Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012797862 Xl3.1-IMAGE:4031151-IMAGp.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4031151-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTTCCCAGTACAGCATCTCCACCTGTCTCCAGCGCATCCAATGATCCCGTAGGCTCTTATTCAATTAATGGAATCCTGGGTATTCCTCGTTCTAATGGCGAAAAGAGGAAACGCGATGAAGATGGATCTGATGGTTCTGGTCCAAATGGAGATTCCCAGAGCAGTGTTGAAAGTTTACGGAAGCATCTACGGGCTGATAACTTCACTCAGCAGCAACTGGAGGCATTAGATCGAGTCTTTGAGCGTCCTTCTTATCCAGATGTCTTTCAGAGTGCTGAACACATCAAATCTGAACAGGCCAGCGAATACTCCCTTCCAGCGCTCACTCCTGGTCTTGATGAAGTCAAGTCTAGTCTATCAGCATCCGGCAATGCAGACCTAGGAAGCAATGTGTCAGGACCCCAGTCCTACCCTGTAGTAACCGGACGAGATATGTCAAGCACCACTCTTCCAGGTTATCCACCTCATGTACCTCCAACAGGACAAGGCAGCTACCCAACATCAACTCTTGCTGGAATGGTACCTGGCACCAACGTTTCGGTCCACCATTCGGTCCAACCTGTGGAGTGCTGTTCATGTCTTTCCAGCTCTAAACCATGTCTGTTTCACTGCAGGACTGGGAGTGGAAGTGAATTTTCAGGAAATCCTTATAGTCACCCTCAATACACAACCTACAACGAAGCATGGAGGTTCAGCAACCCAGCACTATTAAGTTCCCCTTATTATTATAGTGCCACATCCAGGGGCTCCGCACCTCCCACTGCTGCCACTGCCTATGACCGCCACTAGTTACCATGGAAACCACATGAAACTACAGGGCGACAACATAGGCCTCCATATTGTACCTGTCTGAACTACATCAACTATGCCATCGGAAGAAGAGTGGCCTACTCTGCTTTCCCTACTGACGTTTCTCAGCTGTAATAAGCTGCTCTTACCTCTGCTGCAAGCCTCTTTGTTGTTATTGTGCACGGTAGCTAGATGAACATCAAGCCAAGTCATCTGATTTCAGAACTTATTTCCAAAAAGGCCCACTATTTAAGTTATGCAGTGGATTGTAGTAGGAAACCACAGAACTCATGTCTTCTCCCTCAAAAAAAGGAATGCGGAATATGAATACCTTTTCTAAGACAAACATGCGTGCTACAATAAAGAGAGAAAAACTTTTTATGGGC
                                                  Xl3.1-CHK-1012713278                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTACAGCATCTCCACCTGTCTCCAGCGCATCCAATGATCCCGTAGGCTCTTATTCAATTAATGGAATCCTGGGTATTCCTCGTTCTAATGGCGAAAAGAGGAAACGCGATGAAGATGGATCTGATGGTTCTGGTCCAAATGGAGATTCCCAGAGCAGTGTTGAAAGTTTACGGAAGCATCTACGGGCTGATAACTTCACTCAGCAGCAACTGGAGGCATTAGATCGAGTCTTTGAGCGTCCTTCTTATCCAGATGTCTTTCAGAGTGCTGAACACATCAAATCTGAACAGGCCAGCGAATACTCCCTTCCAGCGCTCACTCCTGGTCTTGATGAAGTCAAGTCTAGTCTATCAGCATCCGGCAATGCAGACCTAGGAAGCAATGTGTCAGGACCCCAGTCCTACCCTGTAGTAACCGGACGAGATATGTCAAGCACCACTCTTCCAGGTTATCCACCTCATGTACCTCCAACAGGACAAGGCAGCTACCCAACATCAACTCTTGCTGGAATGGTACCTGGCACCAACGTTTCGGTCCACCATTCGGTCCAACCTGTGGAGTGCTGTTCATGTCTTTCCAGCTCTAAACCATGTCTGTTTCACTGCAGGACTGGGAGTGGAAGTGAATTTTCAGGAAATCCTTATAGTCACCCTCAATACACAACCTACAACGAAGCATGGAGGTTCAGCAACCCAGCACTATTAAGTTCCCCTTATTATTATAGTGCCACATCCAGGGGCTCCGCACCTCCCACTGCTGCCACTGCCTATGACCGCCACTAGTTACCATGGAAACCACATGAAACTACAGGGCGACAACATAGGCCTCCATATTGTACCTGTCTGAACTACATCAACTATGCCATCGGAAGAAGAGTGGCCTACTCTGCTTTCCCTACTGACGTTTCTCAGCTGTAATAAGCTGCTCTTACCTCTGCTGCAAGCCTCTTTGTTGTTATTGTGCACGGTAGCTAGATGAACATCAAGCCAAGTCATCTGATTTCAGAACTTATTTCCAAAAAGGCCCACTATTTAAGTTATGCAGTGGATTGTAGTAGGAAACCACAGAACTCATGTCTTCTCCCTCAAAAAAAGGAATGCGGAATATGAATACCTTTTCTAAGACAAACATGCGTGCTACAATAAAGAGAGAAAAACTTTTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 6e-007     NP_001024570.1 Variable ABnormal morphology family member (vab-3) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Dm ---- 1e-008     NP_523862.1 CG2692-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 4e-088     XP_851539.1 PREDICTED: similar to paired box protein 2 isoform c [Canis familiaris] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Hs ---- 3e-115     NP_003980.2 paired box protein 2 isoform d [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Gg ---- 3e-118     NP_990124.1 paired-box containing protein Pax-2 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Xl ---- 2e-153     NP_001079830.1 paired box protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:4031151-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------TAATAA---------------------------------------------------TAGATG---------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2      seed Kid                    IMAGE:4031151-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTTCCCAGTACAGCATCTCCACCTGTCTCCAGCGCATCCAATGATCCCGTAGGCTCTTATTCAATTAATGGAATCCTGGGTATTCCTCGTTCTAATGGCGAAAAGAGGAAACGCGATGAAGATGGATCTGATGGTTCTGGTCCAAATGGAGATTCCCAGAGCAGTGTTGAAAGTTTACGGAAGCATCTACGGGCTGATAACTTCACTCAGCAGCAACTGGAGGCATTAGATCGAGTCTTTGAGCGTCCTTCTTATCCAGATGTCTTTCAGAGTGCTGAACACATCAAATCTGAACAGGCCAGCGAATACTCCCTTCCAGCGCTCACTCCTGGTCTTGATGAAGTCAAGTCTAGTCTATCAGCATCCGGCAATGCAGACCTAGGAAGCAATGTGTCAGGACCCCAGTCCTACCCTGTAGTAACCGGACGAGATATGTCAAGCACCACTCTTCCAGGTTATCCACCTCATGTACCTCCAACAGGACAAGGCAGCTACCCAACATCAACTCTTGCTGGAATGGTACCTGGCACCAACGTTTCGGTCCACCATTCGGTCCAACCTGTGGAGTGCTGTTCATGTCTTTCCAGCTCTAAACCATGTCTGTTTCACTGCAGGACTGGGAGTGGAAGTGAATTTTCAGGAAATCCTTATAGTCACCCTCAATACACAACCTACAACGAAGCATGGAGGTTCAGCAACCCAGCACTATTAAGTTCCCCTTATTATTATAGTGCCACATCCAGGGGCTCCGCACCTCCCACTGCTGCCACTGCCTATGACCGCCACTAGTTACCATGGAAACCACATGAAACTACAGGGCGACAACATAGGCCTCCATATTGTACCTGTCTGAACTATATTAACTATGCCATCGGAAGAAGAGTGGTCTACTCTGCTTTCCTTACTGACGTTCCTCAGCTGTAATAGGCTGCTTT
  5   1   2       bld Kid                             IMAGE:4031151.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTCCCAGTACAGCATCTCCACCTGTCTCCAGCGCATCCAATGATCCCGTAGGCTCTTATTCAATTAATGGAATCCTGGGTATTCCTCGTTCTAATGGCGAAAAGAGGAAACGCGATGAAGATGGATCTGATGGTTCTGGTCCAAATGGAGATTCCCAGAGCAGTGTTGAAAGTTTACGGAAGCATCTACGGGCTGATAACTTCACTCAGCAGCAACTGGAGGCATTAGATCGAGTCTTTGAGCGTCCTTCTTATCCAGATGTCTTTCAGAGTGCTGAACACATCAAATCTGAACAGGCCAGCGAATACTCCCTTCCAGCGCTCACTCCTGGTCTTGATGAAGTCAAGTCTAGTCTATCAGCATCCGGCAATGCAGACCTAGGAAGCAATGTGTCAGGACCCCAGTCCTACCCTGTAGTAACCGGACGAGATATGTCAAGCACCACTCTTCCAGGTTATCCACCTCATGTACCTCCAACAGGACAAGGCAGCTACCCAACATCAACTCTTGCTGGAATGGTACCTGGCACCAACGTTTCGGTCCACCATTCGGTCCAACCTGTGGAGTGCTGTTCATGTCTTTCCAGCTCTAAACCATGTCTGTTTCACTGCANGACTGGGAGTGGAAGTGAATTTTCAGGAAATCCTTATAGTCACCCTNCATACACAACCCTACACGAAGCATGGAGGTTCAGCANCCCAGCACTATTAAGTTCCCCTTATTTATATAGTNGCACATCCAGGGGCTCCGCACCTCCCACTGCTGGCACTGCCTATGACCGCCACTAGTTACCATGGAAACCACATGAAACTACAGGNCGACAACATAAGGCCTCCATATTTGTACCTGGTCTGAANCTATATTAACTATGGCATCCGNAAAAAAGAAGTGGNCCTACTCCTGCTTTTCCCTTACGTGACGGT
  5   1   1       add Ga15                               XL462b19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCTTCACCCACCATGGCCCCCATTATGGGCAGTTCGGCAGCCAGCCACTCATAGCAGGGCGAGATATGTCAAGCACAACTCTTCCAGGTTATCCACCTCATGTACCTCCAACAGGACAAGGCAGCTACCCTACATCAACTCTTGCTGGAATGGTACCTGGGAGTGAATTTTCAGGAAATCCTTACAGCCACCCACAATATACAACCTACAATGAAGCCTGGAGGTTCAGCAACCCAGCACTATTAAGTTCCCCTTATTATTATAGTGCCACATCCAGGGGCTCCGCACCTCCCACTGCTGCCACTGCCTATGACCGCCACTAGTTACCATGGAAACCACATGAAACTACAGGGCGACAACATAGGCCTCCATATTGTACCTGTCTGAACTACATCAACTATGCCATCGGAAGAAGAGTGGCCTACTCTGCTTTCCCTACTGACGTTTCTCAGCTGTAATAAGCTGCTCTTACCTCTGCTGCAAGCCTCTTTGTTGTTATTGTGCACGGTAGCTAGATGAACATCAAGCCAAGTCATCTGATTTCAGAACTTATTTCCAAAAAGGCCCACTATTTAAGTTATGCAGTGGATTGTAGTAGGAAACCACAGAACTCATGTCTTCTCCCTCAAAAAAAGGAATGCGGAATATGAATACCTTTTCTAAGACAAACATGCGTGCTACAATAAAGAGAGAAAAACTTTTTATGGGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)