Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012799845 Xl3.1-IMAGE:6956105.5 - 6 ESTs
                                                                       ........-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6956105.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGGTTTTCGGTGAAGAGGTGTGCCCGTTGCCATCTTGGCATTTCAGCCTCAGAGATGGTAATGAGAGCACGGGAGTCCGTCTACCACCTGAGCTGTTTTACCTGCACAACCTGTAACAAGACCTTAAGCACCGGGGATCAATTTGGCATGAAGGAAAACCTTGTCTACTGCCGGATTCACTTTGAGCTTCTTGTCCAGGGGGACTTCCATCAGCAGCTAAATTACACGGAGCTCTCAGCCAAGGGTGGGGGACTGGCAGCCCTGCCGTATTTCAGCAATGGGACAGGCACAGTGCAAAAGGGGAGGCCACGAAAGAGAAAGAGCCAGGCTTTGGGTGTGGACATCATCAACTACAGTTCAGGTTGTAACGAAAATGAGACAGATTTGGATCGGGACCAGACATACCCTCCTTCTCAAAAGTCGAAACGCATGAGAACCTCTTTCAAACATAACCAGCTCCGTACAATGAAGTCCTATTTTGCCATTAACCATAATCCAGATGCAAAAGATCTGAAACAACTGGCCCAGAAAACTGGATTAACAAAGAGAGTTCTGCAGGGAGAACAATGTTCGGGGTTTAACAGCCATACAACCCGGCGTTTGAAAATTCCCTAAAGTATTTAAAGAAGGGGAAAAGTTTGATCGGGAAGTCTACTGCAGTGAAGACAAAGACAAAAAATTTGCCAAAAATTTTAAAAATTTAAATCTATATATAAAAAAAAGAACTTCTATGTCATTTTTTGGAATGTTCAAGCACATGCTTTTTTGTATGTATGATAGGAGTTCTAACATTGTACCCTGATAAAATGAGGGAAGGATGTTAAGCTATTACAGTTTTAACGCCATTTTCATATGAATGCTTCGGATTTGTTGATAAAATGATACAAAACTGTGTGATTTTTTTTTTGCCCGCAAAAAATGTGTATATATCATGGAGCAACCTGGCATTAATAAACCTTATACAGTTTTGATGCAGAATTTATCAAAATTTTGTTTAGACTCAAGCACAACTGAAGATTAATTTAAATGTAAAAATAGCACTCTACAACCACGCTTGCAAAAATGTATTCTTCACAAATGTGAAATTGCAAAAGTGTATTCTTCACAAATGTGAAATCCCACTCTATTTGTGCCTGTTTATTTAAAGTTATTGTTTTACTTATAGGTTCTGTTCCCATGTAGCAGAAATAGACTGATTTATAATCCGACAC
                                                  Xl3.1-CHK-1012702960                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCGGTGAAGAGGTGTGCCCGTTGCCATCTTGGCATTTCAGCCTCAGAGATGGTAATGAGAGCACGGGAGTCCGTCTACCACCTGAGCTGTTTTACCTGCACAACCTGTAACAAGACCTTAAGCACCGGGGATCAATTTGGCATGAAGGAAAACCTTGTCTACTGCCGGATTCACTTTGAGCTTCTTGTCCAGGGGGACTTCCATCAGCAGCTAAATTACTCGGAGCTCTCAGCCAAGGGTGGGGGACTGGCAGCCCTGCCGTATTTCAGCAATGGGACAGGCACAGTGCAAAAGGGGAGGCCACGAAAGAGAAAGAGCCAGGCTTTGGGTGTGGACATCATCAACTACAGTTCAGGTTGTAACGAAAATGAGACAGATTTGGATCGGGACCAGACATACCCTCCTTCTCAAAAGTCGAAACGCATGAGAACCTCTTTCAAACATAACCAGCTCCGTACAATGAAGTCCTATTTTGCCATTAACCATAATCCAGATGCAAAAGATCTGAAACAACTGGCCCAGAAAACTGGATTAACAAAGAGAGTTCTGCAGGGAGAACAATGTTCGGGGTTTAACAGCCATACAACCCGGCGTTTGAAAATTCCCTAAAGTATTTAAAGAAGGGGAAAAGTTTGATCGGGAAGTCTACTGCAGTGAAGACAAAGACAAAAAATTTGCCAAAAATTTTAAAAATTTAAATCTATATATAAAAAAAAGAACTTCTATGTCATTTTTTGGAATGTTCAAGCACATGCTTTTTTGTATGTATGATAGGAGTTCTAACATTGTACCCTGATAAAATGAGGGAAGGATGTTAAGCTATTACAGTTTTAACGCCATTTTCATATGAATGCTTCGGATTTGTTGATAAAATGATACAAAACTGTGTGATTTTTTTTTTGCCCGCAAAAAATGTGTATATATCATGGAGCAACCTGGCATTAATAAACCTTATACAGTTTTGATGCAGAATTTATCAAAATTTTGTTTAGACTCAAGCACAACTGAAGATTAATTTAAATGTAAAAATAGCACTCTACAACCACGCTTGCAAAAATGTATTCTTCACAAATGTGAAATTGCAAAAGTGTATTCTTCACAAATGTGAAATCCCACTCTATTTGTGCCTGTTTATTTAAAGTTATTGTTTTACTTATAGGTTCxxxTxCCATGTAGCAGAAATAGACTGATTTATAATCCGACACAATAAC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     2     3     1     3     2     3     2     3     2     3
                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 3e-020     NP_001027767.1 LIM homeodomain protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PROTEIN --- Xt ---- 5e-021     AAI18740.1 LIM homeobox 8 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                          PREDICTED - ?? ---- 4e-023     XP_615356.4 PREDICTED: similar to LIM homeobox protein 6 [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                            PROTEIN --- Ce ---- 6e-029     NP_509970.1 abnormal ThermoTaXis TTX-3, C.Elegans Homeobox, LIM (45.7 kD) (ttx-3) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Ag ==== 3e-040     XP_552873.2 AGAP008980-PA [Anopheles gambiae str. PEST] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 1e-040     NP_724428.1 CG8376-PA, isoform A [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 2e-050     XP_001186323.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Hs ---- 9e-088     NP_001014434.1 LIM homeobox 9 isoform 2 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Bt ---- 6e-088     NP_001019715.1 LIM homeobox 9 [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Gg ---- 2e-088     NP_990757.1 homeobox protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                              PREDICTED - Cf ---- 3e-094     XP_547376.2 PREDICTED: similar to LIM homeobox protein 9 isoform a isoform 1 [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                              PROTEIN --- Mm ---- 3e-094     NP_001020736.1 LIM homeobox protein 9 isoform a [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                              PREDICTED - Dr ---- 4e-097     NP_001017710.1 hypothetical protein LOC550405 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN --- Xl ---- 1e-115     NP_001087527.1 MGC84078 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6956105.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG---ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------TAA------TAA---------------TGA------------------TGA------------------------------TAA------------------------------------------------------------------------------TGATAG------TAA------------------TGA---------------------------TAA------------ATG------------------------TGA------------TGA---------------------ATG---------------------------TAATAA---------------------------------------------------------TGA---------TAAATGTAA---TAG------------------------ATG------------ATGTGA---------------------------------------------------------------------------------------------ATGTAG------TAG---------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   1       add Eye1      in                    IMAGE:6949018.5p                                                                                                                   CTCAGCCGGGCAAGTTCTGTTGCGCCTCATGGCTCATTGTCTCCCCTTGTTGCTGTTGTGTCTCTAGCAGGATCCTGAGATCGCATGTTGAGAAGCGACACTGGGGCTCCGTATATGGAAATTGTGGGGTGCAGAGCAGACGAAAGTGCCTATCCATTCCGGCCAGCAGCAGCCATGCTCTTCCACGGGATCACCGGGGGCCACATCCAAGGAATCATGGAAGAGATGGAGAGGAGGTCAAAGTCGGCCGACAGCCGCTTGGCCAAGAGTATCCAAGTCAATAGCAGAGAAACTAGGATGCCTTCCCTGAATCCTGAGAAGCCTACACTGTGCGCTGGGTGTGGGGGCAAGATCTCAGACAGATACTACCTCTTGGCTGTGGACAAGCAGTGGCACCTGCGCTGCCTGAAATGCTGTGAATGTAAGCTGACCCTCGAGTCGGAGCTGACTTGCTTTGCTAAGGATGGCAGTATATATTGCAAGGAGGACTATTACAGGTTTTCGGTGAAGAGGTGTGCCCGTTGCCATCTTGGCATTTCAGCCTCAGAGATGGTAATGAGAGCACGGGAGTCCGTCTACCACCTGAGCTGTTTTACCTGCACAACCTGTAACAAGACCTTAAGCACCGGGGATCAATTTGGCATGAAGGAAAACCTTGTCTACTGCCGGATTCACTTTGAGCTTCTTGTTCAGGGGGACTTCCATCAGCAGCTAAATTACACGGGAACTCTCAGCCAAGGGTGGGGGGAATAGCCGCCCCTGCCCGTATTTTCAGCAAAGGGACAGGCCACAGTGCAAAAAAGGGAAGGCCCAGGAAAGAGAAAAAAGTCCCAGCGGTTTGGGTGTGGGAACCTCGGGGAACTACCAGTTCAGG
  5   1   1       add Eye1                            IMAGE:6958008.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGATGCTTCATCGGGATCCATTTAGTTACACATGCCATTAGATGTTCATGAAGCACTTATTGCCCATTGTAAACTGAAGTTCTGCTTGTCTCCAGAAGGTTTTCGGTGCAGAGGTGTGCCCGTTGCCATCTTGGCATTTCAGCCTCAGAGATGGTAATGAGAGCACGGGAGTCCGTCTACCACTTGAGCTGCTTTACCTGCACAACCTGTAACAAGACCTTAAGCACCGGGGATCACTTTGGCATGAAGGAAAACCTTGTCTACTGCCGGATTCACTTTGAGCTTCTTGTCCAGGGGGACTTCCATCAGCAGTTAAATTACTCGGAGCTCTCAGCCAAGGGTGGGGGACTGGCAGCCCTGCCGTATTTCAGCAATGGGACAGGCACAGTGCAAAAGGGGAGGCCACGAAAGAGAAAGAGCCAGGCTTTGGGTGTGGACATCATCAACTACAGTTCAGGTTGTAACGAAAATGAGACAGATTTGGATCGGGACCAGACATACCCTCCTTCTCAAAAGTCGAAACGCATGAGAACCTCTTTCAAACATAACCAGCTCCGTACAATGAAGTCCTATTTTGCCATTAACCACAATCCAGATGCAAAAGATTTGAAACAACTGGCCCAGANAACTGGATTAACAAAGAGAGTCCTGCAGCGGAATGATCTTTGTGTGGATCGAGACTGATGCTAAATGAAACCAAAAATAATCTGCTTAATATTTGACCATTGCTTACAAAGTAGTTAAGACCTGAAGAGCAGTCTTAAAGCTTTACGGCCAGACATGGGATATAACACGCTTGCAAATTTCCAAATTGAGAAAGAAGGTGGNAAGAGGCCANGTTTAGTCTACAGAGCATCCTGCCTACTGGATGGGGGTACCTNGTTGCCCTGNAAAAAGTCCAAAATTTTTGATCTGATNGATGGCCAAGGCTCGAGCAGACTCTATCAAAGAAGATTGACCTCCCTTAAGATGGCGGGCATT
  5   1   2      seed Brn1                            IMAGE:6956105.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCTGGACCGGTCCGGATTCCCGGGATGAAGGTTTTCGGTGAAGAGGTGTGCCCGTTGCCATCTTGGCATTTCAGCCTCAGAGATGGTAATGAGAGCACGGGAGTCCGTCTACCACCTGAGCTGTTTTACCTGCACAACCTGTAACAAGACCTTAAGCACCGGGGATCAATTTGGCATGAAGGAAAACCTTGTCTACTGCCGGATTCACTTTGAGCTTCTTGTCCAGGGGGACTTCCATCAGCAGCTAAATTACACGGAGCTCTCAGCCAAGGGTGGGGGAATAGCCGCCCTGCCGTATTTCAGCAATGGGACAGGCACAGTGCAAAAAGGGAGGCCAAGAAAGAGAAAAAGTCCAGCGTTAGGTGTGGACATCATGAACTACAGTTCAGGTTGTAATGAAAATGAGACCGATTTGGATCGGGACCAGACATACCCTCCTTCTCAGAAGACGAAGCGCATGAGAACCTCTTTCAAACATCACCAGCTCCGTACAATGAAGTCCTATTTTGCCATTAACCATAATCCAGATGCAAAAGATCTGAAACAACTGGCCCAGAAAACTGGATTAACAAAGAGAGTTCTGCAGGGAGAACAATGTTCGGGGTTTAACAGCCATACAACCCGGCGTTTGAAAATTCCCTAAAGTATTTAAAGAAGGGGAAAAGTTTGATCGGGAAGTCTACTGCAGTGAAGACAAAGACaaaaaattagccaaaaattttaaaaatttaaatctatatataaaaaaaaGAACTTCTATGTCATTTTTTGGAATGTTCAAGCACATGCTTTTTTGTATGTATGATAGGAGTTCTAACATTGTACCCTGATAAAATGAGGGAAAGATGTTAAACTATT
  5   1   2       bld Eye1      in                    IMAGE:6957171.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATTTTGCCATTAACCATAATCCAGATGCAAAAGATCTGAAACAACTGGCCCAGAAAACTGGATTAACAAAGAGAGTTCTGCAGGGAGAACAATGTTCGGGGTTTAACAGCCATACAACCCGGCGTTTGAAAATTCCCTAAAGTATTTAAAGAAGGGGAAAAGTTTGATCGGGAAGTCTACTGCAGTGAAGAcaaagacaaaaaatttgccaaaaattttaaaaatttaaatctatatataaaaaaaaGAACTTCTATGTCATTTTTTGGAATGTTCAAGCACATGCTTTTTTGTATGTATGATAGGAGTTCTAACATTGTACCCTGATAAAATGAGGGAAGGATGTTAAGCTATTACAGTTTTAACGCCATTTTCATATGAATGCTTCGGATTTGTTGATAAAATGATACAAAACTGTGTGAttttttttttGCCCGCAAAAAATGTGTATATATCATGGAGCAACCTGGCATTAATAAACCTTATACAGTTTTGATGCAGAATTTATCAAAATTTTGTTTAGACTCAAGCACAACTGAAGATTAATTTAAATGTAAAAATAGCACTCTACAACCACGCTTGCAAAAATGTATTCTTCACAAATGTGAAATTGCAAAAGTGTATTCTTCACAAATGTGAAATCCCACTCTATTTGTGCCTGGTTTATTTAAAGTTATTGTTTTACTTATAGGTTCTGGTCCATGTAGCAGAAATAGACTGAATTATAATCCGACACCATAACCAAAATGACTGTGGGTCTTGTAGAACCTAATTCTTGTGTGGAAGCAAATTTAACTTTTACTTCTCCTAAATTATATAAAAATAGGTAAAATGCTTTACCCCAGGGAGAAAAACCAAACCC
  3   1   1       add Eye1      in                    IMAGE:6949018.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAAATGGATCCAAAGCCGTGGGATTTTTTTTTTCCCCGCACAAAATGTGTATATATCATGGGCAAACCTGGCATTAATAAACCTTATACAGTTTGGATGCAGAATTTATCAAATTTTTGTTTAGACTCAGGCACAACTGAAGATTAATTTAAATGTAAAAATAGCACTCTACAACCACGCTTGCAAAAATGTATTCTTCACAAATGTGAAATTGCAAAAGTGTATTCTTCACAAATGTGAAATCCCACTCTATTTGTGCCTGTTTATTTAAAGTTATTGTTTTACTTATAGGTTCTGTTCCATGTAGCAGAAATAGACTGAATTATAATCCGACACAATAACAAAATGACTGTGGTCTTGTAGACCTAATTCTTGTGTGTAGCAAATTAACTTTACATCTCTAAATTATATAAAAATATGTAAATGCTTACACAAGGAGAAAACAAACACACTGTTGTCGTACACTATTATATTATTCAACATAATGTGAATTGTCCATAGAATGGACCTCGGAAATACAGACCTAGTCATTTGTTTGAGCCTTTACATTACCGGAGTGCAGAATGTGAATACTCTATTTCTTTTTATGGTCTTCACATGGAGCTTAAATGTGGCCGAGTTTTGTGCAATTACTCCAGCTGCTGCAGTGGGGATCCTGCTCTTAGGAAAAAATGTAATTTGGTCAATCTGAGTAGGAATATTATTACACCAAAGCATAGATGCAATATAAACAAAAATAAAAGCGGACTGCATGGGACAAAACTATAAAGGAGAATTAAAATCTGCATGACATCTTATGCTTTCTTTTTCGCATGTATGTGTGAATCCCNTAACCTTACAAAGGA
  3   1   1       add Eye1      in                    IMAGE:6957171.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCCGGATTTTATTCAAAAAATTTTGGTTTGGGACTCCAAAGCCACAACTGGGAAGGTTTTATTTTAAAATGTTAAAAAATAGGCCATTCTTAACAAACCAAGGCTTTGGCAAAAAATGTTATTCCTTCCACAAATGGTGAAAATTGCAAAAAGGTGTATTCTTCCACAAAATGTGAAAATCCCCACTTTATTTGTGCCCGGTTTATTTAAAGTTATTGTTTTTACTTATAGGTTCCTGTTCCATGTAGCAGAAATAGACTGATTTATAATCCGACACAATAACAAAATGACTGTGGTCTTGTAGACCTAATTCTTGTGTGTAGCAAATTAACTTTACATCTCTAAATTATATAAAAATATGTAAATGCTTACACAAGGAGAAAACAAACACACTGTTGTCGTACACTATTATATTATTCAACATAATGTGAATTGTCCATAGAATGGACCTCGGAAATACAGACCTAGTCATTTGTTTGAGCCTTTACATTACCGGAGTGCAGAATGTGAATACTCTATTTCTTTTTATGGTCTTCACATGGAGCTTAAATGTGGCCGAGTTTTGTGCAATTACTCCAGCTGCTGCAGTGGGGATCCTGCTCTTAGGAAAAAATGTAATTTGGTCAATCTGAGTAGGAATATTATTACACCAAAGCATAGATGCAATATAAACAAAAATAAAAGCGGACTGCATGGGACAAAACTATAAAGGAGAATTAAAATCTGCATGACATCTTATGCTTTCTTTTTCGCTGTATGTGTGAATCCCTAACTTACAATGATGTTTTCTGTAAAATACAGTTTTCATGAATAAATACATCATCTGATGCAGATATAATACATGACTCCAAAGCTCGATCTAAACGAAGCATTATAAATGAAAGAATAAAAAAAGGACACAGTGTTAAATTATATAATGCTAAGTAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)