Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 61%

 1012799208 Xl3.1-XL092j24.5 - 2 ESTs
                                                                       .....-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL092j24.5                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGAGATCCGGCAGAGGTTCAGCTGGAGTGAGAACAGGGGTCGGTGTTGCGGGCTGGGATCTTGATAAAACCAGGAAACATGATTTCAGAAGGAGGTTCGTTTATGCGGGGCATGTTGATAGGAGGAGGCTTCTGTGTAGTCATCACGCTTCTGGGACATATTAAAGTTGGACATGAACATGGTATCTCCCATGAACATCATCACATTCAGGCACCAGATAAGGAGCAAGTTAAGAAGCTGTCGGAAGCGGAACGTGTGGAACTCAGCCAGAGCATGCGTGTGTATTGTATAATCCTTGTAAGGCCAAAAGACTTAAGTCAATGGGCTGCTGTCCGTGAAATCTGGAGCAAACACTGTGACAAAGTTGACTACTACAGCTCGGAACCAATGAAAGTGTTTGACTCCATTTCTGTCGACACCAATGACATGTGGACGATGATGAGAAGAGCCATCCAGAAGGCCTATGAGAACAACAAGAACGAGTACAACTGGTTCTTTATATGCACGCCTTCCACCTTTGCAGTGATCGAAAACCTGAAATATTTCCTACTCCAAAAAGATCCTTCTCAGCCATTTTACATCGGCCACACTATGAAATCCGGAGACTTGGACTACGTTGATATCACTGGCGGGATAGTATTGAGCATTGAGTCGCTGAATCGCCTTTTCGCCGTTTTCGAGAAGCCGGAGAAATGCCCCGAGCAGGGCGGCTTGATAT
                                                  Xl3.1-CHK-1012718616                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCCGGCAGAGGTTCAGCTGGAGTGAGAACAGGGGTCGGTGTTGCGGGCTGGGATCTTGATAAAACCAGGAAACATGATTTCAGAAGGAGGTTCGTTTATGCGGGGCATGTTGATAGGAGGAGGCTTCTGTGTAGTCATCACGCTTCTGGGACATATTAAAGTTGGACATGAACATGGTATCTCCCATGAACATCATCACATTCAGGCACCAGATAAGGAGCAAGTTAAGAAGCTGTCGGAAGCGGAACGTGTGGAACTCAGCCAGAGCATGCGTGTGTATTGTATAATCCTTGTAAGGCCAAAAGACTTAAGTCAATGGGCTGCTGTCCGTGAAATCTGGAGCAAACACTGTGACAAAGTTGACTACTACAGCTCGGAACCAATGAAAGTGTTTGACTCCATTTCTGTCGACACCAATGACATGTGGACGATGATGAGAAGAGCCATCCAGAAGGCCTATGAGAACAACAAGAACGAGTACAACTGGTTCTTTATATGCACGCCTTCCACCTTTGCAGTGATCGAAAACCTGAAATATTTCCTACTCCAAAAAGATCCTTCTCAGCCATTTTACATCGGCCACACTATGAAATCCGGAGACTTGGACTACGTTGATATCACTGGCGGGATAGTATTGAGCATTGAGTCGCTGAATCGCCTTTTCGCCGTTTTCGAGAAGCCGGAGAAATGCCCCGAGCAGGGCGGCTTGATATTTAAAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                   1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG      80     107                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               BLH MIN      80      78                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 2e-013     NP_499293.2 core1 UDP-galactose:N-acetylgalactosamine-alpha-R beta1,3-galactosyltransferase(44.1 kD) (3L473) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Cf ---- 2e-013     XP_539431.2 PREDICTED: similar to core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 isoform 1 [Canis familiaris] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ag ---- 3e-014     XP_319116.4 AGAP009979-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Sp ---- 7e-017     XP_786522.2 PREDICTED: similar to GA21851-PA, partial [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 6e-017     NP_608720.1 CG18558-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Dr ==== 1e-063     NP_955961.1 Unknown (protein for MGC:66375) [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Mm ==== 3e-083     NP_067525.1 hypothetical protein from clone 1-44 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Bt ==== 1e-083     NP_001029747.1 C1GALT1-specific chaperone 1 [Bos taurus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 1e-083     NP_001011551.1 C1GALT1-specific chaperone 1 [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Gg ==== 7e-088     XP_420333.2 PREDICTED: similar to C1GALT1-specific chaperone 1 [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xt ==== 8e-113     NP_001004886.1 MGC88924 protein [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Xl ==== 3e-123     NP_001088206.1 hypothetical protein LOC495031 [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL092j24.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGA------------------------------------------------ATG---------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  5   1   2       bld Tad2 5g                         IMAGE:6934106.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGAGATCCGGCAGAGGTTCAGCTGGAGTGAGAACAGGGGTCGGTGTTGCGGGCTGGGATCTTGATAAAACCAGGAAACATGATTTCAGAAGGAGGTTCGTTTATGCGGGGCATGTTGATAGGAGGAGGCTTCTGTGTAGTCATCACGCTTCTGGGACATATTAAAGTTGGACATGAACATGGTATCTCCCATGAACATCATCACATTCAGGCACCAGATAAGGAGCAAGTTAAGAAGCTGTCGGAAGCGGAACGTGTGGAACTCAGCCAGAGCATGCGTGTGTATTGTATAATCCTTGTAAGGCCAAAAGACTTAAGTCAATGGGCTGCTGTCCGTGAAATCTGGAGCAAACACTGTGACAAAGTTGACTACTACAGCTCGGAACCAATGAAAGTGTTTGACTCCATTTCTGTCGACACCAATGACATGTGGACGATGATGAGAAGAGCCATCCAGAAGGCCTATGAGAACAACAAGAACGAGTACAACTGGTTCTTTATATGCACGCCTTCCACCTTTGCAGTGATCGAAAACCTGAAATATTTCCTACTCCAAAAAGATCCTTCTCAGCCATTTTACATCGGCCACACTATGAAATCCGGAGACTTGGACTACGTTGATATCACTGGCGGGATAGTATTGAGCATTGAGTCGCTGAATCGCCTTTTCGCCGTTTTCGAGAAGCCGGAGAAATGCCCCGAGCAGGGCGGCTTGATATTTAAAGAAG
  5   1   2      seed Tbd7 5g                              XL092j24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCGGGCTGGGATCTTGATAAAACCGGAAACATGATTTCAGAAGGAGGTTCGTTTATGCGGGGCATGTTGATAGGAGGAGGCTTCTGTGTAGTCATCACGCTTCTGGGACATATTAAAGTTGGACATGAACATGGTATCTCCCATGAACATCATCACATTCAGGCACCAGATAAGGAGCAAGTTAAGAAGCTGTCGGAAGCGGAACGTGTGGAACTCAGCCAGAGCATGCGTGTGTATTGTATAATCCTTGTAAGGCCAAAAGACTTAAGTCAATGGGCTGCTGTCCGTGAAACCTGGAGCAAACACTGTGACAAAGCTGACTACTACAGCTCGGAACCAATGAAAGTGTTTGACTCCATTTCTGTCGACACCAATGACATGTGGACGATGATGAGAAGAGCCATCCAGAAGGCCTATGAGAACAACAAGAACGAGTACAACTGGTTCTTTATATGCACGCCTTCCACCTTTGCAGTGATCGAAAACCTGAAATATTTCCTACTCCAAAAAGATCCTTCTCAGCCATTTTACATCGGCCACACTATGAAATCCGGAGACTTGGACTACGTTGATATCACTGGCGGAATAGTATTGAGCATTGAGTCGCTGAATCGCCTTTCCGCCGTTTTCGAGGAGCCGGAGAAATGCCCCGAGCAGGGCGGCTTGATATTTAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)