Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL184i11.5                            3 END     2         100       66                forkhead box protein M1 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012798353 Xl3.1-XL190f21.3 - 2 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL190f21.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTACCCAGGACAACCNTATTCAGCTTACTCAAGACGAGGACTATACCTTCAAGACCCCCATCAAGGAGCATTTCTCAAAACCGCCCACCTTCTTCCACTCCCAGCAAACCGACTGATACAGGTCTTCTTCAACCTTGGGAATCCGAAACATCTCTTCCCAGAGACCCTGTGCTGGACTTCAGCCCTGTCCGTATCCCTCAAGGCTCAACTTTTACTCCCTTTAAAGATAACCTTGGAACTATGAGTTTTGGGGACACTCCGTTTAAAGATTTTGGCATATTTGGATCCCCCCAGAACCTTCTGAATGCACTTTCTCCTGCTTCTTCTCCACTACTGAGGCTTGAGAGCCCTTGTGTGTCACGCCAGCAGAAGCGATGTTCTAAGGAGCTGCAGGTGGGGGCTTCTGCTAACCGCTCACTACTGGAAGGTCTAGTGCTGGACACGGTTGACGACAGTCTAAGCAAAATTCTGCTGGACATTAGCTTCAGTGGCATGGAGGATGGCAATGGACTTGAGGTGGACGGTGTGTGGAGCCAGTTTCTTCCTGAATTCAAATGAAATCAAGTGTTCTGTAGATTCTTAACTTCCCCTTTAATATCCCAGGCTCAAAGCTCCACTGTAAGACTCCTACACAGCAGAATTGCCTCCTCACCCCATTCAAAACCGAAAACGCGAAATACACACGCTGCAGGCTGCTCTGGTTTCTCCACAACCAAGCCGCATGTATCTGAATTGTAAATTGTGTATAACGTAGATTTCACGTCTGTCCAGTTATAAAGGAGTGAGCTGGCAACACTAAGGGGCAGATTTATTAAGGGTCAAATTGAAAAATTTGAAT
                                                  Xl3.1-CHK-1012715737                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGGACAACCNTATTCAGCTTACTCAAGACGAGGACTATACCTTCAAGACCCCCATCAAGGAGCATTTCTCAAAACCGCCCACCTTCTTCCACTCCCAGCAAACCGACTGATACAGGTCTTCTTCAACCTTGGGAATCCGAAACATCTCTTCCCAGAGACCCTGTGCTGGACTTCAGCCCTGTCCGTATCCCTCAAGGCTCAACTTTTACTCCCTTTAAAGATAACCTTGGAACTATGAGTTTTGGGGACACTCCGTTTAAAGATTTTGGCATATTTGGATCCCCCCAGAACCTTCTGAATGCACTTTCTCCTGCTTCTTCTCCACTACTGAGGCTTGAGAGCCCTTGTGTGTCACGCCAGCAGAAGCGATGTTCTAAGGAGCTGCAGGTGGGGGCTTCTGCTAACCGCTCACTACTGGAAGGTCTAGTGCTGGACACGGTTGACGACAGTCTAAGCAAAATTCTGCTGGACATTAGCTTCAGTGGCATGGAGGATGGCAATGGACTTGAGGTGGACGGTGTGTGGAGCCAGTTTCTTCCTGAATTCAAATGAAATCAAGTGTTCTGTAGATTCTTAACTTCCCCTTTAATATCCCAGGCTCAAAGCTCCACTGTAAGACTCCTACACAGCAGAATTGCCTCCTCACCCCATTCAAAACCGAAAACGCGAAATACACACGCTGCAGGCTGCTCTGGTTTCTCCACAACCAAGCCGCATGTATCTGAATTGTAAATTGTGTATAACGTAGATTTCACGTCTGTCCAGTTATAAAGGAGTGAGCTGGCAACACTAAGGGGCAGATTTATTAAGGGTCAAATTGAAAAATTTGAATACTCAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN      47      31                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PREDICTED - Bt ---- 3e-020     XP_001249705.1 PREDICTED: similar to Forkhead box protein M1 (Forkhead-related protein FKHL16) (Hepatocyte nuclear factor 3 forkhead homolog 11) (HNF-3/fork-head homolog 11) (HFH-11) (Winged helix factor from INS-1 cells) (M-phase phosphoprotein 2) (MPM-2 reactive phosph [Bos taurus]  -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 3e-020     XP_877212.2 PREDICTED: similar to forkhead box M1 isoform 4 [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 3e-020     NP_973731.1 forkhead box M1 isoform 1 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 4e-021     XP_868047.1 PREDICTED: similar to forkhead box M1 isoform 3 isoform 4 [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-023     NP_032047.4 forkhead box M1 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Gg ---- 4e-024     XP_001231194.1 PREDICTED: hypothetical protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 7e-029     NP_957391.1 forkhead box M1-like [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 8e-097     NP_001089001.1 forkhead box protein M1 [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL190f21.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                    ]
  3   1   2      seed Ga12 5g3  out                        XL184i11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTACCCAGGACAACCNTATTCAGCTTACTCAAGACGAGGACTATACCTTCAAGACCCCCATCAAGGAGCATTTCTCAAAACCGCCCACCTTCTTCCACTCCCAGCAAACCGACTGATACAGGTCTTCTTCAACCTTGGGAATCCGAAACATCTCTTCCCAGAGACCCTGTGCTGGACTTCAGCCCTGTCCGTATCCCTCAAGGCTCAACTTTTACTCCCTTTAAAGATAACCTTGGAACTATGAGTTTTGGGGACACTCCGTTTAAAGATTTTGGCATATTTGGATCCCCCCAGAACCTTCTGAATGCACTTTCTCCTGCTTCTTCTCCACTACTGAGGCTTGAGAGCCCTTGTGTGTCACGCCAGCAGAAGCGATGTTCTAAGGAGCTGCAGGTGGGGGCTTCTGCTAACCGCTCACTACTGGAAGGTCTAGTGCTGGACACGGTTGACGACAGTCTAAGCAAAATTCTGCTGGACATTAGCTTCAGTGGCATGGAGGATGGCAATGGACTTGAGGTGGACGGTGTGTGGAGCCAGTTTCTTCCTGAATTCAAATGAAATCAAGTGTTCTGTAGATTCTTAACTTCCCCTTTAATATCCCAGGCTCAAAGCTCCACTGTAAGACTCCTACACAGCAGAATTGCCTCCTCACCCCATTCAAAACCGAAAACGCGAAATACACACGCTGCAGGCTGCTCTGGTTTCTCCACAACCAAGCCGCATGTATCTGAATTGTAAATTGTGTATAACGTAGATTTCACGTCTNTCCAGT
  3   1   2       bld Ga12 5g3  out                        XL190f21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTGAGTTTTGGGGACACTCCGTTTAAAGATTTTGGCATATTTGGATCCCCCCAGAACCTTCTGAATGCACTTTCTCCTGCTTCTTCTCCACTACTGAGGCTTGAGAGCCCTTATGTGTCACGCCAGCAGAAGCGATGTTCTAAGGAGCTGCAGGTGGGGGCTTCTGCTAACCGCTCACTACTGGAAGGTCTAGTGCTGGACACGGTTGACGACAGTCTAAGCAAAATTCTGCTGGACATTAGCTTCAGTGGCATGGAGGATGGCAATGGACTTGAGGTGGACGGTGTGTGGAGCCAGTTTCTTCCTGAATTCAAATGAAATCAAGTGTTCTGTAGATTCTTAACTTCCCCTTTAATATCCCAGGCTCAAAGCTCCACTGTAAGACTCCTACACAGCAGAATTGCCTCCTCACCCCATTCAAAACCGAAAACGCGAAATACACACGCTGCAGGCTGCTCTGGTTTCTCCACAACCAAGCCGCATGTATCTGAATTGTAAATTGTGTATAACGTAGATTTCACGTCTGTCCAGTTATAAAGGAGTGAGCTGGCAACACTAAGGGGCAGATTTATTAAGGGTCAAATTGAAAAATTTGAATACTCAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)