Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL021o11.3                            5 END     1          33       20                (no blast hit)

 This cluster: approximate FL confidence score = 90%

 1012799983 Xl3.1-IMAGE:6866272.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6866272.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGAGTGGCTGCCCCCAAGCACTAATATGTAATACATCTGTGACTCTTTCCGGATGTTCAAATGCGCTTGTCTAGCAAATGACTACATTTCCCAGTAGCATCTAACTGTGTATGTCCGGAAGTCACATGGCCCCAAACATCTGACAACAAGGTTGTGATGGATGAGTACCAAGATTGAGGTTCCCTAATGATCACGGACGCAGCTCAGTTCCAGCGAGAAGGAACGAGAAAGAGGCTCCGGCTCGGGGATGCAGCGTTGCTGCTTGGGACACTGACCTCCCCTAGTAACGATACACTTCCTTTCTCTACCTGTCAATCACGGACAGCCGGCACCTTCCCTGTTTTAGCGATCGCTTGTATGAAAGGAGCACCTTCACATCCGGGTGTCCCACTTACTGCTTAGGAACTGCTGAGCCTCTTCATCGCATTCTGAGGTGGAATATTGTTTCTTTGGGGGCTGAGCTCCCCTTAGGATGGAGAGAGCAATGGAGCAACTCAATCGCCTCACACGCTCCCTGCGCAGAGCCCGCACCGTGGAACTGCCTGAAGATAATGAAACTGCTGTTTACACCTTAATGCCGATGGTAATGGCTGATCAACATAGGTCTGTTTTGGAATTACTTTCAAATTCAAAATTTGATGTCAACTATGCCTTTGGAAGAGTTAAACGAAGTTTACTTCATATTGCTGCCAATTGTGGATCAGTGGAATGCCTGGTTTTGCTTTTAAAAAGAGGAGCAGATCCCAACTACCAGGATATTTCTGGATGTACACCTCTTCACTTAGCGGCTCGGAATGGGCAGAAGAAGTGCATGAGTAAACTGTTAGAATACAATGCTGATGTCAACATTTGTAATAATGAGGGACTCACTGCTATTCACTGGCTTGCTGTGAATGGTCGAACTGAACTTCTTCATGACCTTGTACAACATGTCACTAATGTGGATGTAGAAGATGCGATGGGGCAGACTGCACTTCATGTGGCATGTCAGAATGGACACAAAACGACTGTCTTGTGCTTGTTGGACAGTGGAGCAGATATAAACAGACCAAATGTATCAGGAGCTACTCCATTATATTTTGCGTGCAGCCACGGCCAGAAGGATACAGCACAGATTCTTTTACTGCGTGGTGCAAAGTACTTGCCCAGATAAGAATGGTGTTACACCCTCTGGATCTCTGTGTGCAGGGTGGATACGGTGAAACTTGTG
                                                  Xl3.1-CHK-1012711550                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGCTGCCCCCAAGCACTAATATGTAATACATCTGTGACTCTTTCCGGATGTTCAAATGCGCTTGTCTAGCAAATGACTACATTTCCCAGTAGCATCTAACTGTGTATGTCCGGAAGTCACATGGCCCCAAACATCTGACAACAAGGTTGTGATGGATGAGTACCAAGATTGAGGTTCCCTAATGATCACGGACGCAGCTCAGTTCCAGCGAGAAGGAACGAGAAAGAGGCTCCGGCTCGGGGATGCAGCGTTGCTGCTTGGGACACTGACCTCCCCTAGTAACGATACACTTCCTTTCTCTACCTGTCAATCACGGACAGCCGGCACCTTCCCTGTTTTAGCGATCGCTTGTATGAAAGGAGCACCTTCACATCCGGGTGTCCCACTTACTGCTTAGGAACTGCTGAGCCTCTTCATCGCATTCTGAGGTGGAATATTGTTTCTTTGGGGGCTGAGCTCCCCTTAGGATGGAGAGAGCAATGGAGCAACTCAATCGCCTCACACGCTCCCTGCGCAGAGCCCGCACCGTGGAACTGCCTGAAGATAATGAAACTGCTGTTTACACCTTAATGCCGATGGTAATGGCTGATCAACATAGGTCTGTTTTGGAATTACTTTCAAATTCAAAATTTGATGTCAACTATGCCTTTGGAAGAGTTAAACGAAGTTTACTTCATATTGCTGCCAATTGTGGATCAGTGGAATGCCTGGTTTTGCTTTTAAAAAGAGGAGCAGATCCCAACTACCAGGATATTTCTGGATGTACACCTCTTCACTTAGCGGCTCGGAATGGGCAGAAGAAGTGCATGAGTAAACTGTTAGAATACAATGCTGATGTCAACATTTGTAATAATGAGGGACTCACTGCTATTCACTGGCTTGCTGTGAATGGTCGAACTGAACTTCTTCATGACCTTGTACAACATGTCACTAATGTGGATGTAGAAGATGCGATGGGGCAGACTGCACTTCATGTGGCATGTCAGAATGGACACAAAACGACTGTCTTGTGCTTGTTGGACAGTGGAGCAGATATAAACAGACCAAATGTATCAGGAGCTACTCCATTATATTTTGCGTGCAGCCACGGCCAGAAGGATACAGCACAGATTCTTTTACTGCGTGGTGCAAAGTACTTGCCCAGATAAGAATGGTGTTACACCCTCTGGATCTCTGTGTGCAGGGTGGATACGGTGAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     474     173                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     474     112                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     474     246                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     474       8                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ci ---- 4e-018     BAE06328.1 Ci-Bcl3 [Ciona intestinalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 1e-021     NP_612015.1 CG17142-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 5e-022     NP_001021269.1 UNCoordinated family member (unc-44) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Dr ---- 9e-023     XP_693039.3 PREDICTED: similar to ankyrin repeat domain 52 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- ?? ---- 3e-023     XP_637214.1 ankyrin repeat-containing protein [Dictyostelium discoideum AX4] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 5e-024     XP_001197523.1 PREDICTED: similar to ankyrin 2,3/unc44 [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Bt ---- 3e-024     XP_604226.2 PREDICTED: similar to retinoic acid induced 14, partial [Bos taurus] -----------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - ?? ---- 8e-114     XP_605958.4 PREDICTED: similar to HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 isoform 1 [Bos taurus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Cf ==== 5e-127     XP_532247.2 PREDICTED: similar to HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 isoform 1 [Canis familiaris] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 6e-128     NP_766061.1 cDNA sequence BC025474 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Gg ==== 2e-128     NP_001026249.1 HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 2e-128     NP_065822.2 HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 4e-132     NP_001087077.1 HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 4e-132     Q28BK1 E3 ubiquitin-protein ligase HACE1 (HECT domain and ankyrin repeat-containing E3 ubiquitin-protein ligase 1) [Xenopus tropicalis]  ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6866272.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGTAA---------------------ATG---------------------------------------TAG---------------------------------------------------------TGA---ATG---------------------TAATGA---------------------------------------------------------ATG---------------------TGA---------------------------------------------------------------------TAG------------TGA------------------------------------------------TGA---------------------------------------------TGA------------ATG---------ATG---------------------------------------------------------------------------------------ATG---ATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ...
  5   1   2       bld Eye1 5g                         IMAGE:6958551.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGAGTGGCTGCCCCCAAGCACTAATATGTAATACATCTGTGACTCTTTCCGGATGTTCAAATGCGCTTGTCTAGCAAATGACTACATTTCCCAGTAGCATCTAACTGTGTATGTCCGGAAGTCACATGGCCCCAAACATCTGACAACAAGGTTGTGATGGATGAGTACCAAGATTGAGGTTCCCTAATGATCACGGACGCAGCTCAGTTCCAGCGAGAAGGAACGAGAAAGAGGCTCCGGCTCGGGGATGCAGCGTTGCTGCTTGGGACACTGACCTCCCCTAGTAACGATACACTTCCTTTCTCTACCTGTCAATCACGGACAGCCGGCACCTTCCCTGTTTTAGCGATCGCTTGTATGAAAGGAGCACCTTCACATCCGGGTGTCCCACTTACTGCTTAGGAACTGCTGAGCCTCTTCATCGCATTCTGAGGTGGAATATTGTTTCTTTGGGGGCTGAGCTCCCCTTAGGATGGAGAGAGCAATGGAGCAACTCAATCGCCTCACACGCTCCCTGCGCAGAGCCCGCACCGTGGAACTGCCTGAAGATAATGAAACTGCTGTTTACACCTTAATGCCGATGGTAATGGCTGATCAACATAGGTCTGTTTTGGAATTACTTTCAAATTCAAAATTTGATGTCAACTATGCCTTTGGAAGAGTTAAACGAAGTTTACTTCATATTGCTGCCAATTGTGGATCAGTGGAATGCCTGGTTTTGCTTTTAAAAAGAGGAGCAGATCCCCAACTACCAGGATTTTTCTGGGATGTACACCCTCTTCACTTTAGCGGGCTCGGGAATGGGGGCAGAAGAAANGTGCATTGAGGTAAAACTTGGTTAGGAAC
  5   1   2      seed Emb1 5g                         IMAGE:6866272.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTTGTATGAAAGGAGCACCTTCACATCCGGGTGTCCCACTTACTGCTTAGGAACTGCTGAGCCTCTTCATCGCATTCTGAGGTGGAATATTGTTTCTTTGGGGGCTGAGCTCCCCTTAGGATGGAGAGAGCAATGGAGCAACTCAATCGCCTCACACGCTCCCTGCGCAGAGCCCGCACCGTGGAACTGCCTGAAGATAATGAAACTGCTGTTTACACCTTAATGCCGATGGTAATGGCTGATCAACATAGGTCTGTTTTGGAATTACTTTCAAATTCAAAATTTGATGTCAACTATGCCTTTGGAAGAGTTAAACGAAGTTTACTTCATATTGCTGCCAATTGTGGATCAGTGGAATGCCTGGTTTTGCTTTTAAAAAGAGGAGCAGATCCCAACTACCAGGATATTTCTGGATGTACACCTCTTCACTTAGCGGCTCGGAATGGGCAGAAGAAGTGCATGAGTAAACTGTTAGAATACAATGCTGATGTCAACATTTGTAATAATGAGGGACTCACTGCTATTCACTGGCTTGCTGTGAATGGTCGAACTGAACTTCTTCATGACCTTGTACAACATGTCACTAATGTGGATGTAGAAGATGCGATGGGGCAGACTGCACTTCATGTGGCATGTCAGAATGGACACAAAACGACTGTCTTGTGCTTGTTGGACAGTGGAGCAGATATAAACAGACCAAATGTATCAGGAGCTACTCCATTATATTTTGCGTGCAGCCACGGCCAGAAGGATACAGCACAGATTCTTTTACTGCGTGGTGCAAAGTACTTGCCCAGATAAGAATGGTGTTACACCCTCTGGATCTCTGTGTGCAGGGTGGATACGGTGAAACTTGTG
  5   1   2      skin DMZ       out                        xl312p21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ANTTTACTTCATATTGCTGCCAATTGTGGATCAGTGGAATGCCTGGTTTTGCTTTTAAAAAGAGGAGCAGATCCCAACTACCAGGATATTTCTGGATGTACACCTCTTCAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)