Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 93%

 1012797429 Xl3.1-IMAGE:3403646-IMAGp.5 - 4 ESTs
                                                                       ........-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3403646-IMAGp.5                                                                                         TCGCGATCTAGAACTAGCGGACGCGTGGGCCGTTGCTCTGATAGGCGGTCGGTGGGAGTTGTACAGCTCAGTGCAAATTCAGGCACATTGAGATGTGGAGCCGGGTGGAGGCTGATAGCTGGACTCGGCGCTGGAACCGAGCTGCTGTCTAGGGAATCTAGTTGCTGTACATTAGCGCAAACCTTCCATGTTGATCAATGGAACTCTGTGATTTGAGGAATGTTCTGTGTAAGCATGTGGCTGCAGCCCAGTTCGGCCATCTAGAAAGAGTGGATCATTCCACTGTGGCATCTTCTTGGATCTGAAGTTGATTATTAGGAGGATCAAGTAAGGAGATTAGAAGAAGCTTACATTGAGAATACTGGGTGTATGTGTGAAATGTCTGCCATAATGGATTGTGATTCTGTCCCAAGTCAAGACTCTCAGTCAGAACTTGCAGAGCGAGTTGCTGCCATTGAAGTGGAAGAAGAGTGTCAGGCTCCAGAAAGAATGAATTCTGATGATATGGATGGACTGAAAAACCACTGCATGAGCTCTGAAACCAGTCAGGATGTATTTCTTTCTTCCCAAGAACAAAGGGATTTAAGCACTTTCCAAAGAGCTTCTTCTCGACCTTCTTTATCAAACAGAAAATTCTCTCTCCAAGAAAGACCTTCTGGAGGCTGCCTTCCATCCCACAATCTAGCCTATGGTCCATATGCAACAGGTCCCGCATCACACATATCTCCAAGGATTGTTCGAAGGCCAACAATAGAGTCCAACCGTGTCTCCATCTCTGATTCAGATGATTGTGTGCGGCTGAACCAATACAAGCTACAGAGTGAAATTGGAAAAGGCTCCTATGGTGTTGTAAAACTGGCCTACAATCAAAGTGATGACAAGTATTATGCAATGAAGGTTTTATCAAAAAAGAGGCTGCTGAAGCAATATGGATTTCCACGTCGACCACCCCCTAGAGGCTCAAAGACTGGGGTCAGGGGATCAAACAAAACCAATGGCTTCCACTGGACAGGGTGTATCAGGAAATAGCTATTTTGAAAAAACTGGATCATGTAAATATTGTCAGATTGATTGAGGTACTAGATGATCCAGCTGAAGACAATCTGTATATGGTGTTTGACCTCTTACGCAAAGGGCCTGTAATGGAAGTACCAAGCGAGCATCCTTTTGTAGAAGATCAAGCTAGAGTTTACTTCAGGGACATTGTTTTAGGCATTGAATACTTGCATTACCAGAAGATCATTCATCGGGATATCAAACCATCCAACTTACTGGTGGGAGATGATGGACATATCAAAATAGCTGATTTTGGTGTGAGCAACCAATTTGAAGGCAATGATGCGCTTCTATCAAGCACTGCAGGGACGCCTGCCTTTATGGCTCCTGAGACACTTGCAGATTCTGCCCAAGGGTTCAGTCGAAAGGCACTTGATGCACGCGCCCTGGGAGTAACCTTTTATTGTCTTGTGTTTGCAAAGTGTCCGTTCACCGCTGAATTCATTCTGACTTTGCATAACAAAATCAGAATGAATTCATCCATGGGAGTAACCCTTTATTGTTTTGTGTTTGCAAAGTGTCCGTTTATGGATGAATTCATTCTGACTTTGCATAACAAAATCAAGTACAAACCAGTGGAGTTTTCAGAAGAACCCTCAATAAGTCTTTAAG
                                                  Xl3.1-CHK-1012707313                                                                                               TCTAGAACTAGCGGACGCGTGGGCCGTTGCTCTGATAGGCGGTCGGTGGGAGTTGTACAGCTCAGTGCAAATTCAGGCACATTGAGATGTGGAGCCGGGTGGAGGCTGATAGCTGGACTCGGCGCTGGAACCGAGCTGCTGTCTAGGGAATCTAGTTGCTGTACATTAGCGCAAACCTTCCATGTTGATCAATGGAACTCTGTGATTTGAGGAATGTTCTGTGTAAGCATGTGGCTGCAGCCCAGTTCGGCCATCTAGAAAGAGTGGATCATTCCACTGTGGCATCTTCTTGGATCTGAAGTTGATTATTAGGAGGATCAAGTAAGGAGATTAGAAGAAGCTTACATTGAGAATACTGGGTGTATGTGTGAAATGTCTGCCATAATGGATTGTGATTCTGTCCCAAGTCAAGACTCTCAGTCAGAACTTGCAGAGCGAGTTGCTGCCATTGAAGTGGAAGAAGAGTGTCAGGCTCCAGAAAGAATGAATTCTGATGATATGGATGGACTGAAAAACCACTGCATGAGCTCTGAAACCAGTCAGGATGTATTTCTTTCTTCCCAAGAACAAAGGGATTTAAGCACTTTCCAAAGAGCTTCTTCTCGACCTTCTTTATCAAACAGAAAATTCTCTCTCCAAGAAAGACCTTCTGGAGGCTGCCTTCCATCCCACAATCTAGCCTATGGTCCATATGCAACAGGTCCCGCATCACACATATCTCCAAGGATTGTTCGAAGGCCAACAATAGAGTCCAACCGTGTCTCCATCTCTGATTCAGATGATTGTGTGCGGCTGAACCAATACAAGCTACAGAGTGAAATTGGAAAAGGCTCCTATGGTGTTGTAAAACTGGCCTACAATCAAAGTGATGACAAGTATTATGCAATGAAGGTTTTATCAAAAAAGAGGCTGCTGAAGCAATATGGATTTCCACGTCGACCACCCCCTAGAGGCTCAAAGACTGGGGTCAGGGGATCAAACAAAACCAATGGCTTCCACTGGACAGGGTGTATCAGGAAATAGCTATTTTGAAAAAACTGGATCATGTAAATATTGTCAGATTGATTGAGGTACTAGATGATCCAGCTGAAGACAATCTGTATATGGTGTTTGACCTCTTACGCAAAGGGCCTGTAATGGAAGTACCAAGCGAGCATCCTTTTGTAGAAGATCAAGCTAGAGTTTACTTCAGGGACATTGTTTTAGGCATTGAATACTTGCATTACCAGAAGATCATTCATCGGGATATCAAACCATCCAACTTACTGGTGGGAGATGATGGACATATCAAAATAGCTGATTTTGGTGTGAGCAACCAATTTGAAGGCAATGATGCGCTTCTATCAAGCACTGCAGGGACGCCTGCCTTTATGGCTCCTGAGACACTTGCAGATTCTGCCCAAGGGTTCAGTCGAAAGGCACTTGATGCACGCGCCCTGGGAGTAACCTTTTATTGTCTTGTGTTTGCAAAGTGTCCGTTCACCGCTGAATTCATTCTGACTTTGCATAACAAAATCAGAATGAATTCATCCATGGGAGTAACCCTTTATTGTTTTGTGTTTGCAAAGTGTCCGTTTATGGATGAATTCATTCTGACTTTGCATAACAAAATCAAGTACAAACCAGTGGAGTTTTCAGAAGAACCCTCAATAAGTCTTTAAGATCATT
                                                      consensus depths                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     1     2     2     2     2     2     2     2     2     3     1     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     369     549                                                                                         
                                               BLH MIN     950     114                                                                                         
                                               BLH MPR     369      40                                                                                         
                                               BLH OVR     369      59                                                                                         
                                               ORF LNG     369       8                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ci ---- 4e-022     NP_001027631.1 calmodulin-dependent protein kinase homologue [Ciona intestinalis] -------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                           PROTEIN --- Dm ---- 1e-075     NP_001036634.1 CG17698-PB, isoform B [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ce ---- 2e-074     NP_001021153.1 CaM Kinase Kinase family member (ckk-1) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 2e-089     XP_001193084.1 PREDICTED: similar to MGC139717 protein [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - ?? ---- 2e-111     NP_001124097.1 hypothetical protein LOC100170786 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Cf ---- 1e-134     XP_868554.1 PREDICTED: similar to calcium/calmodulin-dependent protein kinase 1 alpha isoform a isoform 2 [Canis familiaris] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Mm ---- 2e-134     NP_061371.2 calcium/calmodulin-dependent protein kinase kinase 1, alpha [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Bt ---- 6e-082     XP_587386.3 PREDICTED: hypothetical protein [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Hs ---- 6e-082     NP_757343.1 calcium/calmodulin-dependent protein kinase 1 alpha isoform a [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Gg ---- 2e-140     XP_001234325.1 PREDICTED: similar to calcium/calmodulin-dependent protein kinase kinase [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Dr ---- 7e-123     NP_001014361.1 hypothetical LOC541526 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 2e-085     NP_001093741.1 calcium/calmodulin-dependent protein kinase kinase 1, alpha [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xl ==== 0          NP_001082316.1 calcium/calmodulin-dependent protein kinase kinase [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:3403646-IMAGp.5                                                                                                                                                                                                                                                                                                              TGA---ATG------------ATG------------------------TAG---------------------------------------------------TAG---------------------------------------------------ATG------ATG---------ATG------------------------------------------------------------------------------------------------ATG------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------TAG------TGA------------ATGTAA------------TGA---------TAGATG------------------------------------------------------TAA---------------------------TAG------------------------------------TAG---------------------------------------------------------------------ATGATG------------TAG------------TGA------------------ATGATG------------------------------------------------------------------------------------------ATG---------------TAA---------------------------------------------------TGA---------------------TGA---------------TAA---------------------------------------ATG---------TGA------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  3  -1   2       bld Ov1       in                    IMAGE:8328788.3p                                                                                         TCGCGATCTAGAACTAGCGGACGCGTGGGCCGTTGCTCTGATAGGCGGTCGGTGGGAGTTGTACAGCTCAGTGCAAATTCAGGCACATTGAGATGTGGAGCCGGGTGGAGGCTGATAGCTGGACTCGGCGCTGGAACCGAGCTGCTGTCTAGGGAATCTAGTTGCTGTACATTAGCGCAAACCTTCCATGTTGATCAATGGAACTCTGTGATTTGAGGAATGTTCTGTGTAAGCATGTGGCTGCAGCCCAGTTCGGCCATCTAGAAAGAGTGGATCATTCCACTGTGGCATCTTCTTGGATCTGAAGTTGATTATTAGGAGGATCAAGTAAGGAGATTAGAAGAAGCTTACATTGAGAATACTGGGTGTATGTGTGAAATGTCTGCCATAATGGATTGTGATTCTGTCCCAAGTCAAGACTCTCAGTCAGAACTTGCAGAGCGAGTTGCTGCCATTGAAGTGGAAGAAGAGTGTCAGGCTCCAGAAAGAATGAATTCTGATGATATGGATGGACTGAAAAACCACTGCATGAGCTCTGAAACCAGTCAGGATGTATTTCTTTCTTCCCAAGAACAAAGGGATTTAAGCACTTTCCAAAGAGCTTCTTCTCGACCTTCTTTATCAAACAGAAAATTCTCTCTCCAAGAAAGACCTTCTGGAGGCTGCCTTCCAT
  5   1   1       add Egg3 5g                         IMAGE:6326843.5p                                                                                                                                                         AGCTCCGTGCATATCCAGGCACATTGAGCTGTAGAGCCGGGAGGAGACTGGCAGCAGAAGCCGGCGCTGGCACCGAGCTCCTATCTAGGAGATCTGGTTGCTCTACATAATCTCAGACCTTCCATGTTGATCAATGGAACTTTGTGATTTGGGGAATGCTCTGTGTAAGCACGTGGCTGGAGCCCAGTTCAGCCATCTAGAAAGAGTGGATCCTTCCATTGTGGCTTCTTCTTGGTTTTGCAGTTGATCACCACAAGGATCAAGGGAAGACAATCGGAGAAGCTTATATTAAGAAGACTGTGTGTATGTGTGAAAGGTCTGCCATAATGGATTGTGATTCTGTCCCAAGTCAAGACGCTCAGTCAGAACTTGCAGAGCGAGTTGCTGCTATTGAAGTGGATGAAGTATGTCAGGCTCCAGAAAGAATAAATTCTGATGAAATGGATGGACTGAAAAACAACTGCATGAGCTCTGAGACCAGTGAGGATGTATTTCTTTCTTCCCAAGAACAAAGGGACTTGAGCTCTTTCCAAAGGGCTTCTTCTCGACCTTCTTTATCAAACAGAAAATTCTCTCTGCAAGAAAGACCTTCAGGAGGCTGCCTTCCATCCCACAACCTAGCTTATGGTCCATATGCAACAGGTCCCGCATCACACATATCTCCAAAGATTGTTCGAAGGCCAACAATAGAGTCCAACCGTGTCTCCATCTCTGATTCAGATGATTGTGTGCAGCTGAACCAATACAAGCTACAGAGTGAAATTGGCAAAAGTTCATATGGTGGTTTGACCTCTTTACCCAAAGGCGCTTGTATTGGAGGTACCCAGTGAAGCATCCTTTTTGCGGAAGGATCAAGCTATGAATTTAACTTTAAGGGGACATTGGTTCCTGGGCCATTGAAATACTTTGCCTTTTACCAGAAAA
  5   1   2      seed Oo1  5x3               IMAGE:3403646-IMAGp.IMAGp                                                                                                                                                                                                                                                     GAAAAGGACTTATAATATTTCTGTCCGAGAGCCGCGCTAAGGCGATGGTTCCGTTGCTCTGATAGGCGGTAGGTGGGAGTTGTACAGCTCAGTGCAAATTCAGGCACATTGAGATGTGGAGCCGGGTGGAGGCTGATAGCTGGACTCGGCGCTGGAACCGAGCTGCTGTCTAGAAGGAGATTAGAAGAAGCTTACATTGAGAATACTGGGTGTATGTGTGAAATGTCTGCCATAATGGATTGTGATTCTGTCCCAAGTCAAGACTCTCAGTCAGAACTTGCAGAGCGAGTTGCTGCCATTGAAGTGGAAGAAGAGTGTCAGGCTCCAGAAAGAATGAATTCTGATGATATGGATGGACTGAAAAACCACTGCATGAGCTCTGAAACCAGTCAGGATGTATTTCTTTCTTCCCAAGAACAAAGGGATTTAAGCACTTTCCAAAGAGCTTCTTCTCGACCTTCTTTATCAAACAGAAAATTCTCTCTCCAAGAAAGACCTTCTGGAGGCTGCCTTCCATCCCACAATCTAGCCTATGGTCCATATGCAACAGGTCCCGCATCACACATATCTCCAAGGATTGTTCGAAGGCCAACAATAGAGTCCAACCGTGTCTCCATCTCTGATTCAGATGATTGTGTGCGGCTGAACCAATACAAGCTACAGAGTGAAATTGGAAAAGGCTCCTATGGTGTTGTAAAACTGGCCTACAATCAAAGTGATGACAAGTATTATGCAATGAAGGTTTTATCAAAAAAGAGGCTGCTGAAGCAATATGGATTTCCACGTCGACCACCCCCTAGAGGCTCAAAGACTGGGGTCAGGGGATCAAACAAAACCAATGGCTTCCACTGGACAGGGTGTATCAGGAAATAGCTATTTTGAAAAAACTGGATCATGTAAATATTTGCCAGATTGATTGAGGTACTAGAT
  5  -1   1       add Ov1       in                    IMAGE:8328788.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCAATGGCTCCACTGGACAGGGTGTATCAGGAAATAGCTATTTTGAAAAAACTGGATCATGTAAATATTGTCAGATTGATTGAGGTACTAGATGATCCAGCTGAAGACAATCTGTATATGGTGTTTGACCTCTTACGCAAAGGGCCTGTAATGGAAGTACCAAGCGAGCATCCTTTTGTAGAAGATCAAGCTAGAGTTTACTTCAGGGACATTGTTTTAGGCATTGAATACTTGCATTACCAGAAGATCATTCATCGGGATATCAAACCATCCAACTTACTGGTGGGAGATGATGGACATATCAAAATAGCTGATTTTGGTGTGAGCAACCAATTTGAAGGCAATGATGCGCTTCTATCAAGCACTGCAGGGACGCCTGCCTTTATGGCTCCTGAGACACTTGCAGATTCTGCCCAAGGGTTCAGTCGAAAGGCACTTGATGCACGCGCCCTGGGAGTAACCTTTTATTGTCTTGTGTTTGCAAAGTGTCCGTTCACCGCTGAATTCATTCTGACTTTGCATAACAAAATCAGAATGAATTCATCCATGGGAGTAACCCTTTATTGTTTTGTGTTTGCAAAGTGTCCGTTTATGGATGAATTCATTCTGACTTTGCATAACAAAATCAAGTACAAACCAGTGGAGTTTTCAGAAGAACCCTCAATAAGTCTTTAAGATCATTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)