Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:4173312-IMAGp.5                 2 PI      77          4      400                protein kinase C, zeta [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012799646 Xl3.1-XL032f09.5 - 2 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL032f09.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTATGGCATGTGTAAGGAAGGGTTGAGGCCTGGAGATACAACCAGTACATTTTGCGGCACTCCAAATTATATTGCTCCGGAAATCCTACGAGGAGAAGATTACGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTCGGAAGCTCTGACAATCCAGACCAAAATACAGAAGATTTTCTTTTCCAAGTAATTCTGGAAAAGCAAATCCGTATTCCAAGATCACTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTCCTTAACAAGGATCCAAAGGATCGCCTCGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTCTTCCGTAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTCCCTCCATTTAAGCCAAATATATCTGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTTGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCGCTGCTGATGTCTGCCGAAGAATGTGTATAATTTATAGGACAGCTCCACAGGACACATCAGCCTCGGCCGGCTCTGTCTCTCTTCTGCAGGGACAACCACTGTTTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATTTATATCAGCTATTTAAAGCTCCGAATCCCTAAAATGAGATATGTTTATTGTATGGACAGAAAAAAGACATCTCCAGGTTCTTGGAATCGTTTTATCTGCTAGTCGCACACTATCTTCTGCTGAGGATCCTGATCGCCCGGGAATTGAAAATGTGGCTGNGGGGGGTTTTTTTTTCCTCTCTCCCNATCTTGGCCTTTCCAAGAATATGGAAAAATCCATTTTGCTACCCCATTTCCCACCTTTTCCCTGGCCGAATAAAAATAAGTCCGAGTAACAATCCTTGGCCTCCCCCTATATAATGGGAATAAACTCCTTCCTACT
                                                  Xl3.1-CHK-1012718677                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTATGGCATGTGTAAGGAAGGGTTGAGGCCTGGAGATACAACCAGTACATTTTGCGGCACTCCAAATTATATTGCTCCGGAAATCCTACGAGGAGAAGATTACGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTCGGAAGCTCTGACAATCCAGACCAAAATACAGAAGATTTTCTTTTCCAAGTAATTCTGGAAAAGCAAATCCGTATTCCAAGATCACTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTCCTTAACAAGGATCCAAAGGATCGCCTCGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTCTTCCGTAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTCCCTCCATTTAAGCCAAATATATCTGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTTGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCGCTGCTGATGTCTGCCGAAGAATGTGTATAATTTATAGGACAGCTCCACAGGACACATCAGCCTCGGCCGGCTCTGTCTCTCTTCTGCAGGGACAACCACTGTTTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATTTATATCAGCTATTTAAAGCTCCGAATCCCTAAAATGAGATATGTTTATTGTATGGACAGAAAAAAGACATCTCCAGGTTCTTGGAATCGTTTTATCTGCTAGTCGCACACTATCTTCTGCTGAGGATCCTGATCGCCCGGGAATTGAAAATGTGGCTGNGGGGGGTTTTTTTTTCCTCTCTCCCNATCTTGGCCTTTCCAAGAATATGGAAAAATCCATTTTGCTACCCCATTTCCCACCTTTTCCCTGGCCGAATAAAAATAAGTCCGAGTAACAATCCTTGGCCTCCCCCTATATAATGGGAATAAACTCCTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ci ---- 2e-012     NP_001027631.1 calmodulin-dependent protein kinase homologue [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 4e-085     NP_495011.1 protein kinase C, iota/lambda/zeta type, component of a PDZ-mediated proteincomplex PAR-6/PAR-3/PKC-3 required for establishing embryonic polarity (68.0 kD)(pkc-3) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                     PROTEIN --- Dm ---- 3e-100     NP_001036543.1 atypical protein kinase C CG10261-PE, isoform E [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                     PREDICTED - Sp ---- 1e-103     XP_001185476.1 PREDICTED: similar to protein kinase C iota [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bt ---- 2e-104     NP_001071301.1 protein kinase C, zeta [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 8e-121     NP_571930.2 protein kinase C, iota [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 2e-123     NP_001084068.1 protein kinase C subspecies lambda/iota [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Gg ---- 8e-124     NP_001026490.1 protein kinase C, iota [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 5e-124     XP_535855.2 PREDICTED: similar to Protein kinase C, iota type (nPKC-iota) (Atypical protein kinase C-lambda/iota) (aPKC-lambda/iota) (PRKC-lambda/iota) [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 4e-124     NP_032883.2 protein kinase C, iota [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 4e-124     NP_002731.4 protein kinase C, iota [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 3e-124     XP_606901.4 PREDICTED: protein kinase C, iota [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 1e-126     AAI61528.1 Protein kinase C, iota [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL032f09.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATG---------------------------------------------------------------------------------------------------------------------------------ATG------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------TAA------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   2      seed Neu7                                 XL032f09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTATGGCATGTGTAAGGAAGGGTTGAGGCCTGGAGATACAACCAGTACATTTTGCGGCACTCCAAATTATATTGCTCCGGAAATCCTACGAGGAGAAGATTACGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTCGGAAGCTCTGACAATCCAGACCAAAATACAGAAGATTTTCTTTTCCAAGTAATTCTGGAAAAGCAAATCCGTATTCCAAGATCACTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTCCTTAACAAGGATCCAAAGGATCGCCTCGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTCTTCCGTAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTCCCTCCATTTAAGCCAAATATATCTGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTTGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCGCTGCTGATGTCTGCCGAAGAATGTGTATAATTTATA
  5   1   2       bld Oo1                             IMAGE:6637671.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCATGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTCGGAAGCTCTGACAATCCAGACCAAAATACAGAAGATTTTCTTTTCCAAGTANATTCTGGAAAAGCAAATCCGTATTCCAAGATCACTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTCCTTAACAAGGATCCAAAGGATCGCCTCGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTCTTCCGTAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTCCCTCCATTTAAGCCAAATATATCTGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTTGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCGCTGCTGATGTCTGCCGAAGAATGTGTATAATTTATAGGACAGCTCCACAGGACACATCAGCCTCGGCCGGCTCTGTCTCTCTTCTGCAGGGACAACCACTGTTTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATTTATATCAGCTATTTAAAGCTCCGAATCCCTAAAATGAGATATGTTTATTGTATGGACAGAAAAAAGACATCTCCAGGTTCTTGGAATCGTTTTATCTGCTAGTCGCACACTATCTTCTGCTGAGGATCCTGATCGCCCGGGAATTGAAAATGTGGCTGNGGGGGGtttttttttCCTCTCTCCCNATCTTGGCCTTTCCAAGAATATGGAAAAATCCATTTTGCTACCCCATTTCCCACCTTTTCCCTGGCCGAATAAAAATAAGTCCGAGTAACAATCCTTGGCCTCCCCCTATATAATGGGAATAAACTCCTTCCTACTGGGGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)