Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 84%

 1012799707 Xl3.1-IMAGE:4963637.5 - 2 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:4963637.5 GCAAGACTTGTTTGGGCCTCATAAACAACCACAGAACCACAAGCTGAGCACAGACACTCGACAGTGGATCCGGGATATTGGTCAGCAGAAAGGGGCGAATCATTTTCGTTGACTGGAAATAAAAAAACCACAAGACTTTCATACATTGCTGATTTTTTAAAAAAAAACACTAAAACCCCAGGCAGGAAGTTGAAGGAAACGCAATGGCCTCACATAGTGCCTTCCAGTCATTTCCTTTATACCCGCCGTGCTTCTTCAGAGATACCAGCACCAGCCGCCGCTTCACGCCGCCCTCCACCACTCTGAGTCCGGGGAAGATGAGCGAACCGATACCGCTGAATATCGCGGACAGCAGCGCCGGCCTGGTGGGCAAACTGAGAAGCACAGACCGGAATATGGTGGAAATATTGTCCGATCATCCCGGAGAACTGGTCCGCACAGACAGCCCCAACTTTCTCTGCTCGGTGCTTCCCACACACTGGAGGTGCAACAAGACCTTGCCCATCGCTTTCAAGGTGGTGGCCTTGGGAGAAGTTCCAGATGGGACACTGGTGACAGTGATGGTTGGCAATGATGAGAACTATTCTGCTGAATTAAGAAATGCCACAGCAGGCCATGAAGAGTCAAGTGGCCCCGCTTCAATGACCCTGAGATTTGTCGGAAGATCTGGAAGAGGAAAAAGTTTCACCCTGACTA
                                                  Xl3.1-CHK-1012717757       CTTGTTTGGGCCTCATAAACAACCACAGAACCACAAGCTGAGCACAGACACTCGACAGTGGATCCGGGATATTGGTCAGCAGAAAGGGGCGAATCATTTTCGTTGACTGGAAATAAAAAAACCACAAGACTTTCATACATTGCTGATTTTTTAAAAAAAAACACTAAAACCCCAGGCAGGAAGTTGAAGGAAACGCAATGGCCTCACATAGTGCCTTCCAGTCATTTCCTTTATACCCGCCGTGCTTCTTCAGAGATACCAGCACCAGCCGCCGCTTCACGCCGCCCTCCACCACTCTGAGTCCGGGGAAGATGAGCGAACCGATACCGCTGAATATCGCGGACAGCAGCGCCGGCCTGGTGGGCAAACTGAGAAGCACAGACCGGAATATGGTGGAAATATTGTCCGATCATCCCGGAGAACTGGTCCGCACAGACAGCCCCAACTTTCTCTGCTCGGTGCTTCCCACACACTGGAGGTGCAACAAGACCTTGCCCATCGCTTTCAAGGTGGTGGCCTTGGGAGAAGTTCCAGATGGGACACTGGTGACAGTGATGGTTGGCAATGATGAGAACTATTCTGCTGAATTAAGAAATGCCACAGCAGGCCATGAAGAGTCAAGTGGCCCCGCTTCAATGACCCTGAGATTTGTCGGAAGATCTGGAAGAGGAAAAAGTTTCACCC
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     203      80 
                                               BLH MIN     203      64 
                                               BLH MPR      98      64 
                                               BLH OVR     203     199 
                                               CDS MIN     203      64 
                                               ORF LNG     203       4 
                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 6e-015     NP_491679.1 RuNT related (33.9 kD) (rnt-1) [Caenorhabditis elegans] =======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                       PROTEIN --- Ag ---- 2e-032     XP_312433.4 AGAP002506-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                         PROTEIN --- Dm ---- 6e-033     NP_001036285.1 CG34145-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                       PROTEIN --- Sp ---- 6e-034     NP_999779.1 SpRunt-1 protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                PROTEIN --- Dr ---- 1e-057     NP_571678.1 runt-related transcription factor 1 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                            PREDICTED - Cf ==== 6e-061     XP_858829.1 PREDICTED: similar to runt-related transcription factor 1 isoform b isoform 11 [Canis familiaris] =====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                  PROTEIN === Gg ==== 2e-066     NP_990558.1 ch-runtB2 [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                  PREDICTED = Bt ==== 1e-066     XP_870864.1 PREDICTED: similar to runt-related transcription factor 1 isoform a isoform 2 [Bos taurus] ======================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                  PROTEIN === Hs ==== 9e-067     NP_001745.2 runt-related transcription factor 1 isoform a [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                  PROTEIN === Mm ==== 8e-069     NP_001104492.1 runt-related transcription factor 1 isoform 2 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                  PREDICTED = Xl ==== 3e-081     NP_001079966.1 hypothetical protein LOC379657 [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:4963637.5                                             TGA------------------------------------------------------------------------TAA---------------------------TGA------------------TAA------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  5   1   2      seed Sp1  5x3  out                   IMAGE:4963637.5p GCAAGACTTGTTTGGGCCTCATAAACAACCACAGAACCACAAGCTGAGCACAGACACTCGACAGTGGATCCGGGATATTGGTCAGCAGAAAGGGGCGAATCATTTTCGTTGACTGGAAATAAAAAAACCACAAGACTTTCATACATTGCTGATTTTTTaaaaaaaaaCACTAAAACCCCAGGCAGGAAGTTGAAGGAAACGCAATGGCCTCACATAGTGCCTTCCAGTCATTTCCTTTATACCCGCCGTGCTTCTTCAGAGATACCAGCACCAGCCGCCGCTTCACGCCGCCCTCCACCACTCTGAGTCCGGGGAAGATGAGCGAACCGATACCGCTGAATATCGCGGACAGCAGCGCCGCCCTGGTGGGCAAACTGAGAAGCACAGACCGGAATATGGTGGAAGTATTGTCCGATCATCCCGGAGAACTGGTCCGCACAGACAGCCCCAACTTTCTCTGCTCGGTGCTTCCCACACACTGGAGGTGCAACAAGACCTTGCCCATCGCTTTCAAGGTGGTGGCCTTGGGAGAAGTTCCAGATGGGACACTGGTGACAGTGATGGCTGGCAATGATGAG
  5   1   2       bld Sp1  5g                IMAGE:4963637-IMAGp.IMAGp                                                                        GGGATATTGGTCAGCAGAAAGGGGCGAATCATTTTCGTTGACTGGAAATAAAAAAACCACAAGACTTTCATACATTGCTGATTTTTTaaaaaaaaaCACTAAAACCCCAGGCAGGAAGTTGAAGGAAACGCAATGGCCTCACATAGTGCCTTCCAGTCATTTCCTTTATACCCGCCGTGCTTCTTCAGAGATACCAGCACCAGCCGCCGCTTCACGCCGCCCTCCACCACTCTGAGTCCGGGGAAGATGAGCGAACCGATACCGCTGAATATCGCGGACAGCAGCGCCGGCCTGGTGGGCAAACTGAGAAGCACAGACCGGAATATGGTGGAAATATTGTCCGATCATCCCGGAGAACTGGTCCGCACAGACAGCCCCAACTTTCTCTGCTCGGTGCTTCCCACACACTGGAGGTGCAACAAGACCTTGCCCATCGCTTTCAAGGTGGTGGCCTTGGGAGAAGTTCCAGATGGGACACTGGTGACAGTGATGGTTGGCAATGATGAGAACTATTCTGCTGAATTAAGAAATGCCACAGCAGGCCATGAAGAGTCAAGTGGCCCCGCTTCAATGACCCTGAGATTTGTCGGAAGATCTGGAAGAGGAAAAAGTTTCACCCTGACTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)