Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 67%

 1012797334 Xl3.1-IMAGE:8075066.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8075066.5 CCCACGCGTCCGGGAGTATTGACCTACTAACACAGATGTGTAGAGCAGCAGGCTGCAGACTGGAGCGGGGAGAGACTGATATTCACACACGTATACACACACATAGGAGGCACCGCTTCACACTCCCAACGTTGTGATTTTTGTTTTATTCTCTGCTTGCCTGGAAAGGAGCAAGTGAAGTCCTTTTACGTTAAAAAGGAGCAAAAACGGATGCAAGCGCTAATGCAGGTCAAATTATTGTTCCTGAGCATAAAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATTTCGCCAGCAGATGGAATTTAATCTAATTACGAGCATCAAGTTGACGTGAAATTGCTCTTTTTTAGGAGCTGCGGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAAATGCCAACAATTAAAAAAGAGCAAGAATGTGCAGATTCACGTATGGAAAATATTCTTGTTCTTAGTTCAAATATACCAGACATGTCAGAATCCATGGACTCCAGTAATGATATGTTGTACAGCGACGGGCTACCAGTAAAAAACAAAAGCTCCTCATGTCGGAGAAAAAGGGAATTCATCCCAGATGAAAAGAAAGATGCTATGTATTGGGAAAAAAGACGGAAAACAATGAAGCTGCAAAAAGGTCTAGAGAAAAACGGAAGGTTAATGACATGGTTTTGGAAAATAATTTCATGCACTAGGAGAGAAGAATGCAGTCTGAAAACAGACTGCTGTCATT
                                                  Xl3.1-CHK-1012713215       CGTCCGGGAGTATTGACCTACTAACACAGATGTGTAGAGCAGCAGGCTGCAGACTGGAGCGGGGAGAGACTGATATTCACACACGTATACACACACATAGGAGGCACCGCTTCACACTCCCAACGTTGTGATTTTTGTTTTATTCTCTGCTTGCCTGGAAAGGAGCAAGTGAAGTCCTTTTACGTTAAAAAGGAGCAAAAACGGATGCAAGCGCTAATGCAGGTCAAATTATTGTTCCTGAGCATAAAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATTTCGCCAGCAGATGGAATTTAATCTAATTACGAGCATCAAGTTGACGTGAAATTGCTCTTTTTTAGGAGCTGCGGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAAATGCCAACAATTAAAAAAGAGCAAGAATGTGCAGATTCACGTATGGAAAATATTCTTGTTCTTAGTTCAAATATACCAGACATGTCAGAATCCATGGACTCCAGTAATGATATGTTGTACAGCGACGGGCTACCAGTAAAAAACAAAAGCTCCTCATGTCGGAGAAAAAGGGAATTCATCCCAGATGAAAAGAAAGATGCTATGTATTGGGAAAAAAGACGGAAAACAATGAAGCTGCAAAAAGGTCTAGAGAAAAACGGAAGGTTAATGACATGGTTTTGGAAAATAATTTxxTGCACTAGGAGAxxAGAATGCAGTCTGAAAACAGACTGCTGTCATTAAACTT
                                                      consensus depths      1     1     1     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     3     1     3     1     3     1     3     1     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     1     1     1
                                               BLH ATG     260      19 
                                               BLH MIN     413      20 
                                               BLH MPR     401      20 
                                               BLH OVR     416     160 
                                               CDS MIN     416      20 
                                               ORF LNG     416       1 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 1e-011     NP_001004120.1 zgc:100867 [Danio rerio] ====================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Cf ==== 1e-018     XP_533548.2 PREDICTED: similar to nuclear factor, interleukin 3 regulated [Canis familiaris] ==============================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Mm ==== 7e-019     XP_001475867.1 PREDICTED: similar to NFIL3/E4BP4 transcription factor [Mus musculus] ======================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Gg ==== 3e-019     NP_989949.1 nuclear factor, interleukin 3 regulated [Gallus gallus] =======================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Bt ==== 3e-019     NP_001068708.1 nuclear factor, interleukin 3 regulated [Bos taurus] =======================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Hs ==== 9e-020     NP_005375.2 nuclear factor, interleukin 3 regulated [Homo sapiens] ========================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Xt ==== 4e-036     Q5FW38.1 Nuclear factor interleukin-3-regulated protein [Xenopus tropicalis]  ============================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 3e-039     NP_001087679.1 MGC82043 protein [Xenopus laevis] ==========================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8075066.5                                    ATG------------------------------------------------------------------------------------------------TGA------------------------------------------------------TAA------------------------------------------------------------------ATG------------------TGA---------------------------------------TAA---------------TGA------------------TAG------------------------------------------TGA------ATG---------------------------------------ATG------------------------------------ATG---------ATG---------------ATG---------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                              ...
  5   1   2       bld Kid  5g                         IMAGE:7011102.5p CCCACGCGTCCGGGAGTATTGACCTACTAACACAGATGTGTAGAGCAGCAGGCTGCAGACTGGAGCGGGGAGAGACTGATATTCACACACGTATACACACACATAGGAGGCACCGCTTCACACTCCCAACGTTGTGATTTTTGTTTTATTCTCTGCTTGCCTGGAAAGGAGCAAGTGAAGTCCTTTTACGTTAAAAAGGAGCAAAAACGGATGCAAGCGCTAATGCAGGTCAAATTATTGTTCCTGAGCATAAAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATTTCGCCAGCAGATGGAATTTAATCTAATTACGAGCATCAAGTTGACGTGAAATTGCTCTTTTTTTAGGAGCTGCGGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAAATGCCAACAATTAAAAAAGAGCAAGAATGTGCAGATTCACGTATGGAAAATATTCTTGTTCTTAGTTCAAATATACCAGACATGTCAGAATCCATGGACTCCAGTAATGATATGTTGTACAGCGACGGGCTACCAGTAAAAAACAAAAGCTCCTCATGTCGGAGAAAAAGGGAATTCATCCCAGATGAAAAGAAAGATGCTATGTATTGGGAAAAAAGACGGANAAACAATGAAGCTGCAAAAAGGTCTAGAGAANAACGGAGGTTAAATGACATGGTTTTGGAAAATAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTT
  5   1   1       add FaBN 5g                         IMAGE:8075066.5p        GATTCCCGGGATTGACCTACTAACACAGATGTGTAGAGCAGCAGGCTGCAGACTGGAGCGGGGAGAGACTGATATTCACACACGTATACACACACATAGGAGGCACCGCTTCACACTCCCAACGTTGTGATTTTTGTTTTATTCTCTGCTTGCCTGGAAAGGAGCAAGTGAAGTCTTTTTACGTTAAAAAGGAGCAAAAACGGATGCAAGCGCTAATGCAGGTCAAATTATTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATTTCGCCAGCAGATGGAATTTAATCTAATTACCAGCATCAAGTTGACGTGAAATTGCTCTTTTTTAGGAGCTGCGGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAAATGCCAACAATTAAAAAAGAGCAAGAATGTGCAGATTCACGTATGGAAAATATTCTTGTTCTTAGTTCAAATATACCAGACATGTCAGAATCCATGGACTCCAGTAATGATATGTTGTACAGCGACGGGCTACCAGTAAAAACAAAAGCTCCTCATGTCAGAGGAAAAGGGAATTCATCCCAGATGAAAAGAAAGATGCTATGTATTGTgaaaaaagaccgaaaaacaatgaagctgcaaaagcgtctagagaaaaaCGGAAGTTAAATGACATGGTTTTGGAAATAAACTTCATGCACTAGGAGAAGAGATTGCCAGTCTGAAAC
  5   1   2      seed Ov1  5g                         IMAGE:8332598.5p                       CCTACTAACACAGATGTGTAGAGCAGCAGGCTGCAGACTGGAGCGGGGAGAGACTGATATTCACACACGTATACACACACATAGGAGGCACCGCTTCACACTCCCAACGTTGTGATTTTTGTTTTATTCTCTGCTTGCCTGGAAAGGAGCAAGTGAAGTCCTTTTACGTTAAAAAGGAGCAAAAACGGATGCAAGCGCTAATGCAGGTCAAATTATTGTTCCTGAGCATAAAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATTTCGCCAGCAGATGGAATTTAATCTAATTACGAGCATCAAGTTGACGTGAAATTGCTCTTTTTTAGGAGTTGCGGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAAATGCCAACAATTAAAAAAGAGCAAGAATGTGCAGATTCACGTATGGAAAATATTCTTGTTCTTAGTTCAAATATACCAGACATGTCAGAATCCATGGACTCCAGTAATGATATGTTGTACAGCGACGGGCTACCAGTAAAAAACAAAAGCTCCTCATGTCGGAGAAAAAGGGAATTCATCCCagatgaaaagaaagatgctatgtattgggaaaaaagacggaaaacaatgaagctgcaaaaagGTCTAGAGAAAAACGGAAGGTTAATGACATGGTTTTGGAAAATAATTTATTGCACTANGAGAGAAGAATGCAGTCTGAAAACAGACTGCTGTCATTAAACTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)