Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-XL454e14ex.5                          6 END     1          33       16                hypothetical protein LOC780038 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012797043 Xl3.1-xlk150f04ex.3 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk150f04ex.3 TATATATATATATATATATATATATAGGTATATATATATATATATATCTACGCAGCTGTCTGCATGTCCCTCTTGCCAAACTATATAGCAATCTTTTTATATCTGCCTTGTAGTAGCAGGTGCCCACCACACTGGGGCGCCCGAAGCACATCATTTTACAACAGCAAATTTGATTTGCTATTCTCCTTTCTTATATTTTTAGTCTTTTGTCTGTAGAAGTCGTCGTTGCATTTTGTTTGAACCAAGTGAAATAAGAACTCAGGGCATGTACGTGTGCAGCTATGACCTTCTGAGCCCACAGAGTATTTGTCGGTTCTTTATAAATAGATATAATGAGAAGTGAAAGTATCACGGTGGGCCGTCAGTCATTATCCATTATAAAGAGATATATCACCGTCAGTCTCTACTCGATATTACACCCTGTATTTCTGCTATCATCATATTTTCTGCAGGGAAATACTTGTCTGTCTCACTGAAGAGCCTAAACCATTCAAACCCAGGACAGGTTTCTTTTGTACGACCAATGCCAGAGTGAAATAAATCAAATGTCAATAAAACAGGATATTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012711434       TATATATATATATATATATAGGTATATATATATATCTATATCTACGCAGCTGTCTGCATGTCCCTCTTGCCAAACTATATAGCAATCTTTTTATATCTGCCTTGTAGTAGCAGGTGCCCACCACACTGGGGCGCCCGAAGCACATCATTTTACAACAGCAAATTTGATTTGCTATTCTCCTTTCTTATATTTTTAGTCTTTTGTCTGTAGAAGTCGTCGTTGCATTTTGTTTGAACCAAGTGAAATAAGAACTCAGGGCATGTACGTGTGCAGCTATGACCTTCTGAGCCCACAGAGTATTTGTCGGTTCTTTATAAATAGATATAATGAGAAGTGAAAGTATCACGGTGGGCCGTCAGTCATTATCCATTATAAAGAGATATATCACCGTCAGTCTCTACTCGATATTACACCCTGTATTTCTGCTATCATCATATTTTCTGCAGGGAAATACTTGTCTGTCTCACTGAAGAGCCTAAACCATTCAAACCCAGGACAGGTTTCTTTTGTACGACCAATGCCAGAGTGAAATAAATCAAATGTCAATAAAACAGGATATTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
                                                      consensus depths      1     1     1     1     1     1     2     3     2     3     2     3     2     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     1     2     1     2     1     1
                                                   Xl3.1-xlk150f04ex.3                         TAG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------TGA------TGA---------------------------------TGA---------------------------------------TAG---TAATGA------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------TAA
  3   1   1       add Ov1       out                   IMAGE:5074799.3p TATATATATATATATATATATATATAGGTATATATATATATCTCTACGCAGCTGTCTGCATGTCCCTCTTGCCAAACTATATAGGTAGCAATCTTTTTATATCTGCCTTGTAGTAGCAGGTGCCCACCACACTGGGGCGCCCGAAGCACATCATTTTACAACAGCAAATTTGATTTGCTATTCTCCTTTCTTAGATTTTTAGTCTTTTGTCTGTAGAAGTCGTCGTTGCATTTTGTTTGAACCAAGTGAAATAAGAACTCAGGGCATGTACGTGTGCAGCTATGACCTTTTGAGCCCACAGAGTATTTGTCGGTTCTTTATAAATAGATATAATGAGAAGTGAAAGTATCCCGGTGGGCCGTCAGTCATTATCCATTATAAAGAGATATATCCCTGTCAGTCTCTACTCGATATTACACCCTGTATTTCTGCTATCATCATATTTTCTGCAGGGAAATACTTGTCTGTCTCACTGAAGAGCCTAAACCATTCAAACCCAGGACAGGTTTCTTTTGTACGACCAATGCCAGAGTGAAATAAATCAAATGTCAATAAAACAGGATATTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2       bld Ga18      in                      xlk150f04ex.5p                                 tatatatatatatatCTACGCAGCTGTCTNCATGTCCCTCTTGCCAAACTATATAGCAATCTTTTTATATCTGCCTTGTAGTAGCAGGTNNCCACCACACTGGGGCGCCCGAAGCACATCATTTTACAACAGCAAATTTGATTTGCTATTCTCCTTTCTTATATTTTTAGTCTTTTGTCTGTAGAAGTCGTCGTTGCATTTTGTTTGAACCAAGTGAAATAAGAACTCAGGGCATGTACGTGTGCAGCTATGACCTTCTGAGCCCACAGAGTATTTGTCGGTTCTTTATAAATAGATATAATGAGAAGTGAAAGTATCACGGTGGGCCGTCAGTCATTATCCATTATAAAGAGATATATCACCGTCAGTCTCTACTCGATATTACACCCTGTATTTCTGCTATCATCATATTTTCTGCAGGGAAATACTTGTCTGTCTCACTGAAGAGCCTAAACCATTCAAACCCAGGACAGGTTTCTTTTGTACGACCAATGCCAGAGTGAAATAAATCAAATGTCAATAAAACAGGATATTTTCAAGTGATGTTTTTaaaaaaaaaa
  3   1   2      seed Ga18      in                      xlk150f04ex.3p                                 TATATATATATATATCTACGCAGCTGTCTGCATGTCCCTCTTGCCAAACTATATAGCAATCTTTTTATATCTGCCTTGTAGTAGCAGGTGCCCACCACACTGGGGCGCCCGAAGCACATCATTTTACAACAGCAAATTTGATTTGCTATTCTCCTTTCTTATATTTTTAGTCTTTTGTCTGTAGAAGTCGTCGTTGCATTTTGTTTGAACCAAGTGAAATAAGAACTCAGGGCATGTACGTGTGCAGCTATGACCTTCTGAGCCCACAGAGTATTTGTCGGTTCTTTATAAATAGATATAATGAGAAGTGAAAGTATCACGGTGGGCCGTCAGTCATTATCCATTATAAAGAGATATATCACCGTCAGTCTCTACTCGATATTACACCCTGTATTTCTGCTATCATCATATTTTCTGCAGGGAAATACTTGTCTGTCTCACTGAAGAGCCTAAACCATTCAAACCCAGGACAGGTTTCTTTTGTACGACCAATGCCAGAGTGAAATAANTCAAATGTCAATAANNC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)