Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8542045.5                       9 END     1          33       11                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL515l15ex.5                        288 PI      92        701      924                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:5074071.5                      40 PI      91        737      924                (no blast hit)
     4   0.0    0Xl3.1-xl294n15.3                           22 PI      95        581      924                (no blast hit)
     5   0.0    0Xl3.1-XL102e16.5                           18 PI      89        663      854                (no blast hit)
     6   0.0    0Xl3.1-XL156p10.3                           16 PI      94        623      924                (no blast hit)
     7   0.0    0Xl3.1-IMAGE:8076278.5.5                    16 PI      90        580      748                (no blast hit)
     8   0.0    0Xl3.1-XL516a24ex.3                         16 PI      80        581      832                (no blast hit)
     9   0.0    0Xl3.1-XL141c20.3                           15 PI      93        703      924                (no blast hit)
    10   0.0    0Xl3.1-IMAGE:3549618-IMAGp.5                14 PI      80        581      828                hypothetical protein LOC494743 [Xenopus laevis]
    11   0.0    0Xl3.1-xl318b05.3                           13 PI      80        663      923                MGC78848 protein [Xenopus laevis]
    12   0.0    0Xl3.1-XL495c10ex.3                         11 PI      80        722      919                (no blast hit)
    13   0.0    0Xl3.1-IMAGE:5079335.5                      10 PI      77        582      895                (no blast hit)
    14   0.0    0Xl3.1-XL142n01.5                            9 PI      89        769      924                (no blast hit)
    15   0.0    0Xl3.1-IMAGE:6879166.3                       8 PI      92        689      924                (no blast hit)
    16   0.0    0Xl3.1-PBX0070D05.5                          8 PI      88        771      924                (no blast hit)
    17   0.0    0Xl3.1-IMAGE:6879379.5                       8 PI      84        578      924                (no blast hit)
    18   0.0    0Xl3.1-IMAGE:3301101-IMAGp.5                 7 PI      86        752      924                (no blast hit)
    19   0.0    0Xl3.1-XL205f12.3                            7 PI      83        580      924                (no blast hit)
    20   0.0    0Xl3.1-IMAGE:4930339.5                       6 PI      94        766      924                (no blast hit)
    21   0.0    0Xl3.1-XL063j06.3                            6 PI      90        737      924                (no blast hit)
    22   0.0    0Xl3.1-xl222m14.3                            5 PI      92        581      823                (no blast hit)
    23   0.0    0Xl3.1-IMAGE:5073270.3                       5 PI      87        584      924                (no blast hit)
    24   0.0    0Xl3.1-IMAGE:8550191.5                       5 PI      85        581      907                (no blast hit)
    25   0.0    0Xl3.1-XL510g08ex.3                          4 PI      89        653      924                (no blast hit)
    26   0.0    0Xl3.1-Ooc1-db27c10.3                        4 PI      89        738      924                (no blast hit)
    27   0.0    0Xl3.1-IMAGE:4057622-IMAGp.5                 4 PI      89        752      924                (no blast hit)
    28   0.0    0Xl3.1-XL463h14ex.3                          4 PI      84        580      873                (no blast hit)
    29   0.0    0Xl3.1-XL055a02.3                            4 PI      84        682      924                (no blast hit)
    30   0.0    0Xl3.1-XL159d10.3                            4 PI      79        581      918                (no blast hit)
    31   0.0    0Xl3.1-XL142b13.5                            4 PI      78        572      924                (no blast hit)
    32   0.0    0Xl3.1-IMAGE:8328705.3                       3 PI      92        649      924                (no blast hit)
    33   0.0    0Xl3.1-IMAGE:5506209.5                       3 PI      90        575      727                (no blast hit)
    34   0.0    0Xl3.1-PBX0022A06.5                          3 PI      89        668      918                (no blast hit)
    35   0.0    0Xl3.1-XL023a20.3                            3 PI      87        671      924                (no blast hit)
    36   0.0    0Xl3.1-XL196c08.5                            3 PI      85        581      761                (no blast hit)
    37   0.0    0Xl3.1-xl341l06.5                            2 PI      92        771      924                (no blast hit)
    38   0.0    0Xl3.1-IMAGE:3399355-IMAGp.5                 2 PI      90        581      924                (no blast hit)
    39   0.0    0Xl3.1-XL045i07.5                            2 PI      89        767      924                (no blast hit)
    40   0.0    0Xl3.1-IMAGE:5537373-IMAGp.5                 2 PI      89        581      727                (no blast hit)
    41   0.0    0Xl3.1-XL039e24.3                            2 PI      88        584      924                (no blast hit)
    42   0.0    0Xl3.1-xlnoc002j07.3                         2 PI      86        581      924                (no blast hit)
    43   0.0    0Xl3.1-IMAGE:4783521.3                       2 PI      86        663      920                (no blast hit)
    44   0.0    0Xl3.1-IMAGE:7296968.3                       2 PI      84        580      924                (no blast hit)
    45   0.0    0Xl3.1-IMAGE:4057350-IMAGp.5                 2 PI      82        581      875                (no blast hit)
    46   0.0    0Xl3.1-IMAGE:6316084.5                       2 PI      80        581      853                (no blast hit)
    47   0.0    0Xl3.1-IMAGE:3436611.5                       2 PI      79        581      924                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012799839 Xl3.1-XL055g07.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL055g07.5 GTGAAACCGACTGAGACCCTGGCATGAACTTCACAGAAGTCACATCTCATTTTATCTAAATATTTTGAGGTTGTGTACCTCCCAACAGTCACAATTTAGGGTGATATTTATCAAAGGGTTAAAATGAAGTTACAAATGGGTTAGAACCCATAATCGTTCACTAGAGGAGCCCTCATTATTAATTTCTGGTCAATATGCATGAAAAACCTACAGCAGAAAATAGAGAGCTGCAAAATTCCCCTCTGGCAAATTGGTGAGCTTTTTGATGAATATACCCTTTTGCCCGATGCATCTAATCTGCTAGTAGGACACTTTCAGCCTAGCCCTGGGGTGTTATGATACAGAGCAGTATTATTTAAGTCCTGCTTCTGCCCTTCATCCTGGGGCTGATTTTTCAGCACCAGGCTGACATTCTGACTGTATGAGGGATATTAAAATGTGCTGATCATTGGTGGTAAAATGTCTCTGCACTTTACCCAGTGAATGCATTTATTTCCATTTAACTTGCATTAAAGAAAGAGACTGGGTCCTTCATTTGATCTTTCCCAGTAAAGTGGTGCCTAACCTTTTGTGCCTGTCATTAAAGTGGACCTGTCACCCAGATACAAAAATTTGTATAATAAAAGTCCTTTTCAAATTAAACAAAATAAATCCAATTCCTATTTTTTATTAAAGCATTCATAGCTGTTGTAAGCTCATTTAAAAATCTCAGCTGTCAATCAAATATCGTCTGCCACTCCTCTATGCCAGTGGCATAGAGGCGGGGCAGACAATTACTTTCACTTTCCATTCAGCACTTCCTAGATGTCACTGCTCTCCACACATTCCACCATTTTCTTCACCATTTAATTGTGTATCCAGGGCATGGGGATGGACATCAGGTCCCCCATTCTGGTGCACAAACAAGATTCTGAGATGATACAA
                                                  Xl3.1-CHK-1012711288       CCGACTGAGACCCTGGCATGAACTTCACAGAAGTCACATCTCATTTTATCTAAATATTTTGAGGTTGTGTACCTCCCAACAGTCACAATTTAGGGTGATATTTATCAAAGGGTTAAAATGAAGTTACAAATGGGTTAGAACCCATAATCGTTCACTAGAGGAGCCCTCATTATTAATTTCTGGTCAATATGCATGAAAAACCTACAGCAGAAAATAGAGAGCTGCAAAATTCCCCTCTGGCAAATTGGTGAGCTTTTTGATGAATATACCCTTTTGCCCGATGCATCTAATCTGCTAGTAGGACACTTTCAGCCTAGCCCTGGGGTGTTATGATACAGAGCAGTATTATTTAAGTCCTGCTTCTGCCCTTCATCCTGGGGCTGATTTTTCAGCACCAGGCTGACATTCTGACTGTATGAGGGATATTAAAATGTGCTGATCATTGGTGGTAAAATGTCTCTGCACTTTACCCAGTGAATGCATTTATTTCCATTTAACTTGCATTAAAGAAAGAGACTGGGTCCTTCATTTGATCTTTCCCAGTAAAGTGGTGCCTAACCTTTTGTGCCTGTCATTAAAGTGGACCTGTCACCCAGATACAAAAATTTGTATAATAAAAGTCCTTTTCAAATTAAAxAxAxxAAATCCAATTCCTATTTTTTATTAAAGCATTCATAGCTGTTGTAAGCTCATTTAAAAATCTCAGCTGTCAATCAAATATCGTCTGCCACTCCTCTATGCCAGTGGCATAGAGGCGGGGCAGACAATTACTTTCACTTTCCATTCAGCACTTCCTAGATGTCACTGCTCTCCACACATTCCACCATTTTCTTCACCATTTAATTGTGTATCCAGGGCATGGGGATGGACATCAGGTCCCCCATTCTGGTGCACAAACAAGATTCTGAGATGATACAAGGCTTG
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
  5   1   2       bld Int2                            IMAGE:8530770.5p GTGAAACCGACTGAGACCCTGGCATGAACTTCACAGAAGTCACATCTCATTTTATCTAAATATTTTGAGGTTGTGTACCTCCCAACAGTCACAATTTAGGGTGATATTTATCAAAGGGTTAAAATGAAGTTACAAATGGGTTAGAACCCATAATCGTTCACTAGAGGAGCCCTCATTATTAATTTCTGGTCAATATGCATGAAAAACCTACAGCAGAAAATAGAGAGCTGCAAAATTCCCCTCTGGCAAATTGGTGAGCTTTTTGATGAATATACCCTTTTGCCCGATGCATCTAATCTGCTAGTAGGACACTTTCAGCCTAGCCCTGGGGTGTTATGATACAGAGCAGTATTATTTAAGTCCTGCTTCTGCCCTTCATCCTGGGGCTGATTTTTCAGCACCAGGCTGACATTCTGACTGTATGAGGGATATTAAAATGTGCTGATCATTGGTGGTAAAATGTCTCTGCACTTTACCCAGTGAATGCATTTATTTCCATTTAACTTGCATTAAAGAAAGAGACTGGGTCCTTCATTTGATCTTTCCCAGTAAAGTGGTGCCTAACCTTTTGTGCCTGTCATTAAAGTGGACCTGTCACCCAGACACAAAAATTTGTATAATAAAAGTCCTTTTCAAATTAAACATGAAATCCAATTCCTATTTTTTATTNAAGCATTCATAGCTGTTGTAAGCTCATTTAAAAATCTCAGCTGTNCAATATCGTCTGCCACTCCTCTATGCCAGTGG
  5   1   2      seed Tbd7      out                        XL055g07.5p                                                                                                                                                            GTTNCTAGNAGGAGCCCTCATTATTAATTTCTGGTCAATATGCATGAAAAACCTACAGCAGAAAATAGAGAGCTGCAAAATTCCCCTCTGGCAAATTGGTGAGCTTTTTGATGAATATACCCTTTTGCCCGATGCATCTAATCTGCTAGTAGGACACTTTCAGCCTAGCCCTGGGGTGTTATGATACAGAGCAGTATTATTTAAGTCCTGCTTCTGCCCTTCATCCTGGGGCTGATTTTTCAGCACCAGGCTGACATTCTGACTGTATGAGGGATATTAAAATGTGCTGATCATTGGTGGTAAAATGTCTCTGCACTTTACCCAGTGAATGCATTTATTTCCATTTAACTTGCATTAAAGAAAGAGACTGGGTCCTTCATTTGATCTTTCCCAGTAAAGTGGTGCCTAACCTTTTGTGCCTGTCATTAAAGTGGACCTGTCACCCAGATACAAAAATTTGTATAATAAAAGTCCTTTTCAAATTAAACAAAATCCAATTCCTATTTTTTATTAAAGCATTCATAGCTGTTGTAAGCTCATTTAAAAATCTCAGCTGTCAAATATCGTCTGCCACTCCTCTATGCCAGTGGCATAGAGGCGGGGCAGAC
  5   1   2       bld Neu7                                 XL001o03.5p                                                                                                                                                                                                                                                                                                                                                                                 CTGCCCTTCNNCCTGGGGCTGATTTTTCAGCACCAGGCTGACATTCTGACTGTATGAGGGATATTAAAATGTGCTGATCATTGGTGGTAAAATGTCTCTGCACTTTACCCAGTGAATGCATTTATTTCCATTTAACTTGCATTAAAGNAAAGAGACTGGGTCCTTCATTTGATCTTTCCCAGNAAAGTGGTGCCTAACCTTTTGTGCCTGTCATTAAAGTGGACCTGTCACCCAGNACACAAAAATTTGTATAATAAAAGTCCTTTTCAAATTAAACATGAAATCCAATTCCTATTTTTTATTAAAGCATTCATAGCTGTTGTAAGCTCATTTAAAAATCTCAGCTGTCAATCAAATATCGTCTGCCACTCCTCTATGCCAGTGGCATAGAGGCGGGGCAGACAATTACTTTCACTTTCCATTCAGCACTTCCTAGATGTCACTGCTCTCCACACATTCCACCATTTTCTTCACCATTTAATTGTGTATCCAGGGCATGGGGATGGACATCAGGTCCCCCATTCTGGTGCACAAACAAGATTCTGAGATGATACAAGGCTTGTCTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)