Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-XL147c04.5                            2 END     1          33       50                hypothetical protein LOC496002 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL147c04.5                            2 PI      92          8      713                hypothetical protein LOC496002 [Xenopus laevis]

 This cluster: approximate FL confidence score = 90%

 1012797521 Xl3.1-IMAGE:4202752-IMAGp.5 - 3 ESTs
                                                                       .........-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4202752-IMAGp.5                                                            GCAAGCAGAGGAGTAAACGTTGAACCTCAGCTGGGTGAAGAAGTGTGGTATGGAGAATGGTATTAAGGAAAGTCAAGTGGGTCTGAACAAGAATGGCACCCATGTTATCCTACCCACACCTGTGGTGTCCGAGGAGCCTAAAAATCACAAAAGTATCCTCAACTCTTTGCTGTCTGGGGCTCTTGCTGGAGCTGTAGCTAAAACATCTGTTGCTCCACTGGACAGAACCAAAATCATATTCCAAGTGTCTTCAAACAGATTTTCTGCCAAGGAAGCCTACAGACTGATTTACCGCACATATTTGAATGAAGGCTTCCTAAGTTTGTGGAGAGGTAACTCTGCCACAATGGTGCGTGTGATTCCCTATGCAGCCATACAGTTTTGTGCTCATGAGCAATACAAGAACCTGCTTGGTAGTTATTATGGCTTCCAGGGAAGTGCTTTGACTCCCATTCCTCGACTTCTTGCAGGAGCTCTAGCTGGTACAACAGCTACCATATTGACATATCCCTTGGATCTGGTGCGTGCACGCATGGCAGTTACACCAAAGGAAATGTATAGTAATATCCTTCACGTGTTTATGCGTATGTCAAGAGAGGAGGGTCTTAAGTCACTTTACAGAGGATTTACACCTACAGTGCTTGGTGTCATCCCATATGCAGGGATCAGCTTTTTCACCTACGAAACGCTTAAAAAGCTACATGCAGAACACAGTGGCAGAATGCAACCATACCCCTTTGAGCGATTGCTATTTTGGGGCCTGTGCAGGGTCTCTTTGGACAGTCCTCTTCATACCCATTGGATGTGGTGAGGAGGCGAATGCAGACTGCAGGAGTGACAGGACACACGTATGGATCAATCATTGGCACAATGCAGGAGATAGTGGCAGAAGAAGGTTTTATCCGTGGTCTCTACAAAGGGCTTAGCATGAACTGGGTGAAAGGACCGGTGGCAGTGGGAATAAGCTTCACTACCTTTGATTTAACACAAATCCTCCTAAAAAAGTTGCAGCAAATCTCTCATATCCAGAGGTAGATGAATGAGGAAAAAGGACAGACCCTCAACCTCTTCCCTTCTTGCGGGGCATCATCACAATTAAACAGCAACAAAATCATCACCCACTAACCTGATTGCTAAAACATGCCCTCTTTATCAAGATACCAAATGGTGTTACTTAACTTTTAAAAT
                                                  Xl3.1-CHK-1012710003                                                                  AGAGGAGTAAACGTTGAACCTCAGCTGGGTGAAGAAGTGTGGTATGGAGAATGGTATTAAGGAAAGTCAAGTGGGTCTGAACAAGAATGGCACCCATGTTATCCTACCCACACCTGTGGTGTCCGAGGAGCCTAAAAATCACAAAAGTATCCTCAACTCTTTGCTGTCTGGGGCTCTTGCTGGAGCTGTAGCTAAAACATCTGTTGCTCCACTGGACAGAACCAAAATCATATTCCAAGTGTCTTCAAACAGATTTTCTGCCAAGGAAGCCTACAGACTGATTTACCGCACATATTTGAATGAAGGCTTCCTAAGTTTGTGGAGAGGTAACTCTGCCACAATGGTGCGTGTGATTCCCTATGCAGCCATACAGTTTTGTGCTCATGAGCAATACAAGAACCTGCTTGGTAGTTATTATGGCTTCCAGGGAAGTGCTTTGACTCCCATTCCTCGACTTCTTGCAGGAGCTCTAGCTGGTACAACAGCTACCATATTGACATATCCCTTGGATCTGGTGCGTGCACGCATGGCAGTTACACCAAAGGAAATGTATAGTAATATCCTTCACGTGTTTATGCGTATGTCAAGAGAGGAGGGTCTTAAGTCACTTTACAGAGGATTTACACCTACAGTGCTTGGTGTCATCCCATATGCAGGGATCAGCTTTTTCACCTACGAAACGCTTAAAAAGCTACATGCAGAACACAGTGGCAGAATGCAACCATACCCCTTTGAGCGATTGCTATTTTGGGGCCTxxxxxxGGTCTCTTTGGACAGTCCTCTTCATACCCATTGGATGTGGTGAGGAGGCGAATGCAGACTGCAGGAGTGACAGGACACACGTATGGATCAATCATTGGCACAATGCAGGAGATAGTGGCAGAAGAAGGTTTTATCCGTGGTCTCTACAAAGGGCTTAGCATGAACTGGGTGAAAGGACCGGTGGCAGTGGGAATAAGCTTCACTACCTTTGATTTAACACAAATCCTCCTAAAAAAGTTGCAGCAAATCTCTCATATCCAGAGGTAGATGAATGAGGAAAAAGGACAGACCCTCAACCTCTTCCCTTCTTGCGGGGCATCATCACAATTAAACAGCAACAAAATCATCACCCACTAACCTGATTGCTAAAACATGCCCTCTTTATCAAGATACCAAATGGTGTTACTTAACTTT
                                                      consensus depths                                                                 1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG      49     170                                                            
                                               BLH MIN      49     151                                                            
                                               BLH OVR      49     169                                                            
                                               ORF LNG      49       9                                                            
                                                                                                                                                                                                     PROTEIN --- Ag ==== 2e-074     XP_311055.4 AGAP000097-PA [Anopheles gambiae str. PEST] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 8e-074     NP_996244.1 CG4241-PC, isoform C [Drosophila melanogaster] ---------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                     PROTEIN === Ce ==== 5e-077     NP_492333.1 mitochondrial carrier protein (1J190) [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                               PREDICTED - Sp ---- 1e-090     XP_001194433.1 PREDICTED: similar to LOC496002 protein [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PREDICTED = Mm ==== 4e-132     NP_001007571.1 hypothetical protein LOC73095 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PREDICTED = Hs ==== 8e-130     NP_848621.1 hypothetical protein MGC26694 [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PREDICTED = ?? ==== 2e-131     XP_580755.4 PREDICTED: similar to Solute carrier family 25 member 42 [Bos taurus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PREDICTED = Dr ==== 5e-137     NP_001038918.1 hypothetical protein LOC751743 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                    PREDICTED - Gg ---- 6e-138     XP_424684.2 PREDICTED: similar to LOC496002 protein [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PREDICTED = Cf ==== 5e-133     XP_852174.1 PREDICTED: similar to F43G9.3 [Canis familiaris] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PREDICTED = Xl ==== 3e-168     NP_001088738.1 hypothetical protein LOC496002 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN === Xt ==== 4e-170     Q05AQ3 Solute carrier family 25 member 42 [Xenopus tropicalis]  ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:4202752-IMAGp.5                                                                         TAA---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------ATG---ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---TGA------------------------TGA------------ATG---------------------------TAG---------------------------------------------TGA------TGA---------------------TAA------------------TAA------------TAA------------------------------------TGAATG------------------------------------------------------TAA
                                                                   ORF                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ...
  5   1   2      seed Emb4 5g                IMAGE:4202752-IMAGp.IMAGp                                                            GCAAGCAGAGGAGTAAACGTTGAACCTCAGCTGGGTGAAGAAGTGTGGTATGGAGAATGGTATTAAGGAAAGTCAAGTGGGTCTGAACAAGAATGGCACCCATGTTATCCTACCCACACCTGTGGTGTCCGAGGAGCCTAAAAATCACAAAAGTATCCTCAACTCTTTGCTGTCTGGGGCTCTTGCTGGAGCTGTAGCTAAAACATCTGTTGCTCCACTGGACAGAACCAAAATCATATTCCAAGTGTCTTCAAACAGATTTTCTGCCAAGGAAGCCTACAGACTGATTTACCGCACATATTTGAATGAAGGCTTCCTAAGTTTGTGGAGAGGTAACTCTGCCACAATGGTGCGTGTGATTCCCTATGCAGCCATACAGTTTTGTGCTCATGAGCAATACAAGAACCTGCTTGGTAGTTATTATGGCTTCCAGGGAAGTGCTTTGACTCCCATTCCTCGACTTCTTGCAGGAGCTCTAGCTGGTACAACAGCTACCATATTGACATATCCCTTGGATCTGGTGCGTGCACGCATGGCAGTTACACCAAAGGAAATGTATAGTAATATCCTTCACGTGTTTATGCGTATGTCAAGAGAGGAGGGTCTTAAGTCACTTTACAGAGGATTTACACCTACAGTGCTTGGTGTCATCCCATATGCAGGGATCAGCTTTTTCACCTACGAAACGCTTAAAAAGCTACATGCAGAACACAGTGGCAGAATGCAACCATACCCCTTTGAGCGATTGCTATTTTGGGGCCTGTGCAGGACTCTTTGGGACAGTCTGCTTCATACCCATTGGATGTGGTGAGGAGGCGAATGCAAACTGCAGGAGTGACAGGACACACATATGGATCAATCATCGGCACGATGCAGGAGATAGTGGG
  5   1   2       bld Emb4 5g                         IMAGE:4202752.5p                                                              AAGCAGAGGAGTAAACGTTGAACCTCAGCTGGGTGAAGAAGTGTGGTATGGAGAATGGTATTAAGGAAAGTCAAGTGGGTCTGAACAAGAATGGCACCCATGTTATCCTACCCACACCTGTGGTGTCCGAGGAGCCTAAAAATCACAAAAGTATCCTCAACTCTTTGCTGTCTGGGGCTCTTGCTGGAGCTGTAGCTAAAACATCTGTTGCTCCACTGGACAGAACCAAAATCATATTCCAAGTGTCTTCAAACAGATTTTCTGCCAAGGAAGCCTACAGACTGATTTACCGC
  3   1   1       add Ga12      out                        XL147c04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGCAGCAACTCTGCAGACACGCTGCCAGGACTCCTCCAAAGAAGACAGCGATTCTCCTGCTCCAAAAACGAACACAGTGGCAGGATACAACCATATACCTTTGAGAGATTGCTATTCGGGGCATGTGCAGGTCTCTTTGGACAGTCCTCTTCATACCCATTGGATGTGGTGAGGAGGCGAATGCAGACTGCAGGAGTGACAGGACACACGTATGGATCAATCATTGGCACAATGCAGGAGATAGTGGCAGAAGAAGGTTTTATCCGTGGTCTCTACAAAGGGCTTAGCATGAACTGGGTGAAAGGACCGGTGGCAGTGGGAATAAGCTTCACTACCTTTGATTTAACACAAATCCTCCTAAAAAAGTTGCAGCAAATCTCTCATATCCAGAGGTAGATGAATGAGGAAAAAGGACAGACCCTCAACCTCTTCCCTTCTTGCGGGGCATCATCACAATTAAACAGCAACAAAATCATCACCCACTAACCTGATTGCTAAAACATGCCCTCTTTATCAAGATACCAAATGGTGTTACTTAACTTTTAAAATGGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)