Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:4175596.3.5                    13 PI      94         13      354                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:8548910.5                      10 PI      99        118      249                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:4633229-IMAGp.5.5              10 PI      95         13      356                (no blast hit)
     4   0.0    0Xl3.1-XL518p22ex.3                         10 PI      94         13      373                (no blast hit)
     5   0.0    0Xl3.1-XL423o19ex.5                          9 PI      95         78      270                (no blast hit)
     6   0.0    0Xl3.1-IMAGE:4085038.3                       8 PI      91         85      291                Nuclear Hormone Receptor family member (nhr-88) [Caenorhabditis elegans]
     7   0.0    0Xl3.1-XL426d03ex.5                          4 PI      97         82      244                (no blast hit)
     8   0.0    0Xl3.1-xl247g06.5                            4 PI      91        162      335                (no blast hit)
     9   0.0    0Xl3.1-IMAGE:5515411.5                       3 PI      86         17      319                (no blast hit)
    10   0.0    0Xl3.1-XL425p16ex.3                          3 PI      85         99      336                (no blast hit)
    11   0.0    0Xl3.1-IMAGE:3437493.5                       2 PI      88         13      356                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012799193 Xl3.1-xlk133g02ex.3 - 2 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk133g02ex.3 CCCACGCGTCCGAGAACATTCCTTCTCTGTATATTTGTATTTATACATATGGGAGGAGGAGGTGCCATATTGACAGTACAGTATGAGGGTATAGCTTATTGTGTGCCCAGAGCATTCCTTCTCTGTATATTTGTATTTATACATATGGGAGGAGGAGGTGCCATATTGATTCCCTTAGACTGTACAGTATGAGGGTATAGCTTATTGTGTGCCCAGAACATTCCTTCTCTGTATATTTGTATTTATACATATGGGAGGAGGGAGGTGCCAAATTGATTCCCTTAGACAGTACAGTATAAGGGTATAGCTTATTGTGTGCCCAGAACATTCCTTCTCTGTATATTTGTATTTATACACATCAGTAGGAGGTGCCTGCCTTTCACGGGATAGTAACATGAGTACTTAATGACTGGAAGAACAAAGTTGTATATTTAAATATTCTGGTTTTATATGTCTTCAAACAGTGACTTATTTGGAGCAATTTCAGTCATCTTGAAAAATACATATTTTGGCACAGTCTGGTGAGTTTGTTGTTGCATCAATGTTTATTTTAACATATTAAAT
                                                  Xl3.1-CHK-1012719040       CGTCCGAGAACATTCCTTCTCTGTATATTTGTATTTATACATATGGGAGGAGGAGGTGCCATATTGACAGTACAGTATGAGGGTATAGCTTATTGTGTGCCCAGAGCATTCCTTCTCTGTATATTTGTATTTATACATATGGGAGGAGGAGGTGCCATATTGATTCCCTTAGACTGTACAGTATGAGGGTATAGCTTATTGTGTGCCCAGAACATTCCTTCTCTGTATATTTGTATTTATACATATGGGAGGAGGGAGGTGCCAAATTGATTCCCTTAGACAGTACAGTATAAGGGTATAGCTTATTGTGTGCCCAGAACATTCCTTCTCTGTATATTTGTATTTATACACATCAGTAGGAGGTGCCTGCCTTTCACGGGATAGTAACATGAGTACTTAATGACTGGAAGAACAAAGTTGTATATTTAAATATTCTGGTTTTATATGTCTTCAAACAGTGACTTATTTGGAGCAATTTCAGTCATCTTGAAAAATACATATTTTGGCACAGTCTGGTGAGTTTGTTGTTGCATCAATGTTTATTTTAACATATTAAATAAAGNT
                                                      consensus depths      1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1
                                                   Xl3.1-xlk133g02ex.3                                                 ATG---------------------------------------------------------------------------------------------ATG------------------------------------------TGA---------------------------------------------------------------------------------TGA------TAG------------------------------------------------------------------------------------------------------TAGTAA------------ATG------------------------TAA---------------ATG---------------------------------------------------------------------TGA
  3   1   2       bld Ga18      in                      xlk133g02ex.3p CCCACGCGTCCGAGAACATTCCTTCTCTGTATATTTGTATTTATACATATGGGAGGAGGAGGTGCCATATTGACAGTACAGTATGAGGGTATAGCTTATTGTGTGCCCAGAGCATTCCTTCTCTGTATATTTGTATTTATACATATGGGAGGAGGAGGTGCCATATTGATTCCCTTAGACTGTACAGTATGAGGGTATAGCTTATTGTGTGCCCAGAACATTCCTTCTCTGTATATTTGTATTTATACATATGGGAGGAGGGAGGTGCCAAATTGATTCCCTTAGACAGTACAGTATAAGGGTATAGCTTATTGTGTGCCCAGAACATTCCTTCTCTGTATATTTGTATTTATACACATCAGTAGGAGGTGCCTGCCTTTCACGGGATAGTAACATGAGTACTTAATGACTGGAAGAACAAAGTTGTATATTTAAATATTCTGGTTTTATATGTCTTCAAACAGTGACTTATTTGGAGCAATTTCAGTCATCTTGAAAAATACATATTTTGGCACAGTCTGGTGAGTTTGTTGTTGCATCAATGTNTATT
  5   1   2      seed Ga18      in                      xlk133g02ex.5p             AGAACATTCCTTCTCTGTATATTTGTATTTATACATATGGGAGGAGGAGGTGCCATATTGACAGTACAGTATGAGGGTATAGCTTATTGTGTGCCCAGAGCATTCCTTCTCTGTATATTTGTATTTATACATATGGGAGGAGGAGGTGCCATATTGATTCCCTTAGACTGTACAGTATGAGGGTATAGCTTATTGTGTGCCCAGAACATTCCTTCTCTGTATATTTGTATTTATACATATGGGAGGAGGGAGGNGCCAAATTGATTCCCTTAGACAGTACAGTATAAGGGTATAGCTTATTGTGTGCCCAGAACATTCCTTCTCTGTATATTTGTATTTATACACATCAGTAGGAGGNGCCTGCCTTTCACGGGATAGTAACATGAGTACTTAATGACTGGAAGAACAAAGTTGTATATTTAAATATTCTGGTTTTATATGTCTTCAAACAGTGACTTATTTGGAGCAATTTCAGTCATCTTGAAAAATACATATTTTGGCACAGTCTGGTGAGTTTGTTGTTGCATCAATGTTTATTTTAACATATTAAATAAAGNTGTTCCNAAATC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)