Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL006c05.5                            3 PI      84          1      514                hypothetical protein LOC100158347 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012799296 Xl3.1-IMAGE:5047960.5 - 2 ESTs
                                                                       ...-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5047960.5                                                                          CTGAACTAGTAAAGGTATGTGGTCGCATATTTCCGGACCCTGGTATCGTGCATGGTGAAAGGCCGTTCACAGCTTACTGTGTCATTAATCAGACTTGTCTCAGAGAAGATGCCAGTAGAATATATTGGCTTGTCAAAGGTGTTAAGGTACCAGAGACGCAGTACGAGATCTTAAACCAAACGACTTCAAGTGTAACTTTTGAGAACCTTACTACTCTGAACAGTCCTCTGACGTGTAATGTAATGGCATCTGGACATGTTGCAAATACACTGTATGGAATTTTCTTCACATTGGGTTTGCCTCCAGATAAGCCTACGAACCTGACGTGCATTGTGTATAACCACGACAACCTGACCTGCACTTGGGACCCTGGAAGGCCTACTAATCTGCCTACAAACTACACTCTATCACACCGATGGGCACACTTTGGCGCAAACTACTGCAGAGGAGCCAATAATTCTTGTACAATCCATTCTCCAGGATTTCAGTTCTATATTGATACTACATTCCAAGTGGAAGCCACAAATGAGCTTGGAATTCAAAAATCGGAGACGCTGACAATAGATCCTGTCAATATAGTCAAACCTAATCCACCTCAACTCAGTGAGCTTATCTCATCCCTGGAGTTACCAAATGCACTGAAAATCGAATGGAAGAACCCAATAACGAATGCTTTTAATCTGA
                                                  Xl3.1-CHK-1012715416                                                                                TAGTAAAGGTATGTGGTCGCATATTTCCGGACCCTGGTATCGTGCATGGTGAAAGGCCGTTCACAGCTTACTGTGTCATTAATCAGACTTGTCTCAGAGAAGATGCCAGTAGAATATATTGGCTTGTCAAAGGTGTTAAGGTACCAGAGACGCAGTACGAGATCTTAAACCAAACGACTTCAAGTGTAACTTTTGAGAACCTTACTACTCTGAACAGTCCTCTGACGTGTAATGTAATGGCATCTGGACATGTTGCAAATACACTGTATGGAATTTTCTTCACATTGGGTTTGCCTCCAGATAAGCCTACGAACCTGACGTGCATTGTGTATAACCACGACAACCTGACCTGCACTTGGGACCCTGGAAGGCCTACTAATCTGCCTACAAACTACACTCTATCACACCGATGGGCACACTTTGGCGCAAACTACTGCAGAGGAGCCAATAATTCTTGTACAATCCATTCTCCAGGATTTCAGTTCTATATTGATACTACATTCCAAGTGGAAGCCACAAATGAGCTTGGAATTCAAAAATCGGAGACGCTGACAATAGATCCTGTCAATATAGTCAAACCTAATCCACCTCAACTCAGTGAGCTTATCTCATCCCTGGAGTTACCAAATGCACTGAAAATCGAATGGAAGAACCCAATAACGAATGCTTTTAATCTGAAATACA
                                                      consensus depths                                                                               1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                          PROTEIN --- Bt ---- 5e-013     NP_001120644.1 interleukin 23 receptor [Bos taurus] ----------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                     PROTEIN --- Dr ---- 1e-020     NP_001002650.1 zgc:91992 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                PROTEIN --- Hs ---- 5e-043     NP_786943.1 interleukin 6 signal transducer isoform 2 precursor [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                PREDICTED - Cf ---- 3e-043     XP_535239.2 PREDICTED: similar to Interleukin-6 receptor beta chain precursor (IL-6R-beta) (Interleukin 6 signal transducer) (Membrane glycoprotein 130) (gp130) (Oncostatin M receptor) (CDw130) (CD130 antigen) [Canis familiaris] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                PROTEIN --- Mm ---- 3e-044     NP_034690.2 interleukin 6 signal transducer [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                PREDICTED - ?? ---- 2e-044     XP_600430.4 PREDICTED: similar to interleukin 6 signal transducer (gp130, oncostatin M receptor) [Bos taurus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Gg ---- 1e-046     NP_990202.1 glycoprotein 130 [Gallus gallus] --=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PROTEIN === Xl ==== 2e-135     AAI10983.1 Unknown (protein for IMAGE:5047960) [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5047960.5                                                                                                                                                                                                                                                                                                                            ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                  ...
  5   1   2       bld Ov1                    IMAGE:5047960-IMAGp.IMAGp                                                                          CTGAACTAGTAAAGGTATGTGGTCGCATATTTCCGGACCCTGGTATCGTGCATGGTGAAAGGCCGTTCACAGCTTACTGTGTCATTAATCAGACTTGTCTCAGAGAAGATGCCAGTAGAATATATTGGCTTGTCAAAGGTGTTAAGGTACCAGAGACGCAGTACGAGATCTTAAACCAAACGACTTCAAGTGTAACTTTTGAGAACCTTACTACTCTGAACAGTCCTCTGACGTGTAATGTAATGGCATCTGGACATGTTGCAAATACACTGTATGGAATTTTCTTCACATTGGGTTTGCCTCCAGATAAGCCTACGAACCTGACGTGCATTGTGTATAACCACGACAACCTGACCTGCACTTGGGACCCTGGAAGGCCTACTAATCTGCCTACAAACTACACTCTATCACACCGATGGGCACACTTTGGCGCAAACTACTGCAGAGGAGCCAATAATTCTTGTACAATCCATTCTCCAGGATTTCAGTTCTATATTGATACTACATTCCAAGTGGAAGCCACAAATGAGCTTGGAATTCAAAAATCGGAGACGCTGACAATAGATCCTGTCAATATAGTCAAACCTAATCCACCTCAACTCAGTGAGCTTATCTCATCCCTGGAGTTACCAAATGCACTGAAAATCGAATGGAAGAACCCAATAACGAATGCTTTTAATCTGAAATACAACATC
  5   1   2      seed Ov1       out                   IMAGE:5047960.5p                                                                            GAACTAGTAAAGGTATGTGGTCGCATATTTCCGGACCCTGGTATCGTGCATGGTGAAAGGCCGTTCACAGCTTACTGTGTCATTAATCAGACTTGTCTCAGAGAAGATGCCAGTAGAATATATTGGCTTGTCAAAGGTGTTAAGGTACCAGAGACGCAGTACGAGATCTTAAACCAAACGACTTCAAGTGTAACTTTTGAGAACCTTACTACTCTGAACAGTCCTCTGACGTGTAATGTAATGGCATCTGGACATGTTGCAAATACACTGTATGGAATTTTCTTCACATTGGGTTTGCCTCCAGATAAGCCTACGAACCTGACGTGCATTGTGTATAACCAAGACAACCTGACCTGCACTTGGGACCCTGGAAGGCCTACTAATCTGCCTACAAACTACACTCTATCACACCGATGGGCACACTTTGGCGCAAACTACTGCAGAGGAGCCAATAATTCTTGTACAATCCATTCTCCAGGATTTCAGTTCTATATTGATACTACATTCCAAGTGGAAGCCACAAATGAGCTTGGAATTTCAAAATCGGAGAACGCTGACATAGATCCTGTCAATATAGTCAAACCTAATCCACCTCAACTCAGTGAGCTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)