Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 21 Sep 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xl3.1-XL409f06ex.5                         12 END     1          33        8                hypothetical protein LOC398915 [Xenopus laevis]
     2   2.0    0Xl3.1-IMAGE:8321115.5                       2 END     1          33       50                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012798247 Xl3.1-XL051a21.3 - 3 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL051a21.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGGATTATCATGGGCACCTTCACCCTGTGCTGGTTGCCCTTCTTCTTGGCCAACGTGGTCAATGTCTTCTACAGGAACCTGATCCCAGACAAACTCTTCCTCTTCCTCAACTGGCTGGGTACGCCAACTCCCGCGTTTAACCCCATCATCTACTGCAGGAGCCCAGACTTCAGGAAGGCTTTCAAGAGACTCCTGTGTTGCCCCAAAAGGGCAGATTGGCACCTGCAGACCACTGGGGAGCTCTCCCGAACCTCAGGGGGCTTTGTTAACTCTTTAGACACCAATGCTTTGGGTACGTGTTCTGAATGTAATGGGGTGCGGACGTCATTGGACTGAAATTAATTATTTATTGTGGGTCGGAGGGAGATTGAATAACTGGGTGCAGGGGCTGCAAATAACGGGTACGTTTATAGCAATCTCACGGCAGCTTATTGGAATCTAGAGGTTTTCCCGGGATAGGAGTGAACTCCGGAAAATGTCATCTCAATGGCTGCGGAGCTATTACATCCCGGGGATATTCACCAATACATGCCCAATGCTGATTGGTCAGTTTGACTTTCACTGTGTTACTGCCTACCAATGGGGTCAGTTGTGGGGTTGTTCCGACTAAT
                                                  Xl3.1-CHK-1012710862                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATCATGGGCACCTTCACCCTGTGCTGGTTGCCCTTCTTCTTGGCCAACGTGGTCAATGTCTTCTACAGGAACCTGATCCCAGACAAACTCTTCCTCTTCCTCAACTGxxxGGxTACGCCxAxxxCCGCGTTTAACCCCATCATCTACTGCAGGAGCCCAGACTTCAGGAAGGCTTTCAAGAGACTCCTGTGTTGCCCCAAAAGGGCAGATTGGCACCTGCAGACCACTGGGGAGCTCTCCCGAACCTCAGGGGGCTTTGTTAACTCTTTAGACACCAATGCTTTGGGTACGTGTTCTGAATGTAATGGGGTGCGGACGTCATTGGACTGAAATTAATTATTTATTGTGGGTCGGAGGGAGATTGAATAACTGGGTGCAGGGGCTGCAAATAACGGGTACGTTTATAGCAATCTCACGGCAGCTTATTGGAATCTAGAGGTTTTCCCGGGATAGGAGTGAACTCCGGAAAATGTCATCTCAATGGCTGCGGAGCTATTACATCCCGGGGATATTCACCAATACATGCCCAATGCTGATTGGTCAGTTTGACTTTCACTGTGTTACTGCCTxxCxAxGGGGTCAGTTGTGGGGTTGTTCCGACTAATACACTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 1e-011     NP_001024580.1 DOPamine receptor family member (dop-1) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-012     NP_477007.1 CG9652-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                    PREDICTED - Ag ---- 8e-014     XP_315207.3 putative dopamine receptor 1 (AGAP004613-PA) [Anopheles gambiae str. PEST] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---- 9e-014     XP_001194944.1 PREDICTED: similar to dopamine D1/beta receptor [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================
                                                                                                       PROTEIN --- Cf ---- 2e-029     NP_001008713.1 adrenergic, beta-1-, receptor [Canis familiaris] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================
                                                                                              PROTEIN --- Hs ---- 2e-029     NP_000675.1 beta-1-adrenergic receptor [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================
                                                                                                                                     PROTEIN --- Bt ---- 6e-030     NP_919242.1 adrenergic, beta-1-, receptor [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================
                                                                                                                               PROTEIN --- Mm ---- 4e-030     NP_031445.2 adrenergic receptor, beta 1 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 4e-031     XP_428541.2 PREDICTED: similar to beta-4C-adrenergic receptor [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PROTEIN --- Dr ---- 2e-037     NP_001122161.1 beta-1-adrenergic receptor [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                          PROTEIN --- Xl ---- 1e-056     NP_001084152.1 beta-1 adrenergic receptor [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL051a21.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---TAA------------------------------TAA---------------------------------------------------------------------------------TAG---TGA---------------------ATG---------------------------------------ATG---------------------TGA
  3   1   2       bld Neu7                                 XL018g05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGGATTATCATGGGCACCTTCACCCTGTGCTGGTTGCCCTTCTTCTTGGCCAACGTGGTCAATGTCTTCTACAGGAACCTGATCCCAGACAAACTCTTCCTCTTCCTCAACTGGCTGGGNTACGCCAACTCCGCGTTTAACCCCATCATCTACTGCAGGAGCCCAGACTTCAGGAAGGCTTTCAAGAGACTCCTGTGTTGCCCCAAAAGGGCAGATTGGCACCTGCAGACCACTGGGGAGCTCTCCCGAACCTCAGGGGGCTTTGTTAACTCTTTAGACACCAATGCTTTGGGTACGTGTTCTGAATGTAATGGGGTGCGGACGTCATTGGACTGAAATTAATTATTTATTGTGGGTCGGAGGGAGATTGAATAACTGGGTGCAGGGGCCCCAAATAACGGGTACGTTTATAGCAATCTCACGGCAGCTTATTGGAATCTAGAGGTTTTCCCAGGATAGGAGTGAACTCCGGAAAATGTCATCTCAATGGCTGCGGAGCTATTACATCCCGGGGATATTCACCAANACATGCCAAATGCTGATTGGTCAGTTTGACTTTCACTGTGTTACTGCCTGACCAATGGGGTCAGTTGTGGGGTTGTTCCGACTAATACAC
  3   1   2      seed Tbd7      out                        XL051a21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTGCTGGTTGCCCTTCTTCTTGGCCAACGTGGGTCAATGTCTGCTACAGGAACCTGATCCCAGACAAACTTCTTCCTCAACTGGCTGGGCTACGCCAACTCCGCGTTTAACCCCATCATCTACTGCAGGAGCCCAGACTTCAGGAAGGCTTTCAAGAGACTTCCTGTGTTGCCCCAAAAAGGCAGATTGGCACCTGCAGACCACTGGGGAGCTCTCCCGAACCTCAGGGGGCTTTGTTAACTCTTTAGACACCAATGCTTTGGGTACGTGTTCTGAATGTAATGGGGTGCGGACGTCATTGGACTGAAATTAATTATTTATTGTGGGTCGGAGGGAGATTGAATAACTGGGTGCAGGGGCTGCAAATAACGGGTACGTTTATAGCAATCTCACGGCAGCTTATTGGAATCTAGAGGTTTTCCCGGGATAGGAGTGAACTCCGGAAAATGTCATCTCAATGGCTGCGGAGCTATTACATCCCGGGGATATTCACCAATACATGCCCAATGCTGATTGGTCAGTTTGACTTTCACTGTGTTACTGCCNACCAATGGGGTCAGTTGTGGGGTTGTTCCGACTAATACACTT
  3   1   2       bld Tbd7      out                        XL051e20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCTTTGTTAACTCTTTAGACACCAATGCTTTGGGTACGTGTTCTGAATGTAATGGGGTGCGGACGTCATTGGACTGAAATTAATTATTTATTGTGGGTCGGAGGGAGATTGAATAACTGGGTGCAGGGGCTGCAAATAACGGGTACGTTTATAGCAATCTCACGGCAGCTTATTGGAATCTAGAGGTTTTCCCGGGATAGGAGTGAACTCCGGAAAATGTCATCTCAATGGCTGCGGAGCTATTACATCCCGGGGA

In case of problems mail me! (