Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 61%

 1012797906 Xl3.1-XL108b03.3 - 3 ESTs
                                                                       .-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL108b03.3                                                                                                                                                                                                                                                                                                                                                                                                                  GTACACTGCTACTGGGGTCCTGTGCTGAGCTGGAGGAAAGCAAGGGATCATTAGGACTTTTAGTATCTGGGCAACAGAGATTTCATTCATGTCCATGTGAATCTATATTATATGTCCTCCTATAAGTGCCCAAGTGCATTTGCTTCTTAAAGCATCAGTTATTGCCAAAGATTTGGTGCAGTAAGGATGATACTCAATATAGTCACATAGTTATACCCAATATAGTCACATAGTTATCACACCCAATATAGTCAGAAGGCTTGGAAAGCCCAGTTGCTTTAACCCATTCTGCCCCCCAGACCTTTTACATGTGTACTGTCCTCGCTTGATGTTTGCCTTGCATGCTCTACTTTGTGCCAATTTAAAAGCATATTTACTTTGGTTTTGTCCCACAGGTGGGCAGCGTACACGCAAAAAAAGGTGCCCGTATACCAAATACCAGATTAGAGAACTGGAAAGGGAATTCTTCTTTAGCGTCTATATTAACAAAGAAAAGCGCCTGCAGCTCTCACGGATGCTCAACCTGACTGACCGACAAGTCAAGATCTGGTTCCAGAACAGGAGGATGAAAGAGAAGAAAATTAACAGAGACCGCCTGCAGTACTATTCTGCTAACCCACTGCTATGAGACTAGTTGCTAGTCACCTTAATCAAGTCCACAGTTTTACAGTCAGACATATGGACCAGACAGGAATACATGTTTCTATGGGCTCACCCCAGCTTGGAACTTCCCTTGGCCCTGGTTTTTGATTTACCCCACAGTGAAAATGGAATAACGAAGGCCCTCAACTTTCTGGTTATGGCTAAACCAATACAGGTTGTAGGGTACACTCTTTGATACACACAATGGACACTAGTTGTTTTGTCATTCGGGATCAATACAAACAATTCTCATGCTATAAGCTCCCCCTCACTTTTTCACTCTACCAAAGAGTCCAAGCAAATACAATCATTGGTAGAGCCAACTCCTTTCCCTTGTGGGATTTAAGGGAACATCTTACTACAGAGGAAGAATTAACTGTTTAATTCAATGCTGATTCACCTCAATCTGTTACTCTGTGAATTCATGTTTTTATTGCAAAGAAGCAACTCCTCAACATGAAATATGAAGTCTGCACTTTCTTTGCTAATATCAATCCGCCTGGGAGTCACTTGTGGTAATGGAAAGTTTAGACAGAGACAAGCAAGCATTGCAATCTGACTCCACAAGGCAAATAATCAGCATACAGAGAAAGTAATAATAGCATAAAAAGTAACAAATATATAGATGTTATCTTTTTTTTTCATACCAAATGGCAACAAATAGGGCTGCAGTCTGCAGTAGAGTGCACAGGTTATAATCTAAGTTTAAATGAATCTCTTTGCAAT
                                                  Xl3.1-CHK-1012714414                                                                                                                                                                                                                                                                                                                                                                                                                        TGCTACTGGGGTCCTGTGCTGAGCTGGAGGAAAGCAAGGGATCATTAGGACTTTTAGTATCTGGGCAACAGAGATTTCATTCATGTCCATGTGAATCTATATTATATGTCCTCCTATAAGTGCCCAAGTGCATTTGCTTCTTAAAGCATCAGTTATTGCCAAAGATTTGGTGCAGTAAGGATGATACTCAATATAGTCACATAGTTATACCCAATATAGTCACATAGTTATCACACCCAATATAGTCAGAAGGCTTGGAAAGCCCAGTTGCTTTAACCCATTCTGCCCCCCAGACCTTTTACATGTGTACTGTCCTCGCTTGATGTTTGCCTTGCATGCTCTACTTTGTGCCAATTTAAAAGCATATTTACTTTGGTTTTGTCCCACAGGTGGGCAGCGTACACGCAAAAAAAGGTGCCCGTATACCAAATACCAGATTAGAGAACTGGAAAGGGAATTCTTCTTTAGCGTCTATATTAACAAAGAAAAGCGCCTGCAGCTCTCACGGATGCTCAACCTGACTGACCGACAAGTCAAGATCTGGTTCCAGAACAGGAGGATGAAAGAGAAGAAAATTAACAGAGACCGCCTGCAGTACTATTCTGCTAACCCACTGCTATGAGACTAGTTGCTAGTCACCTTAATCAAGTCCACAGTTTTACAGTCAGACATATGGACCAGACAGGAATACATGTTTCTATGGGCTCACCCCAGCTTGGAACTTCCCTTGGCCCTGGTTTTTGATTTACCCCACAGTGAAAATGGAATAACGAAGGCCCTCAACTTTCTGGTTATGGCTAAACCAATACAGGTTGTAGGGTACACTCTTTGATACACACAATGGACACTAGTTGTTTTGTCATTCGGGATCAATACAAACAATTCTCATGCTATAAGCTCCCCCTCACTTTTTCACTCTACCAAAGAGTCCAAGCAAATACAATCATTGGTAGAGCCAACTCCTTTCCCTTGTGGGATTTAAGGGAACATCTTACTACAGAGGAAGAATTAACTGTTTAATTCAATGCTGATTCACCTCAATCTGTTACTCTGTGAATTCATGTTTTTATTGCAAAGAAGCAACTCCTCAACATGAAATATGAAGTCTGCACTTTCTTTGCTAATATCAATCCGCCTGGGAGTCACTTGTGGTAATGGAAAGTTTAGACAGAGACAAGCAAGCATTGCAATCTGACTCCACAAGGCAAATAATCAGCATACAGAGAAAGTAATAATAGCATAAAAAGTAACAAATATATAGATGTTATCTTTTTTTTTCATACCAAATGGCAACAAATAGGGCTGCAGTCTGCAGTAGAGTGCACAGGTTATAATCTAAGTTTAAATGAAxxxxxx
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                       1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1
                                               BLH MIN     361      44                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH OVR     328     216                                                                                                                                                                                                                                                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 2e-016     NP_499573.1 posterior Hox gene Paralog (php-3) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dm ---- 2e-017     NP_996220.1 CG11648-PE, isoform E [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================
                                                                                                           PROTEIN --- Ci ---- 4e-019     NP_001027696.1 hox10 protein [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ag ---- 1e-018     XP_311628.4 AGAP004664-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 5e-020     XP_001182393.1 PREDICTED: similar to homeodomain protein TgHBox4 [Strongylocentrotus purpuratus] ==============================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Xt ---- 1e-020     AAI22055.1 Unknown (protein for IMAGE:7860727) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xb ---- 3e-021     CAA43908.1 homeobox [Xenopus borealis] ========================================================================================================================================================
                                                                             PREDICTED - Cf ---- 5e-035     XP_852429.1 PREDICTED: similar to Homeobox protein Hox-D11 (Hox-4F) [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================
                                                                                      PREDICTED - Bt ---- 3e-035     XP_870343.2 PREDICTED: similar to Hox-4.6 [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN --- Dr ---- 2e-038     NP_571619.1 homeo box A11a [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================
                                                                                                                                                              PROTEIN --- Hs ---- 1e-038     NP_005514.1 homeobox protein A11 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Xl ---- 1e-038     CAC44977.1 homeobox protein Hox A11 [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================
                                                                                                                                                                                                              PROTEIN --- Gg ---- 6e-039     NP_989950.1 homeodomain-containing protein [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================
                                                                                                                                                              PROTEIN --- Mm ---- 2e-039     NP_034580.1 homeobox protein A11 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================
                                                      Xl3.1-XL108b03.3                                                                                                                                                                                                                                                                                                                                                                                                                                           TGA------------------------------------------------------------ATG---ATGTGA---------------------------------------------------------------------------------TAA---TGA---------TAG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------------TGA---TAG---------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------TAA------------ATG---------------------------------ATG------------------------------TGA---ATG------------------------------------------------------------------------------------------TGA---------------------------------------------TAA---------------TAGATG---------------------------------TAG---------------TAG------------------TAA---TAAATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                ...
  5   1   2       bld Tbd7 5g3  in                         XL108b03.5p                                                                                                                                                                                                                                                                                                                                                                                                                  GTACACTGCTACTGGGGTCCTGTGCTGAGCTGGAGGAAAGCAAGGGATCATTAGGACTTTTAGTATCTGGGCAACAGAGATTTCATTCATGTCCATGTGAATCTATATTATATGTCCTCCTATAAGTGCCCAAGTGCATTTGCTTCTTAAAGCATCAGTTATTGCCAAAGATTTGGTGCAGTAAGGATGATACTCAATATAGTCACATAGTTATACCCAATATAGTCACATAGTTATCACACCCAATATAGTCAGAAGGCTTGGAAAGCCCAGTTGCTTTAACCCATTCTGCCCCCCAGACCTTTTACATGTGTACTGTCCTCGCTTGATGTTTGCCTTGCATGCTCTACTTTGTGCCAATTTAAAAGCATATTTACTTTGGTTTTGTCCCACAGGTGGGCAGCGTACACGCAAAAAAAGGTGCCCGTATACCAAATACCAGATTAGAGAACTGGAAAGGGAATTCTTCTTTAGCGTCTATATTAACAAAGAAAAGCGCCTGCAGCTCTCACGGATGCTCAACCTGACTGACCGACAAGTCAAGATCTGGTTCCAGAACAGGAGGATGAAAGAGAAGAAAATTAACAGAGACCGCCTGCAGTACTATTCTGCTAACCCACTGCTATGAGACTAGTTGCTAGTCACCTTAATCAAGTCCACAGTTTTACAGTCAGACATATGGACCAGACAGGAATACATGTTTCTATGGGCTCA
  3   1   2      seed Tbd7 5g3  in                         XL108b03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTTTACAGTCAGACATATGGACCAGACAGGAATACATGTTTCTATGGGCTCACCCCAGCTTGGAACTTCCCTTGGCCCTGGTTTTTGATTTACCCCACAGTGAAAATGGAATAACGAAGGCCCTCAACTTTCTGGTTATGGCTAAACCAATACAGGTTGTAGGGTACACTCTTTGATACACACAATGGACACTAGTTGTTTTGTCATTCGGGATCAATACAAACAATTCTCATGCTATAAGCTCCCCCTCACTTTTTCACTCTACCAAAGAGTCCAAGCAAATACAATCATTGGTAGAGCCAACTCCTTTCCCTTGTGGGATTTAAGGGAACATCTTACTACAGAGGAAGAATTAACTGTTTAATTCAATGCTGATTCACCTCAATCTGTTACTCTGTGAATTCATGTTTTTATTGCAAAGAAGCAACTCCTCAACATGAAATATGAAGTCTGCACTTTCTTTGCTAATATCAATCCGCCTGGGAGTCACTTGTGGTAATGGAAAGTTTAGACAGAGACAAGCAAGCATTGCAATCTGACTCCACAAGGCAAATAATCAGCATACAGAGAAAGTAATAATAGCATAAAAAGTAACAAATATATAGATGTTATCTTTTTTTTTCATACCAAATGGCAACAAATAGGGCTGCAGTCTGCAGTAGAGTGCACAGGTTATAATCTAAGTTTAAANAAATCTCTTTGCAATATAG
  3   1   2       bld Tbd7                                 XL108a03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAATGGAATAACGAAGGCCCTCAACTTTCTGGTTATGGCTAAACCAATACAGGTTGTAGGGTACACTCTTTGATACACACAATGGACACTAGTTGTTTTGTCATTCGGGATCAATACAAACAATTCTCATGCTATAAGCTCCCCCTCACTTTTTCACTCTACCAAAGAGTCCAAGCAAATACAATCATTGGTAGAGCCAACTCCTTTCCCTTGTGGGATTTAAGGGAACATCTTACTACAGAGGAAGAATTAACTGTTTAATTCAATGCTGATTCACCTCAATCTGTTACTCTGTGAATTCATGTTTTTATTGCAAAGAAGCAACTCCTCAACATGAAATATGAAGTCTGCACTTTCTTTGCTAATATCAATCCGCCTGGGAGTCACTTGTGGTAATGGAAAGTTTAGACAGAGACAAGCAAGCATTGCAATCTGACTCCACAAGGCAAATAATCAGCATACAGAGAAAGTAATAATAGCATAAAAAGTANCAAATATATAGATGTTATCTTTTTTTTTCATACCAAATGGCAACAAATAGGGCTGCAGTCTGCAGTAGAGTGCACAGGTTATAATCTAAGTTTAAATGAAATCTGCTTTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)