Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012797212 Xl3.1-XL071i05.5 - 2 ESTs
                                                                       ....-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL071i05.5                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCAGCCTCACATGGACTAGTCTTGATCTGCTGTGAGCCAGCGGCCCCTTCCCACAGGATGAACTGTCTCGTTTATGCTCTAGGATCCCTTTTCCTTCTGAGTGGGCTCCTCCTCCCCAGCTCCGAAGGGAAGAAGAAGGTTAGTGGATCACAGGGAGCCATTCCTCCCCCTGACAAAGGGCAGCCCAATGACTCTGAGCAAGGTCAAGCTCAGCCAGGAGACCGGGTCAGAGGGAAGGGGAAGGGACAAGCACTAGCGGCTGAAGAAGTGCTGGAGTCCAGTCAAGAAGCTCTACACGTCACTGAACGCAGTATCTAAAGAGGGACTGGTGTAAGACTCAGCCCTTAAAGCAAACAATTCACGAGGACGGGTGCAACAGTCGTACCATCATCAACCGCTTCTGCTATGGGCAATGCAACTCCTTCTACATCCCCCGTCACATACGCAGGGAGGAGGGCTCATTTCAATCCTGCTCCTTCTGCAAGCCTAAAAAATTCACCACAATGGTGGTCACCCTGAACTGCCCAGAGCTACAACCTCCCACAAAGAAGAAGAGAATTACACGTGTCAAGCAGTGTCGCTGCATCTCCATAGACCTGGACTAATGTGCCGCTGGGCCTGTGAATACTAAAATAATGTACTGGGAGCTTCACTCTTCATATCCATACCATTACTGTCTGTGCCAAGACCATCAAACCACAATCCTCACAGGCATTCTGTTGTGTCCGAGCTACTTTATGCTTTTCATGCTAATACACCATCAGCAGGAATCCAAACAAGCAATAAATATCTAGATTTCCTCCTTCTGCTGAACTGTCCCGAACAGCGTTGGGTTCTTTATCCTTTTTTTTAGGGAATGTGGAGGCCTGCAAAGACGGCATCCAAGTATACATTGTGTACATATATATTATTTATTCTCACG
                                                  Xl3.1-CHK-1012718994                                                                                                                                                                                                                                                                                                                                                                                                                           CCTCACATGGACTAGTCTTGATCTGCTGTGAGCCAGCGGCCCCTTCCCACAGGATGAACTGTCTCGTTTATGCTCTAGGATCCCTTTTCCTTCTGAGTGGGCTCCTCCTCCCCAGCTCCGAAGGGAAGAAGAAGGTTAGTGGATCACAGGGAGCCATTCCTCCCCCTGACAAAGGGCAGCCCAATGACTCTGAGCAAGGTCAAGCTCAGCCAGGAGACCGGGTCAGAGGGAAGGGGAAGGGACAAGCACTAGCGGCTGAAGAAGTGCTGGAGTCCAGTCAAGAAGCTCTACACGTCACTGAACGCAGTATCTAAAGAGGGACTGGTGTAAGACTCAGCCCTTAAAGCAAACAATTCACGAGGACGGGTGCAACAGTCGTACCATCATCAACCGCTTCTGCTATGGGCAATGCAACTCCTTCTACATCCCCCGTCACATACGCAGGGAGGAGGGCTCATTTCAATCCTGCTCCTTCTGCAAGCCTAAAAAATTCACCACAATGGTGGTCACCCTGAACTGCCCAGAGCTACAACCTCCCACAAAGAAGAAGAGAATTACACGTGTCAAGCAGTGTCGCTGCATCTCCATAGACCTGGACTAATGTGCCGCTGGGCCTGTGAATACTAAAATAATGTACTGGGAGCTTCACTCTTCATATCCATACCATTACTGTCTGTGCCAAGACCATCAAACCACAATCCTCACAGGCATTCTGTTGTGTCCGAGCTACTTTATGCTTTTCATGCTAATACACCATCAGCAGGAATCCAAACAAGCAATAAATATCTAGATTTCCTCCTTCTGCTGAACTGTCCCGAACAGCGTTGGGTTCTTTATCCTTTTTTTTAGGGAATGTGGAGGCCTGCAAAGACGGCATCCAAGTATACATTGTGTACATATATATTATTTATT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                          1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN     202      57                                                                                                                                                                                                                                                                                                                                                                                                                     
                                                                       PROTEIN --- Ce ---- 1e-017     NP_001023876.2 F35B12.10 [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ci ---- 1e-020     NP_001071676.1 DAN protein [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ag ---- 1e-032     XP_555475.3 AGAP007994-PA [Anopheles gambiae str. PEST] ============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Dr ---- 9e-051     XP_001344700.2 PREDICTED: similar to Gremlin-1 precursor (Cysteine knot superfamily 1, BMP antagonist 1) (Down-regulated in Mos-transformed cells protein) [Danio rerio] -===============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Gg ---- 2e-054     NP_990309.1 gremlin [Gallus gallus] -----------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Xt ---- 4e-056     NP_001093701.1 gremlin 1 [Xenopus tropicalis] -------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Mm ---- 1e-056     NP_035954.1 cysteine knot superfamily 1, BMP antagonist 1; down-regulated inv-mos-transformed cells; Gremlin1 [Mus musculus] ------======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Cf ---- 1e-056     XP_544600.1 PREDICTED: similar to cysteine knot superfamily 1, BMP antagonist 1 [Canis familiaris] -----==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Hs ---- 1e-056     NP_037504.1 cysteine knot superfamily 1, BMP antagonist 1 [Homo sapiens] -------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Xl ---- 1e-056     NP_001083746.1 gremlin [Xenopus laevis] ----------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Bt ---- 7e-057     NP_001075919.1 gremlin-1 [Bos taurus] ------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL071i05.5                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGA---------------------------------------------------------------------------------------------------------TAG---------------------------TGA---------------TGA---TGA---------------------------------------------------------------TGA---------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------TAA------------------------------ATG---------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------TAG---------------TGA
  5   1   2      seed Tbd7      in                         XL071i05.5p                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCAGCCTCACATGGACTAGTCTTGATCTGCTGTGAGCCAGCGGCCCCTTCCCACAGGATGAACTGTCTCGTTTATGCTCTAGGATCCCTTTTCCTTCTGAGTGGGCTCCTCCTCCCCAGCTCCGAAGGGAAGAAGAAGGTTAGTGGATCACAGGGAGCCATTCCTCCCCCTGACAAAGGGCAGCCCAATGACTCTGAGCAAGGTCAAGCTCAGCCAGGAGACCGGGTCAGAGGGAAGGGGAAGGGACAAGCACTAGCGGCTGAAGAAGTGCTGGAGTCCAGTCAAGAAGCTCTACACGTCACTGAACGCAGTATCTAAAGAGGGACTGGTGTAAGACTCAGCCCTTAAAGCAAACAATTCACGAGGACGGGTGCAACAGTCGTACCATCATCAACCGCTTCTGCTATGGGCAATGCAACTCCTTCTACATCCCCCGTCACATACGCAGGGAGGAGGGCTCATTTCAATCCTGCTCCTTCTGCAAGCCTAAAAAATTCACCACAATGGTGGTCACCCTGAACTGCCCAGAGCTACAACCTCCCACAAAGAAGAAGAGAATTACACGTGTCAAGCAGTGTCGCTGCATCTCCATAGACCTGGACTAATGTGCCGCTGGGCCTGTGAATACTAAAATAATGTACTGGGAGCTTCACTCTTCATATCCATACCATTACTGTC
  3   1   2       bld Tbd7      in                         XL071i05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGACAAGCACTAGCGGCTGAAGAAGTGCTGGAGTCCAGTCAAGAAGCTCTACACGTCACTGAACGCAGTATCTAAAGAGGGACTGGTGTAAGACTCAGCCCTTAAAGCAAACAATTCACGAGGACGGGTGCAACAGTCGTACCATCATCAACCGCTTCTGCTATGGGCAATGCAACTCCTTCTACATCCCCCGTCACATACGCAGGGAGGAGGGCTCATTTCAATCCTGCTCCTTCTGCAAGCCTAAAAAATTCACCACAATGGTGGTCACCCTGAACTGCCCAGAGCTACAACCTCCCACAAAGAAGAAGAGAATTACACGTGTCAAGCAGTGTCGCTGCATCTCCATAGACCTGGACTAATGTGCCGCTGGGCCTGTGAATACTAAAATAATGTACTGGGAGCTTCACTCTTCATATCCATACCATTACTGTCTGTGCCAAGACCATCAAACCACAATCCTCACAGGCATTCTGTTGTGTCCGAGCTACTTTATGCTTTTCATGCTAATACACCATCAGCAGGAATCCAAACAAGCAATAAATATCTAGATTTCCTCCTTCTGCTGAACTGTCCCGAACAGCGTTGGGTTCTTTATCCTTTTTTTTAGGGAATGTGGAGGCCTGCAAAGACGGCATCCAAGTATACATTGTGTACATATATATTATTTATTCTCACGTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)