Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-rxlk141k20ex.3                        6 END     1          50       16                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL013j21.5                            4 PI      94          1      808                (no blast hit)

 This cluster: approximate FL confidence score = 83%

 1012797182 Xl3.1-xl259l21.5 - 2 ESTs
                                                                       ....-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl259l21.5                                                                                                                                                                                                                                                                                                                                                                                                                                         CACGGAGCAGCAGTGGCCGGAGAGGTAACCCGGGGACCGCGGAGCCATCATCAACACAGCACCGCGTGCTATAACTGCCTGGGTAGCCGGACGGAGAAACCAGTATGCAGAATTCAGACAGTGGATCAGACTCGGCAACATCTGTTGCTCTAAGAACATCGGCATCGGCACAAGCTCCTGTAGTGCAGCCTGTACCAGCATCTCAACAGGTCCAGACTGTCCAACATGTCTATCCAGCTCAAGTGCAGTATGTGGAAGGGGATACAGTGTACACCAATGGAGCCATCCGTACAGCTTACTCCTACAATGCGGAAGCCCAGATCTACGCGCCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGAGGTGCTCAGGTCACCACAGTGGTCTCTAGCCCTACAGCAATCCCTTCCCACAGTATGGTGGGTATCGCCATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATTCATGGAGGACTGGAGAATTCTCGCCATGCACCCTCTCACACTTCTCGTACCTTTCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGCTGGATAATTATGAGACAGCGGAAGGCGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGGCACTGCCAGGACCACAAACTTGATCCAGTTAATGCGGCATCCTTTGGCAAACTCATTCGCTCAGTGTTCATGGGCCTGAGAACACGACGACTTGGTACCAGAGGTAACTCAAAATACCATTATTATGGCATTCGTCTGAAGCCAGATTCTCCTCTGAACCGCCTGCAGGAGGATACACAGTATATGGCAATAAGACAGCAACCCATCCACCAGAAGCAAAGATACAGGCCTGCACAGAAGATGGATGGAATGGGAGATAATCCAGCCAACAGCAGCCAACATACCTCTCCAGAACAATCTGTTGCAGCTCAAAGTCAGCATCATCAGCAATTTATAGATACATCACATGTGTTCCCAGACTTCCCAGCACCTGATTTGGGCAGTTTGCTGTTACCAGAAGGCATCACTATGACCGACATAAAAAACCTCCAGCTTATGTACCGGCGGCACTGTGAGTGAGGATGAACAGGAGCCAACTATCCCAAAAGACAAGCTGATGGTGCTTTGTAAATATGAACCCATTATGAGGTGGATGAGAAACTGTGATCACATTCTTTACCAAGCGCTGGTGGAGATACTCATCCCTGATGTACTAAGACCCTGTTCCAGTACTTTGACCCAGGCAATTCGGAATTTTGCCAAGAGTTTGGAGGGCTGGCCTTACCAATGCCATGGTGTGATTTCCCACAGCAGATAGTTCATGCCAAGGGTTGGAGTAGTAAAGTGCCTTTTGCACAAAACGCCTCCGCCGGTTACACCGTCCTTTAAATCATTTTTGGGC
                                                  Xl3.1-CHK-1012718763                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAGCAGTGGCCGGAGAGGTAACCCGGGGACCGCGGAGCCATCATCAACACAGCACCGCGTGCTATAACTGCCTGGGTAGCCGGACGGAGAAACCAGTATGCAGAATTCAGACAGTGGATCAGACTCGGCAACATCTGTTGCTCTAAGAACATCGGCATCGGCACAAGCTCCTGTAGTGCAGCCTGTACCAGCATCTCAACAGGTCCAGACTGTCCAACATGTCTATCCAGCTCAAGTGCAGTATGTGGAAGGGGATACAGTGTACACCAATGGAGCCATCCGTACAGCTTACTCCTACAATGCGGAAGCCCAGATCTACGCGCCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGAGGTGCTCAGGTCACCACAGTGGTCTCTAGCCCTACAGCAATCCCTTCCCACAGTATGGTGGGTATCGCCATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATTCATGGAGGACTGGAGAATTCTCGCCATGCACCCTCTCACACTTCTCGTACCTTTCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGCTGGATAATTATGAGACAGCGGAAGGCGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGGCACTGCCAGGACCACAAACTTGATCCAGTTAATGCGGCATCCTTTGGCAAACTCATTCGCTCAGTGTTCATGGGCCTGAGAACACGACGACTTGGTACCAGAGGTAACTCAAAATACCATTATTATGGCATTCGTCTGAAGCCAGATTCTCCTCTGAACCGCCTGCAGGAGGATACACAGTATATGGCAATAAGACAGCAACCCATCCACCAGAAGCAAAGATACAGGCCTGCACAGAAGATGGATGGAATGGGAGATAATCCAGCCAACAGCAGCCAACATACCTCTCCAGAACAATCTGTTGCAGCTCAAAGTCAGCATCATCAGCAATTTATAGATACATCACATGTGTTCCCAGACTTCCCAGCACCTGATTTGGGCAGTTTGCTGTTACCAGAAGGCATCACTATGACCGACATAAAAAACCTCCAGCTTATGTACCGGCGGCACTGTGAGTGAGGATGAACAGGAGCCAACTATCCCAAAAGACAAGCTGATGGTGCTTTGTAAATATGAACCCATTATGAGGTGGATGAGAAACTGTGATCACATTCTTTACCAAGCGCTGGTGGAGATACTCATCCCTGATGTACTAAGACCCTGTTCCAGTACTTTGACCCAGGCAATTCGGAATTTTGCCAAGAGTTTGGAGGGCTGGCCTTACCAATGCCATGGTGTGATTTCCCACAGCAGATAGTTCATGCCAAGGGTTGGAGTAGTAAAGTGCCTTTTGCACAAAACGCCTCCGCCGGTTACACCGTCCTTTAAATCATTTTTGGGCTCAAGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     104     293                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ce ---- 4e-029     NP_001022140.1 abnormal DAuer Formation family member (daf-19) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 2e-054     NP_649999.2 CG6312-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ci ---- 3e-079     NP_001071807.1 regulatory factor X [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Sp ==== 2e-083     XP_001189925.1 PREDICTED: similar to regulatory factor X3 [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 2e-132     NP_033082.1 vregulatory factor X, 2 (influences HLA class II expression); regulatory factor(trans-acting) 2 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 2e-176     NP_001013296.1 zgc:91808 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 0          NP_000626.2 regulatory factor X2 isoform a; trans-acting regulatory factor 2; DNA bindingprotein RFX2; HLA class II regulatory factor RFX2 [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Bt ==== 0          NP_001095642.1 regulatory factor X2 [Bos taurus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Cf ==== 0          XP_533937.2 PREDICTED: similar to regulatory factor X2 isoform a isoform 1 [Canis familiaris] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Gg ---- 0          XP_418212.2 PREDICTED: hypothetical protein [Gallus gallus] -----===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Xl ==== 0          NP_001090132.1 hypothetical protein LOC735210 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 0          NP_001116955.1 regulatory factor X, 2 (influences HLA class II expression) [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl259l21.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAA---------TAG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------TGA---TGA------------------------------------------TAA---TGA---------------------------TGA---------------------------------------TGA------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ...
  5   1   2      seed DMZ  5g3  out                        xl259l21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         CACGGAGCAGCAGTGGCCGGAGAGGTAACCCGGGGACCGCGGAGCCATCATCAACACAGCACCGCGTGCTATAACTGCCTGGGTAGCCGGACGGAGAAACCAGTATGCAGAATTCAGACAGTGGATCAGACTCGGCAACATCTGTTGCTCTAAGAACATCGGCATCGGCACAAGCTCCTGTAGTGCAGCCTGTACCAGCATCTCAACAGGTCCAGACTGTCCAACATGTCTATCCAGCTCAAGTGCAGTATGTGGAAGGGGATACAGTGTACACCAATGGAGCCATCCGTACAGCTTACTCCTACAATGCGGAAGCCCAGATCTACGCGCCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGAGGTGCTCAGGTCACCACAGTGGTCTCTAGCCCTACAGCAATCCCTTCCCACAGTATGGTGGGTATCGCCATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATTCATGGAGGACTGGAGAATTCTCGCCATGCACCCTCTCACACTTCTCGTACCTTTCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGCTGGATAATTATGAGACAGCGGAAGGCGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGC
  5   1   2       bld Emb1                            IMAGE:6635539.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATGAGACAGCGGAAGGCGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGGCACTGCCAGGACCACAAACTTGATCCAGTTAATGCGGCATCCTTTGGCAAACTCATTCGCTCAGTGTTCATGGGCCTGAGAACACGACGACTTGGTACCAGAGGTAACTCAAAATACCATTATTATGGCATTCGTCTGAAGCCAGATTCTCCTCTGAACCGCCTGCAGGAGGATACACAGTATATGGCAATAAGACAGCAACCCATCCACCAGAAGCAAAGATACAGGCCTGCACAGAAGATGGATGGAATGGGAGATAATCCAGCCAACAGCAGCCAACATACCTCTCCAGAACAATCTGTTGCAGCTCAAAGTCAGCATCATCAGCAATTTATAGATACATCACATGTGTTCCCAGACTTCCCAGCACCTGATTTGGGCAGTTTGCTGTTACCAGAAGGCATCACTATGACCGACATAAAAAACCTCCAGCTTATGTACCGGCGGCACTGTGAGTGAGGATGAACAGGAGCCAACTATCCCAAAAGACAAGCTGATGGTGCTTTGTAAATATGAACCCATTATGAGGTGGATGAGAAACTGTGATCACATTCTTTACCAAGCGCTGGTGGAGATACTCATCCCTGATGTACTAAGACCCTGTTCCAGTACTTTGACCCAGGCAATTCGGAATTTTGCCAAGAGTTTGGAGGGCTGGCCTTACCAATGCCATGGTGTGATTTCCCACAGCAGATAGTTCATGCCAAGGGTTGGAGTAGTAAAGTGCCTTTTGCACAAAACGCCTCCGCCGGTTACACCGTCCTTTAAATCATTTTTGGGCTCAAGACN

In case of problems mail me! (mike.gilchrist@crick.ac.uk)