Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Jul 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL490l11ex.5                         33 PI      80         30      382                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:5512412.5                      22 PI      84         28      252                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:7208283.5                       7 PI      80         60      427                (no blast hit)
     4   0.0    0Xl3.1-XL220m10.3                            6 PI      84         86      437                (no blast hit)
     5   0.0    0Xl3.1-XL472h08ex.5                          6 PI      81        156      429                (no blast hit)
     6   0.0    0Xl3.1-IMAGE:7299725.5                       3 PI      77         28      347                (no blast hit)
     7   0.0    0Xl3.1-XL428h08ex.3                          2 PI      76        111      425                (no blast hit)

 This cluster: approximate FL confidence score = 83%

 1012799613 Xl3.1-IMAGE:4057639.5 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:4057639.5 AGATAAGATAGGAGTTCCTCAAAAAATAGTCCCAAAAAACGCTAGCGTCTTTTCCTTCAGGTGATAGGCTGAAAAATAGCGTCAATTTTTTTTGGGGTAACTGGGCTTCCCCCTACATTTCCTAACATATGGCACATAAACTATACAGTGGGCTCATGTGTAGGGCAATATAACAACTCTATTTTATTTTATTAAGGTTGGGCTTGTGTAGTGTCATGTATTTGCTGCAACATATACGTCCATTCAACTTTAACTTCCCGCCGTATGCAAATTAGACAACGTTAGCGCAACTTCGCTTGGCGCAGTAATGCTAACACAACTTCGCCAGCGTTCAGCGCCCTGGACGCAGGTTCGGATTTTAGTGAATTAACATTGTCCTGGCAAAGTGTTGTGATGTGAGTGAAGCCATCGCTGGTGAATTTTCGGAGGAGAGTGAAATAAATGGAGCAGAGTGCCAATGCTCGGCAGTCAACCCTACGTTCCCGAACACAAGAATTAAATACACTATCTGTTTTGTCCAAAGATGTATCGCTCGAAGATGCAAAGAAATATTGGAAAGATCGTCAAGCGGATGGGAAAGTAGACTGGATATTTGAGAAAGTATTGAACAAGCTCAAGATTCTTTGGCAGAAAATTAAAGATGGGTCAGCAACAAACTTAGATATTCACAAGGAAAATGAAGTGCAGGAAAACACAGATTGTTCTCCAGAAAGAAAGGAGGACACATGTCTTAACCTAAATACTGATTGTGGGACAGATGTTTCAGGTTCTGAGCCTGAGTGCAACAGCACAGTTTCGCCTCCTGCTGCAGAGAGGGTCTATTTTGGAAACCATTCATGTGGTCCATCTTGTCTCTCTGGCATTAATTCATTTCTATTTACAAAAGGAAACCCTCTACAACTCCCAATCTCCTGCGACTTTCAGAGGTGCCATCTAAAGATAAATAGCCCTGATGACCTGTCACATATCCTATATAAAGCTCCATGTGGCAGAAGCCTGAGAGACTATGATGAAGTGCAT
                                                  Xl3.1-CHK-1012707075       GATAGGAGTTCCTCAAAAAATAGTCCCAAAAAACGCTAGCGTCTTTTCCTTCAGGTGATAGGCTGAAAAATAGCGTCAATTTTTTTTGGGGTAACTGGGCTTCCCCCTACATTTCCTAACATATGGCACATAAACTATACAGTGGGCTCATGTGTAGGGCAATATAACAACTCTATTTTATTTTATTAAGGTTGGGCTTGTGTAGTGTCATGTATTTGCTGCAACATATACGTCCATTCAACTTTAACTTCCCGCCGTATGCAAATTAGACAACGTTAGCGCAACTTCGCTTGGCGCAGTAATGCTAACACAACTTCGCCAGCGTTCAGCGCCCTGGACGCAGGTTCGGATTTTAGTGAATTAACATTGTCCTGGCAAAGTGTTGTGATGTGAGTGAAGCCATCGCTGGTGAATTTTCGGAGGAGAGTGAAATAAATGGAGCAGAGTGCCAATGCTCGGCAGTCAACCCTACGTTCCCGAACACAAGAATTAAATACACTATCTGTTTTGTCCAAAGATGTATCGCTCGAAGATGCAAAGAAATATTGGAAAGATCGTCAAGCGGATGGGAAAGTAGACTGGATATTTGAGAAAGTATTGAACAAGCTCAAGATTCTTTGGCAGAAAATTAAAGATGGGTCAGCAACAAACTTAGATATTCACAAGGAAAATGAAGTGCAGGAAAACACAGATTGTTCTCCAGAAAGAAAGGAGGACACATGTCTTAACCTAAATACTGATTGTGGGACAGATGTTTCAGGTTCTGAGCCTGAGTGCAACAGCACAGTTTCGCCTCCTGCTGCAGAGAGGGTCTATTTTGGAAACCATTCATGTGGTCCATCTTGTCTCTCTGGCATTAATTCATTTCTATTTACAAAAGGAAACCCTCTACAACTCCCAATCTCCTGCGACTTTCAGAGGTGCCATCTAAAGATAAATAGCCCTGATGACCTGTCACATATCCTATATAAAGCTCCATGTGGCAGAAGCCTGAGAGACTATGATGAAGTGCATTCTTAC
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     2     4     2     4     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     441      42 
                                               BLH MIN     441      33 
                                               BLH MPR     441      33 
                                               BLH OVR     441     119 
                                               CDS MIN     441      33 
                                               ORF LNG     441       6 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Gg ---= 2e-014     XP_417061.2 PREDICTED: similar to SETDB2 protein [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Hs ---= 3e-021     NP_114121.1 CLLL8 protein; chromosome 13 open reading frame 4 [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Cf ---= 2e-021     XP_542559.2 PREDICTED: similar to CLLL8 protein [Canis familiaris] ================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Mm ---= 2e-021     NP_001074493.1 SET domain, bifurcated 2 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xt ==== 2e-075     NP_001096194.1 SET domain, bifurcated 2 [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Xl ==== 2e-107     NP_001082765.1 putative histone methylatransferase CLLD8 [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:4057639.5    TAA------------------------------------TAG------------------------TGA------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------ATG---------------TAG------------------------------------------------------------------------------------------------------------ATGTGA---------------------------------------TAAATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
  5   1   1       add Lu1       out                   IMAGE:4057639.5p AGATAAGATAGGAGTTCCTCAAAAAATAGTCCCAAAAAACGCTAGCGTCTTTTCCTTCAGGTGATAGGCTGAAAAATAGCGTCAAttttttttGGGGTAACTGGGCTTCCCCCTACATTTCCTAACATATGGCACATAAACTATACAGTGGGCTCATGTGTAGGGCAATATAACAACTCTATTTTATTTTATTAAGGTTGGGCTTGTGTAGTGTCATGTATTTGCTGCAACATATACGTNCATTCAACTTTAACTTCCCGCCGTATGCAAATTAGACAACGTTAGCGCAACTTCGCTTGGCGCAGTAATGCTAACACAACTTCGCCAGCGTTC
  5   1   2      seed Ga12                                 XL173j20.5p                                                                                                                                                              GCACAAACACTGTAGCAAACTGTACGGATTCCAACCTAGGTTGGGCTTGTGTAGTGTCATGTATTTGCTGCAACATATACGTCCATTCAACTTTAACTTCCCGCCGTATGCAAATTAGACAACGTTAGCGCAACTTCGCTTGGCGCAGTAATGCTAACACAACTTCGCCAGCGTTCAGCGCCCTGGACGCAGGTTCGGATTTTAGTGAATTAACATTGTCCTGGCAAAGTGTTGTGATGTGAGTGAAGCCATCGCTGGTGAATTTTCGGAGGAGAGTGAAATAAATGGAGCAGAGTGCCAATGCTCGGCAGTCAACCCTACGTTCCCGAACACAAGAATTAAATACACTATCTGTTTTGTCCAAAGATGTATCGCTCGAAGATGCAAAGAAATATTGGAAAGATCGTCAAGCGGATGGGAAAGTAGACTGGATATTTGAGAAAGTATTGAACAAGCTCAAGATTCTTTGGCAGAAAATCAAAGATGGGTCAGCAACAAACTTAGAATATGTAAGAGCTGTGATTTTGGTGAATGAAGCAGGAAATTTAGAAGAGGACTTGGAAGAGGACTTACAAGAGGACACTGATACCATACACATTGATATTCACAAGGAAAATGAAGTGCAGGAAAACACAGATT
  5   1   1       add Brn2                             Brn2-za41e12.5p                                                                                                                                                                                                        GGGCTTGTGTAGTGTAATGTATTTGCTGCAACATATACGTCCATTCAACTTTAACTTCCCGCCACATGCAAATTAGCCAACGCTAGTGCAACTCCGCTTCGCTTGGCCCAGTAACGCTAGCTCAACTTCGCCAGTGTTAAGCACCCTGGACGCAACTTCGGATTTTAGTGAATTAGCGTTGTCCTGGCGAATCTACGCCTGGCGAAGTGTTACGCTGTCAGCGATGCCGCCGCTGGCGAATTTTCAGAGGTTAGTGAATTTGCCCCTGTAAGAATATTTATAATCTGCATGTTATTGGTGGTCAGTCATTTAAAGGGAAATATTTGTAGATATTTAAGTAAATGCATTTTTTTAA
  5   1   2       bld Te2N                            IMAGE:7768072.5p                                                                                                                                                                                                                                                                                                 GCAAAAACCCCTAGTGAATGCAGCTCAGCTGTGTCCGGGCCTCGCTTCCCTCTTGTCTTCTCTACTCTCCTACTTCTCGTGTCAGGAAGAGCCGGGGCTTCCGTACTGGGCGGACACTTGCCGCTGCCATGGAGACAACAGAGAGTGAAATAAATGGAGCAGAGTGCCAATGCTCGGCAGTCAACCCTACGTTCCCGAACACAAGAATTAAATACACTATCTGTTTTGTCCAAAGATGTATCGCTCGAAGATGCAAAGAAATATTGGAAAGATCGTCAAGCGGATGGGAAAGTAGACTGGATATTTGAGAAAGTATTGAACAAGCTCAAGATTCTTTGGCAGAAAATTAAAGATGGGTCAGCAACAAACTTAGATATTCACAAGGAAAATGAAGTGCAGGAAAACACAGATTGTTCTCCAGAAAGAAAGGAGGACACATGTCTTAACCTAAATACTGATTGTGGGACAGATGTTTCAGGTTCTGAGCCTGAGTGCAACAGCACAGTTTCGCCTCCTGCTGCAGAGAGGGTCTATTTTGGAAACCATTCATGTGGTCCATCTTGTCTCTCTGGCATTAATTCATTTCTATTTACAAAAGGAAACCCTCTACAACTCCCAATCTCCTGCGACTTTCAGAGGTGCCATCTAAAGATAAATAGCCCTGATGACCTGTCACATATCCTATATAAAGCTCCATGTGGCAGAAGCCTGAGAGACTATGATGAAGTGCATTCTTACC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)