Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6878618.3                       3 END     2         100       66                chromobox homolog 4 (Pc class homolog, Drosophila); polycomb 2 [Danio rerio]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6878618.3                       3 PI      88        620      900                chromobox homolog 4 (Pc class homolog, Drosophila); polycomb 2 [Danio rerio]

 This cluster: approximate FL confidence score = 0%

 1012799516 Xl3.1-IMAGE:6878618.5 - 2 ESTs
                                                                       ...-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6878618.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGGAAAATTGTGAAAAATAAAAATAAGAATGGGAGAATTGTGATAGTTATGAGTAAATATATGGAAAATGGGATGCAGTCCGTAAAAATAAAGTCTTCAGAGGAGGACTGTGACATGGGAGATGTGAGGAGAAGGTTTGATTCCCCAGGCACCCTTAATGGGGACAAAACATGCACAGCCCAGGAAGAAAAAACAGAGCATTGGAAGAAGCGTGTGGAATCCCGGGTAAAGATACATGAAGGTAGTAAAAGTGTGGACAAAGGGTCAGTACATCTTGCAGGCCTCAGAAGGACTTATTCTACTGCCAGTGAAACGTTAAATGATCAACCCTTGCAGCTCACCACAAAGAGTAGCCATGTTCCTATGCCAAATAGGACCAGATCTCCTGTTTATGCAGGGGAGCCCTACAATGATTTAGTTTATACAAATCCAAGAAAACGTTGTTTGTCAGAGGCAAATGGGGACAAGGAGCTTTGTAAGAAGACTCTTACATCTCGGAGTGTGAGTGCTCCCGGCATAGTGGAATGCAAAGGTGGTCTGACCCCTCTTAACGTACCTTTACAGGAACCAGATATCATTCTCTTAGACTCCGACTTGGACGAACCCATAGACCTGCGCTGTGTAAAGTCTCGGTGTGACAGTGACCAAGAGGTGGACAAACCTGAGATTCAGTCACCCAGAATCCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTCAGAGTTTAAACCTTTCCTTGGGAATATTGTAATTTCAGTGTCACAGCCGAATGGCCTACTGTCACTTTTAACGAATATANTACAGTGTGACTCTTATTNCTTTTTGACTGCATATCTAAACTGACGCTTTCCAGCCAATTGGCATGAATTTAATCTGCCTATGACACATTATATATATATAT
                                                  Xl3.1-CHK-1012718038                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATTGTGAAAAATAAAAATAAGAATGGGAGAATTGTGATAGTTATGAGTAAATATATGGAAAATGGGATGCAGTCCGTAAAAATAAAGTCTTCAGAGGAGGACTGTGACATGGGAGATGTGAGGAGAAGGTTTGATTCCCCAGGCACCCTTAATGGGGACAAAACATGCACAGCCCAGGAAGAAAAAACAGAGCATTGGAAGAAGCGTGTGGAATCCCGGGTAAAGATACATGAAGGTAGTAAAAGTGTGGACAAAGGGTCAGTACATCTTGCAGGCCTCAGAAGGACTTATTCTACTGCCAGTGAAACGTTAAATGATCAACCCTTGCAGCTCACCACAAAGAGTAGCCATGTTCCTATGCCAAATAGGACCAGATCTCCTGTTTATGCAGGGGAGCCCTACAATGATTTAGTTTATACAAATCCAAGAAAACGTTGTTTGTCAGAGGCAAATGGGGACAAGGAGCTTTGTAAGAAGACTCTTACATCTCGGAGTGTGAGTGCTCCCGGCATAGTGGAATGCAAAGGTGGTCTGACCCCTCTTAACGTACCTTTACAGGAACCAGATATCATTCTCTTAGACTCCGACTTGGACGAACCCATAGACCTGCGCTGTGTAAAGTCTCGGTGTGACAGTGACCAAGAGGTGGACAAACCTGAGATTCAGTCACCCAGAATCCTCAGTCAGTTGATGTGGATGTTTGTGAGxxTCxxAGTTTAAACCTTTCCTTGGGAATATTGTAATxxxxxTGTCACAGCCGAATGGCCTACTGTCACTTTTAACGAATATANTACAGTGTGACTCTTATTNCTTTTTGACTGCATATCTAAACTGACGCTTTCCAGCCAATTGGCATGAATTTAATCTGCCTATGACACATTATATATATATATTAGAGT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dr ---- 4e-012     NP_991312.1 chromobox homolog 4 (Pc class homolog, Drosophila); polycomb 2 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - ?? ---- 3e-018     XP_869814.3 PREDICTED: chromobox-like protein 4 [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 8e-036     XP_850702.1 PREDICTED: similar to chromobox homolog 4 [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                    PROTEIN --- Hs ---- 5e-036     NP_003646.2 chromobox homolog 4 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                             PROTEIN --- Gg ---- 1e-036     NP_989973.1 chromobox protein (CHCB3) [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                    PROTEIN --- Mm ---- 3e-037     NP_031651.2 chromobox homolog 4 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Xt ---- 5e-110     NP_001096327.1 hypothetical protein LOC100124911 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                        PROTEIN --- Xl ---- 3e-129     NP_001080949.1 chromobox homolog 4 (Polycomb) [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6878618.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG---------ATG---------ATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------TAA------------------------------------------------------------------------------TGA------------------------------------------------------TGA---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2      seed Tad1      out                   IMAGE:6878618.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGGAAAATTGTGAAAAATAAAAATAAGAATGGGAGAATTGTGATAGTTATGAGTAAATATATGGAAAATGGGATGCAGTCCGTAAAAATAAAGTCTTCAGAGGAGGACTGTGACATGGGAGATGTGAGGAGAAGGTTTGATTCCCCAGGCACCCTTAATGGGGACAAAACATGCACAGCCCAGGAAGAAAAAACAGAGCATTGGAAGAAGCGTGTGGAATCCCGGGTAAAGATACATGAAGGTAGTAAAAGTGTGGACAAAGGGTCAGTACATCTTGCAGGCCTCAGAAGGACTTATTCTACTGCCAGTGAAACGTTAAATGATCAACCCTTGCAGCTCACCACAAAGAGTAGCCATGTTCCTATGCCAAATAGGACCAGATCTCCTGTTTATGCAGGGGAGCCCTACAATGATTTAGTTTATACAAATCCAAGAAAACGTTGTTTGTCAGAAGCAAATGGGGACAAGGAGCTTTGTAAGAAGACTCTTACATCTCGGAGTGTGAGTGCTCCCGGCATAGTGGAATGCAAAGGTGGTCTGACCCCTCTTAACGTACCTTTACAGGAACCAGATATCATTCTCTTAGACTCCGACTTGGACGAACCCATAGACCTGCGCTGTGTAAAGTCTCGGTGTGACAGTGACCAAGAGGTGGACAAACCTGAGATTCAAGTCACCCAGAATCCTCAGTCAGTTGATGTGGATGTTTGTGGAGTCTCAGTTTAAACCTTTCCTTGGGAATATTGTAATTTCAGAAGTCACAG
  5   1   2       bld Ooc1      out                     xlnoc003b05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAAATGGGATGCAGTCCGTAAAAATAAAGTCTTCAGAGGAGGACTGTGACATGGGAGATGTGAGGAGAAGGTTTGATTCCCCAGGCACCCTTAATGGGGACAAAACATGCACAGCCCAGGAAGAAAAAACAGAGCATTGGAAGAAGCGTGTGGAATCCCGGGTAAAGATACATGAAGGTAGTAAAAGTGTGGGCAAAGGGTCAGTACATCTTGCAGGCCTCAGAAGGACTTATTCTACTGCCAGTGAAACGTTAAATGATCAACCCTTGCAGCTCACCACAAAGAGTAGCCATGTTCCTATGCCAAATAGGACCAGATCTCCTGTTTATGCAGGGGAGCCCTACAATGATTTAGTTTATACAAATCCAAGAAAACGTTGTTTGTCAGAGGCAAATGGGGACAAGGAGCTTTGTAAGAAGACTCTTACATCTCGGAGTGTGAGTGCTCCCGGCATAGTGGAATGCANAGGTGGTCTGACCCCTCTTAACGTACCTTTACAGGAACCAGATATCATTCTCTTAGACTCCGACTTGGACGAACCCATAGACCTGCGCTGTGTAAAGTCTCGGTGTGACAGTGACCAAGAGGTGGACAAACCTGAGATTCAGTCACCCAGAATCCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTCAGNTTAAACCTTTTCTTTGNNGATATNGTCANTACAGATGTCACAGCCGAATGGCCTACTGTCACTTTTAACGAATATANTACAGTGTGACTCTTATTNCTTTTTGACTGCATATCTAAACTGACGCTTTCCAGCCAATTGGCATGAATTTAATCTGCCTATGACACATtatatatatatatTAGAGTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)