Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-rxlk157k16ex.3                        5 END     1          33       20                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl265h13.5                            3 PI      88        557      787                sterol regulatory element binding transcription factor 2 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012798600 Xl3.1-xl264h13.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl264h13.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCTTCCATGGCTATTGGCTGGTTACAAGGGGATGATTCTGTGGTGAAATCACACTTTGCAGAAGTAGAAAGAATTCCTAAGCTCCTTGACTCTGATAACCCTCTGGTGAAAGCAGTGATCCATGTGTGCCGAGCCATGCAAGCAGCTGTACTTGGTAAATGTGATGGCCAGCAGAGCTCATTCTATCACTGTGAGAAAGCCAGCACATTCTTGTGGAACAGTCTGAATATGAGCAGCACCGGCAACACAAATCTCAACAAGGTGGTGCAACTTTTAATTTGCGACCTTCTGCTTTCATTGCGCACTTCCTTATGGCAGAAACAGTCCTCCAGTCCAGCAGCTGGAGAATCTATTCATGCACCCACTTCTGTCCTAACAGGATTCCAGCGTGATCTCAGCAGTCTGCGTCGTTTGTCTTTCATCTTTAAACCTGCCCACTGCAAGCTCTTCCTCCATGAAGCCACAGTACGATTGATGGCTGGTGCAAGTCCAACCCGTACACATCAGCTTCTGCTACATAGCTTGCAAAAACGCACAGCACTTGCAAATAAACAAGGTGACCTGGACTCATTACCTGGGCAACGGGAGAGAGCTACAGCTATTCTTCTGGCCTGTCGACACCTACCACTTTCATTTCTGTCATCCCCTGGGCAGAGAGCCGTCATGCTTGCTGAAGCTGCCCGAACTCTCGAGAAAGTGGGTGACCGTCGTTCTTACCACGATTGCCAGCAAATGATGGTGAAGTTGAGCGGTGGCACTGCTATGGCAGCCTCCTGAAACGGACACTCGCCCAGATCTGTTGGGAAGAAACAACATTCTCTTTTTCC
                                                  Xl3.1-CHK-1012710185                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATGGCTATTGGCTGGTTACAAGGGGATGATTCTGTGGTGAAATCACACTTTGCAGAAGTAGAAAGAATTCCTAAGCTCCTTGACTCTGATAACCCTCTGGTGAAAGCAGTGATCCATGTGTGCCGAGCCATGCAAGCAGCTGTACTTGGTAAATGTGATGGCCAGCAGAGCTCATTCTATCACTGTGAGAAAGCCAGCACATTCTTGTGGAACAGTCTGAATATGAGCAGCACCGGCAACACAAATCTCAACAAGGTGGTGCAACTTTTAATTTGCGACCTTCTGCTTTCATTGCGCACTTCCTTATGGCAGAAACAGTCCTCCAGTCCAGCAGCTGGAGAATCTATTCATGCACCCACTTCTGTCCTAACAGGATTCCAGCGTGATCTCAGCAGTCTGCGTCGTTTGTCTTTCATCTTTAAACCTGCCCACTGCAAGCTCTTCCTCCATGAAGCCACAGTACGATTGATGGCTGGTGCAAGTCCAACCCGTACACATCAGCTTCTGCTACATATCTTGCAAAAACGCACAGCACTTGCAAATAAACAAGGTGACCTGGACTCATTACCTGGGCAACGGGAGAGAGCTACAGCTATTCTTCTGGCCTGTCGACACCTACCACTTTCATTTCTGTCATCCCCTGGGCAGAGAGCCGTCATGCTTGCTGAAGCTGCCCGAACTCTCGAGAAAGTGGGTGACCGTCGTTCTTACCACGATTGCCAGCAAATGATGGTGAAGTTGAGCGGTGGCACTGCTATGGCAGCCTCCTGAAACGGACACTCGCCCAGATCTGTTGGGAAGAAACAACATTCTCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     2     2     1     1     1     1     1     1     1     1     1     1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 2e-026     XP_001178836.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 4e-037     NP_524166.2 CG8522-PC [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 9e-041     XP_311076.4 AGAP000076-PA [Anopheles gambiae str. PEST] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 6e-057     XP_001790652.1 PREDICTED: sterol regulatory element binding transcription factor 1 [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                     PREDICTED - Dr ---- 8e-067     XP_001918672.1 PREDICTED: hypothetical protein [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 3e-097     NP_150087.1 sterol regulatory element binding factor 2 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 5e-098     XP_849087.1 PREDICTED: similar to sterol regulatory element-binding transcription factor 2 isoform 1 [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bt ---- 1e-098     XP_583656.3 PREDICTED: similar to sterol regulatory element-binding transcription factor 2 [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 3e-100     NP_004590.2 sterol regulatory element-binding transcription factor 2; sterol regulatoryelement-binding protein 2 [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 6e-101     XP_416222.2 PREDICTED: similar to sterol regulatory element binding protein-2 [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 1e-137     NP_001116910.1 sterol regulatory element binding transcription factor 2 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 5e-138     NP_001085554.1 MGC80395 protein [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl264h13.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATGATG------------------------ATG---------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  5   1   2       bld Emb3                            IMAGE:3399750.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCTTCCATGGCTATTGGCTGGTTACAAGGGGATGATTCTGTGGTGAAATCACACTTTGCAGAAGTAGAAAGAATTCCTAAGCTCCTTGACTCTGATAACCCTCTGGTGAAAGCAGTGATCCATGTGTGCCGAGCCATGCAAGCAGCTGTACTTGGTAAATGTGATGGCCAGCAGAGCTCATTCTATCACTGTGAGAAAGCCAGCACATTCTTGTGGAACAGTCTGAATATGAGCAGCACCGGCAACACAAATCTCAACAAGGTGGTGCAACTTTTAATTTGCGACCTTCTGCTTTCATTGCGCACTTCCTTATGGCAGAAACAGTCCTCCAGTCCAGCAGCTGGAGAATCTATTCATGCACCCACTTCTGTCCTAACAGGATTCCAGCGTGATCTCAGCAGTCTGCGTCGTTTGTCTTTCATCTTTAAACCTGCCCACTGCAAGCTCTTCCTCCATGAAGCCACAGTACGATTGATGGCTGGTGCAAGTCCAACCCGTACACATCAGCTTCTGCTACATATCTTGCAAAAACGCACAGCACTTGCAAATAAACAAGGTGACCTGGACTCATTACCTGGGCAACGGGAGAGAGCTACAGCTATTCTTCTGGCCTGTCGACACCTACCACTTTTATTCCTATCATCCACTGGG
  5   1   2      seed DMZ                                  xl264h13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTAACAGGATTCCAGCGTGATCTCAGCAGTCTGCGTCGTTTGTCTTTCATCTTTAAACCTGCCCACTGCAAGCTCTTCCTCCATGAAGCCACAGTACGATTGATGGCTGGTGCAAGTCCAACCCGTACACATCAGCTTCTGCAACATAGCTTGCAAAAACGCACAGCACTTGCAAATAAACAAGGTGACCTGGACTCATTACCTGGGCAACGGGAGAGAGCTACAGCTATTCTTCTGGCCTGTCGACACCTACCACTTTCATTCCTATCATCCCCTGGGCAGAGAGCAGTCATGCTTGCCGAAGCTGCCCGAACTCTTGAGAAAGTGGGCGACCGTCGCTCTTACCACGATTGTCANCAAATGATGGTAAAGCTGANTGGCGGTACTGCTATGGCAGCCTCCTGA
  5   1   1       add Tbd7      out                        XL057g22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCTGACCTTTAAACCTGCCCACTGCAAGCTCTTCCTNCATGAAGCCACAGTACGATTGATGGCCGGTGCAAGTCCAACTCGTACACATCAACTTCTGCAACACAGCCTACAAAAACGCACCGCACTTGCAAATAAACAAGGTGATCTGGACTCGTTACCTGGGCAGCGGGAGAGAGCTACAGCAATTCTCCTGGCCTGCCGACACCTACCACTTTCATTTCTGTCATCCCCTGGGCAGAGAGCCGTCATGCTTGCTGAAGCTGCCCGAACTCTCGAGAAAGTGGGTGACCGTCGTTCTTACCACGATTGCCAGCAAATGATGGTGAAGTTGAGCGGTGGCACTGCTATGGCAGCCTCCTGAAACGGACACTCGCCCAGATCTGTTGGGAAGAAACAACATTCTCTTTTTCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)