Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:4957303-IMAGp.5                 5 END     1          25       20                MGC84302 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 36%

 1012798628 Xl3.1-IMAGE:8538056.5 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8538056.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCAAGTGGCTCAGAAGCCGGGTGTCGAGCTGCCCCCACCCCAGTCGCAGCTCAAGTAAGAGCCCTGGCGGTTCTTGGGTGGGCCATACAGGTTTCCGGTTCCTATACTTCCTTCTGCATCCCGGTCTGTTGCATGTTGCCTGTGGCAGTTACACTGGATTTACTTTATCTCTCCATGTGCCAAGACCATGGGGGTCCCTAGGGGGCACCAGCTGATCATTAAGATTCATTGGCTGCTCTCTGCACACGCCCACCATTGTCTTGGTTACCAGGGTGACAATATAATTCCAGTCTGGAGTGCTACCGAGCTGCCAAGAATATTTGCTGTGAATGAAAAGTACAATGATAACGATGGTGATGCATGACTTTAACTGTTCATTATTTCTCTCCCACCCCTTCTTTATGTTCCTCCTTTATCATCTCTTCTCCAACGTAACCGCCTCACCCCTGGTCCTGTTTGGCATCCTTCGCAATTGTGCTGCCATGTGCTTGGGTTGTGCATGTTCTGCTCCATCTGTCTTGTGCCCCCACAAACCTCTGGTGCCCGTGTCTCATGTCACCGCTCCCCACTATGGCACCTCTTCTCCTCCTTCTACACAAACATCTCACCGGATGTTGGCTTCTTTACCCACTTACAATCCCACGTCACCCTTCCATCTTGTGCCCCCCTTGCACCCCAATTCATTTGCCTCCACCAGTAAGTCCCAGTCCCTCACCAACTCCTTCACCCTTGCAGACACGCAGGCTCCTCGCTCCAACCTTAGCCAAGATGAAGCAAAAGCCGAAACGATCCGCAACCTGAGGAAATCCTTTGCCAGTCTCTTCTCTGACTAATGGAGGGGTCGCCGGAACCTCACTTGTACCCTTTTCCCACTTCATGCCCCCCCTTAAGCCCCGTGGCTTTGTGTATGAACTGTTCCCTTGCCCCCTGTGACACATATGCACGGCTTCTTGTGCTGGTGCCACACAATATGGACACGTGGATATGGGAACAAGAGAGAGAGAAATCTGTATAAAGAGGAACGTGACATATTTCTACGCTCTATAGACAGGTCCTTATTGGTGCTGGTACATTCCCCAGTGCAGCATGACACATGCTGGTTGTTGTGCCCCAGTCAGTGGTGTCATTGTGGCTTGGTGTTGCTAGTGGAGTAGTTCAACGTGTGCGTTTGTGAGTATTTGCCATTGCGCTCTCATATCGTAACACCCTCCTTTCCAGGCCGTATCTCAGTTGTGCCCCATCGCCATTGTCATGTTCCTTCTGCTTAGATTACATTCCTGGCCTGGCACCCATCTTTCCCACGCCTCAGCACCCTCATAAATTTTGTTGTCAAGCAAAGCTTGGGGTTATTTGCCAGCACGGCTAATGTTTCTGATGAACCTTGTGTTGCCATGGACTAGTTTTGTGTGCCAGTAAATGTGTTGTGTGTGTAACCCCAGCTTGCCAGTGTATGGTGTAACATTGCCACAAATTTGTTGGTGCCCCCCATAGCAAACTATTCTTCTAAGTATTACCAGTCATTTATTTCACCACGTCAGCCCCCCCCCCACACATTGTCAAGGAACTGGAGGAGAAACGAGTATATAGCTTGTCTGTAAATGGTGAAAATGTGCCCCCTCCCGGGTAATATA
                                                  Xl3.1-CHK-1012708099                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGCTCAGAAGCCGGGTGTCGAGCTGCCCCCACCCCAGTCGCAGCTCAAGTAAGAGCCCTGGCGGTTCTTGGGTGGGCCATACAGGTTTCCGGTTCCTATACTTCCTTCTGCATCCCGGTCTGTTGCATGTTGCCTGTGGCAGTTACACTGGATTTACTTTATCTCTCCATGTGCCAAGACCATGGGGGTCCCTAGGGGGCACCAGCTGATCATTAAGATTCATTGGCTGCTCTCTGCACACGCCCACCATTGTCTTGGTTACCAGGGTGACAATATAATTCCAGTCTGGAGTGCTACCGAGCTGCCAAGAATATTTGCTGTGAATGAAAAGTACAATGATAACGATGGTGATGCATGACTTTAACTGTTCATTATTTCTCTCCCACCCCTTCTTTATGTTCCTCCTTTATCATCTCTTCTCCAACGTAACCGCCTCACCCCTGGTCCTGTTTGGCATCCTTCGCAATTGTGCTGCCATGTGCTTGGGTTGTGCATGTTCTGCTCCATCTGTCTTGTGCCCCCACAAACCTCTGGTGCCCGTGTCTCATGTCACCGCTCCCCACTATGGCACCTCTTCTCCTCCTTCTACACAAACATCTCACCGGATGTTGGCTTCTTTACCCACTTACAATCCCxxxxxxCCCTTCCATCTTGTGCCCCCCTTGCACCCCAATTCATTTGCCTCCACCAGTAAGTCCCAGTCCCTCACCAACTCCTTCACCCTTGCAGACACGCAGGCTCCTCGCTCCAACCTTAGCCAAGATGAAGCAAAAGCCGAAACGATCCGCAACCTGAGGAAATCCTTTGCCAGTCTCTTCTCTGACTAATGGAGGGGTCGCCGGAACCTCACTTGTACCCTTTTCCCACTTCATGCCCCCCCTTAAGCCCCGTGGCTTTGTGTATGAACTGTTCCCTTGCCCCCTGTGACACATATGCACGGCTTCTTGTGCTGGTGCCACACAATATGGACACGTGGATATGGGAACAAAAGAGAGAGAAATCTGTATAAAGAGGAACGTGACATATTTCTACGCTCTATAGACAGGTCCTTATTGGTGCTGGTACATTCCCCAGTGCAGCATGACACATGCTGGTTGTTGTGCCCCAGTCAGTGGTGTCATTGTGGCTTGGTGTTGCTAGTGGAGTAGTTCAACGTGTGCGTTTGTGAGTATTTGCCATTGCGCTCTCATATCGTAACACCCTCCTTTCCAGGCCGTATCTCAGTTGTGCCCCATCGCCATTGTCATGTTCCTTCTGCTTAGATTACATTCCTGGCCTGGCACCCATCTTTCCCACGCCTCAGCACCCTCATAAATTTTGTTGTCAAGCAAAGCTTGGGGTTATTTGCCAGCACGGCTAATGTTTCTGATGAACCTTGTGTTGCCATGGACTAGTTTTGTGTGCCAGTAAATGTGTTGTGTGTGTAACCCCAGCTTGCCAGTGTATGGTGTAACATTGCCACAAATTTGTTGGTGCCCCCCATAGCAAACTATTCTTCTAAGTATTACCAGTCATTTATTTCACCACGTCAGCCCCCCCCCCACACATTGTCAAGGAACTGGAGGAGAAACGAGTATATAGCTTGTCTGTAAATGGTGAAAATGTGCCCCCTCCCGGGT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     3     2     3     1     3     1     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN     516      14                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     330      48                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     330       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PREDICTED - Dr ---- 1e-009     NP_001119909.1 hypothetical protein LOC570672 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                  PROTEIN --- Xl ---- 6e-010     NP_001079204.1 synapsin IIIa [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================
                                                                                                                                             PROTEIN --- Xt ---- 2e-010     AAI67591.1 Unknown (protein for MGC:184865) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bt ---- 1e-011     NP_776616.1 synapsin I [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-011     NP_038708.3 synapsin I isoform a [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================
                                                                                                                                                                     PROTEIN --- Hs ---- 2e-012     NP_598328.1 synapsin II isoform IIa [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                              PREDICTED - ?? ---- 2e-012     XP_001789269.1 PREDICTED: similar to synapsin II [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 4e-013     XP_541766.2 PREDICTED: similar to synapsin II isoform IIb [Canis familiaris] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8538056.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGA------------------------------------------------------------------TAA------------------------------------------TGAATG---------ATG------ATG---ATG------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------TAA------------------TGA---------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------ATG---TAG------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAATG------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                               ...
  5   1   1       add Eye1 5g                         IMAGE:7020273.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCAAGTGGCTCAGAAGCCGGGTGTCGAGCTGCCCCCACCCCAGTCGCAGCTCAAGTAAGAGCCCTGGCGGTTCTTGGGTGGGCCATACAGGTTTCCGGTTCCTATACTTCCTTCTGCATCCCGGTCTGTTGCATGTTGCCTGTGGCAGTTACACTGGATTTACTTTATCTCTCCATGTGCCAAGACCATGGGGGTCCCTAGGGGGCACCAGCTGATCATTAAGATTCATTGGCTGCTCTCTGCACACGCCCACCATTGTCTTGGTTACCAGGGTGACAATATAATTCCAGTCTGGAGTGCTACCGAGCTGCCAAGAATATTTGCTGTGAATGAAAAGTACAATGATAACGATGGTGATGCATGACTTTAACTGTTCATTATTTCTCTCCCACCCCTTCTTTATGTTCCTCCTTTATCATCTCTTCTCCAACGTAACCGCCTCACCCCTGGTCCTGTTTGGCATCCTTCGCAATTGTGCTGCCATGTGCTTGGGTTGTGCATGTTCTGCTCCATCTGTCTTGTGCCCCCACAAACCTCTGGTGCCCGTGTCTCATGTCACCGCTCCCCACTATGGCACCTCTTCTCCTCCTTCTACACAAACATCTCACCGGATGTTGGCTTCTTTACCCACTTACAATCccacgtcatccccttccatcttgtgcccccccttgcaccccaaatccatttgcctcccccaATTAAGTCACCAGTCCCTCAACCAAAATCCTTCAACCCCTGGCTAGAAATCGCAAAGGTTCCTCCGGCTTCAAAACTTTTAGCCCCAAAATTGAAGGAAAAAACCCCAAAACCTAATCCGCCCAACCCTTAGGGGGAAATCCCCTTTGCCCAGAGCCCTCATCCCCGTAACACATATGGTAAGGGGGTTccccccggaaaacccccccT
  5   1   2       bld Tad2                            IMAGE:6936591.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGGGCTCCCCACTATGGCACCTCTTCTCCTCCTTCTACACAAACATCTCACCGGATGTTGGCTCTTTACCCACTTACAATCCCACGTCATCCCTTCCATCTTGTGCCCCCCTTGCACCCCAATTCATTTGCCTCCACCAGTAAGTCCCAGTCCCTCACCAACTCCTTCACCCTTGCAGACACGCAGGCTCCTCGCTCCAACCTTAGCCAAGATGAAGCAAAAGCCGAAACGATCCGCAACCTGAGGAAATCCTTTGCCAGTCTCTTCTCTGACTAATGGAGGGGTCGCCGGAACCTCACTTGTACCCTTTTCCCACTTCATGCCCCCCCTTAAGCCCCGTGGCTTTGTGTATGAACTGTTCCCTTGCCCCCTGTGACACATATGCACGGCTTCTTGTGCTGGTGCCACACAATATGGACACGTGGATATGGGAACAAAAGAGAGAGAAATCTGTATAAAGAGGAACGCGACATATTTCTACGCTCTATAGACAGGTCCTTATTGGTGCTGGTACATTCCCCAGTGCAGCATGACACATGCTGGTTGTTGTGCCCCAGTCAGTGGTGTCATTGTGGCTTGGTGTTGCTAGTGGAGTAGTTCAACGTGTGCGGTTTGTGAAGTCTTTGCCATTGCGCCTCTCATATCCGTAACACCCCTCCCTTTTCCAGGCCGGTATTCTCAGTTTGGTGCCCCCAATCCCCCCAATTTGGTCAATGTTTTCCCTTTCCTGCCTTTAGAAATTTAAACATTTCCTTGGGCCCCCTGGGGCAACCCCC
  5   1   2      seed Brn3                            IMAGE:8538056.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAAAATNNNNCCATCGTGTCGNNGAAGNACATCNAATAAATTCGNCCCCCNTCATCCCTTCCATCTTGTGCCCCCCTTGCACCCCAATTCATTTGCCTCCACCAGTAAGTCCCAGTCCCTCACCAACTCCTTCACCCTTGCAGACACGCAGGCTCCTCGCTCCAACCTTAGCCAAGATGAAGCAAAAGCCGAAACGATCCGCAACCTGAGGAAATCCTTTGCCAGTCTCTTCTCTGACTAATGGAGGGGTCGCCGGAACCTCACTTGTACCCTTTTCCCACTTCATGCCCCCCCTTAAGCCCCGTGGCTTTGTGTATGAACTGTTCCCTTGCCCCCTGTGACACATATGCACGGCTTCTTGTGCTGGTGCCACACAATATGGACACGTGGATATGGGAACAAGAGAGAGAGAAATCTGTATAAAGAGGAACGTGACATATTTCTACGCTCTATAGACAGGTCCTTATTGGTGCTGGTACATTCCCCAGTGCAGCATGACACATGCTGGTTGTTGTGCCCCAGTCAGTGGTGTCATTGTGGCTTGGTGTTGCTAGTGGAGTAGTTCAACGTGTGCGTTTGTGAGTCTTTGCCATTGCGCTCTCATATCGTAACACCCTCCTTTCCAGGCCGTATCTCAGTTGTGCCCCATCGACATTGTCATGTTCCTTCTGCTTAGATTACATTCCTGGCCTGGCACCCATCTCTCCCACGCCTCAGCAACCTCATGAAATTTGTTGTCAAGCAAAGCTTGCGGTT
  3   1   1       add Eye1      out                   IMAGE:6957158.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCCCAAGGATGAAGGGCAAAAAAGCCTGGAAAGCGATTCCGGCCAAACCTGGAGGGAAAATCCTTTTGGCCAGTTCTTTTTCTTCTAGATTAATATGGAGGGGGTGGTCCCGAAACCTTCAATTTGTTCCCTTTTTCCCAATTTCTATGCCCCCCCCTTAAGCCCCGTGGGTTTTGTGTATGAACTGTTCCCTTTGCCCCCTGTGACACATATGCACGGCTTCTTGTGCTGGTGCCACACAATATGGACACGTGGATATGTGAACAAAAGAGAGAGAAATCTGTATAAAGAGGAACGTGACATATTTCTACGCTCTATAGACAGGTCCTTATTGGTGCTGGTACATTCCCCAGTGCAGCATGACACATGCTGGTTGTTGTGCCCCAGTCAGTGGTGTCATTGTGGCTTGGTGTTGCTAGTGGAGTAGTTCAACGTGTGCGTTTGTGAGTATTTGCCATTGCGCTCTCATATCGTAACACCCTCCTTTCCAGGCCGTATCTCAGTTGTGCCCCATCGCCATTGTCATGTTCCTTCTGCTTAGATTACATTCCTGGCCTGGCACCCATCTTTCCCACGCCTCAGCACCCTCATAAATTTTGTTGTCAAGCAAAGCTTGGGGTTATTTGCCAGCACGGCTAATGTTTCTGATGAACCTTGTGTTGCCATGGACTAGTTTTGTGTGCCAGTAAATGTGTTGTGTGTGTAACCCCAGCTTGCCAGTGTATGGTGTAACATTGCCACAAATTTGTTGGTGCCCCCCATAGCAAACTATTCTTCTAAGTATTACCAGTCATTTATTTCACCACGTCAGCCCCCCCCCCACACATTGTCAAGGAACTGGAGGAGAAACGAGTATATAGCTTGTCTGTAAATGGTGAAAATGTGCCCCCTCCCGGGTAATATAGAAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)