Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 25 Oct 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 95%

 1012798061 Xl3.1-IMAGE:5572648.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5572648.5 GAGGAGGGGGGAGTGAAGGGAGTGAGCGGCGGCCTGTGACAGGAGCCGGAGTTACTAGCAGCTCGGGGCAGAGTGGCCTCTCGGGAGCGGCAGGAAAGGACCGGGAGTTATTTGCCTCTTCATATTTGTATGCTGCAGGGGACATATCTGGCCACAAGGAAGGACACAGACACATACACGGCAGATGTCTGTAATGGAGGAACACCGTGACGACTAAGACCAGACAAGCTGCCTCCTACGCTGTAACAGAACGCCAAAATGGATATTAGGTGTGCTGGACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTGCGCTTGGTCAGCCTGGCCTAGCGATCCTACGGAAGTCGCTCAGGATTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATCAAAGAGACAGTGGCACCAATGACAGGAATTCCGGACAGTTCTGCTTTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTCTGAAGTTGGAAAGGAGACATTGCCCTCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTCGATGGTGACAAAGGAGTCTATGAGATTTCTGTGGCCTCCCTGCAACTGGCCCCAATGGAAGTTATGTACCCCAAACCACAGATGTTTTCCTCTGTAGAGGGTCATCCTTGAGGACCACAAGAACCTCAGTCTGTGCGAGTGGCAGGGCAGGAAACAACTGAAGCAACTCCTTTTCTATGGGGCACTGGATGAGCCGTAACAATTTTTGACTGGAAATTTTAAAATGCAGACTTTGACAAAAATGAACACCACAGCCCAAGAGTTAGATCTTTCCTGAACCGAAATGAA
                                                  Xl3.1-CHK-1012711983       GGGGGAGTGAAGGGAGTGAGCGGCGGCCTGTGACAGGAGCCGGAGTTACTAGCAGCTCGGGGCAGAGTGGCCTCTCGGGAGCGGCAGGAAAGGACCGGGAGTTATTTGCCTCTTCATATTTGTATGCTGCAGGGGACATATCTGGCCACAAGGAAGGACACAGACACATACACGGCAGATGTCTGTAATGGAGGAACACCGTGACGACTAAGACCAGACAAGCTGCCTCCTACGCTGTAACAGAACGCCAAAATGGATATTAGGTGTGCTGGACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTGCGCTTGGTCAGCCTGGCCTAGCGATCCTACGGAAGTCGCTCAGGATTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATCAAAGAGACAGTGGCACCAATGACAGGAATTCCGGACAGTTCTGCTTTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTCTGAAGTTGGAAAGGAGACATTGCCCTCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTCGATGGTGACAAAGGAGTCTATGAGATTTCTGTGGCCTCCCTGCAACTGGCCCCAATGGAAGTTATGTACCCCAAACCACAGATGTTTTCCTCTGTAGAGGGTCATCCTxxxGxxCCACAAxxxxxxCAGTCTGTGCGAGTGGCAGGGCAGGAAACAACTGAAGCAACTCCTTTTCTATGGGGCACTGGATGAGCCGTAACAATTTTTGACTGGAAATTTTAAAATGCAGACTTTGACAAAAATGAACACCACAGCCCAAGAGTTAGATCTTTCCTGAACCGAAATGAAAAGAAT
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     258     369 
                                               BLH MIN     258      45 
                                               BLH MPR     249      45 
                                               BLH OVR     258     720 
                                               CDS MIN     258      45 
                                               ORF LNG     258      16 
                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Sp ---- 2e-008     XP_001188993.1 PREDICTED: similar to Dag1 protein [Strongylocentrotus purpuratus] ----------------==============================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                PROTEIN --- Dr ---- 5e-022     NP_775381.1 dystroglycan 1; dystrophin-associated glycoprote [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Cf ==== 4e-037     NP_001029164.1 dystroglycan 1 [Canis familiaris] =================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Hs ---- 1e-038     NP_004384.2 dystroglycan 1 preproprotein [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Bt ---- 3e-040     NP_776587.1 RAB7, member RAS oncogene family [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Mm ---- 1e-040     NP_034147.1 dystroglycan 1; dystrophin associated glycoprotein 1 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Gg ---- 2e-046     NP_001091009.1 dystroglycan [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 1e-080     NP_001016518.1 dystroglycan 1 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 3e-086     NP_001082480.1 dystroglycan [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5572648.5                                     TGA------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------TGA---------------------------------TAA------------ATG------------------------------ATG------------ATG---------ATG------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------------ATG---------------------------------------------------------------------------------------------------------TGA---------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  5   1   2       bld Emb4 5g                         IMAGE:5572648.5p GAGGAGGGGGGAGTGAAGGGAGTGAGCGGCGGCCTGTGACAGGAGCCGGAGTTACTAGCAGCTCGGGGCAGAGTGGCCTCTCGGGAGCGGCAGGAAAGGACCGGGAGTTATTTGCCTCTTCATATTTGTATGCTGCAGGGGACATATCTGGCCACAAGGAAGGACACAGACACATACACGGCAGATGTCTGTAATGGAGGAACACCGTGACGACTAAGACCAGACAAGCTGCCTCCTACGCTGTAACAGAACGCCAAAATGGATATTAGGTGTGCTGGACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTGCGCTTGGTCAGCCTGGCCTAGCGATCCTACGGAAGTCGCTCAGGATTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATCAAAGAGACAGTGGCACCAATGACAGGAATTCCGGACAGTTCTGCTTTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTCTGAAGTTGGAAAGGAGACATTGCCCTCTTGGTTACATTGGGAAGGTAATTTTTTGCAAGGTCTTCCCCTTGATGGGGACAAAGGGGTCTATGACATTTCTGTGGCCTCCCTGCACCTGGCACCAAATGGAAGTTATGTACCACTTACCCCAGATGTTTTCCTCTGAAAAGGTTCATCCTGAGGACCACAATGGAACCTCAATCTGTGGCAAGTGGCAGGAACGGGAAACCGCCTTAACGCAAATTCCCTTTTTCAATGGGGCGCCCGGAGGAAGGCCGTAAACAACTTTTTTGGACGGGAAAC
  5   1   1       add Emb4 5g                         IMAGE:5572858.5p                                                       AGTAGCCGGAGTTACTAGCAGCTCTGGGCTGAGCGGCCTCTCGGGAGCGGCAGGAAAAGACCGGGAGTTATATTGTTCTTCGCTAATAAGGGGAGAGACCTGGCCACAAGAAAGGACACACATACGGCAGATGTCCGTAATGGAGGAACACTGTGACGAATAAGACCAGACGCGTTGCCTCCTACGCTGTAACACAACACCAAAATGGATATTCGGTGTGCTGCACTTTCCTTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCGGTCTGGCCTAGTGATCCAACTGAAGTTGCTCAAGACTGGGACAATCAGCTCGAGGCCTCCATGCATTCGTTGTTCCCTGAAATTAAAGAGACAGTGGCACCAATGGCAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCATATCCCTGCAGAATTTCTTGCTTCCAATGGAGAAACAATCAAGATTTCTGAAGTTGGAAAGGACACCTTGCCCTCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTCGATGGTGACAAAGGAGTCTATGAGATTTCTGTGGCCTCCCTGCAACTGGCCCCAATGGAAGTTATGTACCCCAAACCACAGATGTTTTCCTCTGTAGAGGGTCATCCTGAGGACCACNATGAACCTCAGTCTGTGCGAGTGGCAGGGCAGGAAACAACTGAAGCAACTCCTTTTCTATGGGGCACTGGATGAGCCGTAACAATTTTTGACTGGAAATTTTAAAATGCAGACTTTGACAAAAATGAACACCACAGCCCAAGAGTTAGATCTTTCCTGAACCGAAATGAAAAGAAT
  5   1   2      seed Bla1 5g                         IMAGE:3380035.5p                                                                                                                                                                                                                  CCGGGCCCGGGGAGACAAGCTGCCTCCTACGCTGTAACAGAACGCCAAAATGGATATTAGGTGTGCTGGACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTGCGCTTGGTCAGCCTGGCCTAGCGATCCTACGGAAGTCGCTCAGGATTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATCAAAGAGACAGTGGCACCAATGACAGGAATTCCGGACAGTTCTGCTTTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTCTGAAGTTGGAAAGGAGACATTGCCCTCTTGGTTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)