Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 28 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 90%

 1012800139 Xl3.1-IMAGE:3400653-IMAGp.5 - 3 ESTs
                                                                       ..-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3400653-IMAGp.5             CTCTTTCCTCTGTCTTTTCTCTCCCACCCTCTCCTCTTCCTCTGTAACCCCAGCTCCCTCTCTCCTGTCTCGTCTCACACTGGCACATTCTCCGGGAAGGGAGGCTGCTATTTATTAAAAAAAAGAAGGACAAAGGGAAACAATCCATTTGGGGGAAGCGGAAGCACGAGAGTGCACTACAAAATAGACTTCTGCATCTTCACTCTCAATCCTTACCTGGAGCTGTAACAGCCACTGGGGCTGCCGCAGATGTTGCTGCTTGTCTACAGAACCCGGACTGTCCCAGTCACTCTCTGATCTCCGCACAAGCGAAACTCTTGGAGCAGAATACTTTTGGCCGGGGAATTTCATCTCTTCTTCTTCTCTCTAGTCGAATTAAAACACAACCCAGTCTGAGAATTAGCCGGCAGTTTGTGTCAATGCTTGTTTCTGCCACTTTAATGTGCCCGTGAAGATCCTTCAGACTGGACTGAGCCCCAAACGGTGACATCCAAAGGGTGCAAGTGAATGAATTTACCCATGAGAGACCCAGTAATTTCAGGGTCAGGCATGGCTTACCATCCATTCCTATCCCACAGGGCACCAGACTTTGCAATGAGTGCTGTTCTTGGACACCAACCTCCCTTTTTTCCAACCCTGGCTCTGCCACCCAATGGGGCTGCTCTTTCCCTTTCTAGTGCCCTGGCCAAGCCCATCATGGATCAATTAATGGGTGCCGCAGAGACTGGCATCCCCTTTTCATCTTTGGGTCATCAGGCAGCTGCTCATTTGAGGCCTCTTAAAACCCTTGAACCAGAAGAAGAA
                                                  Xl3.1-CHK-1012714934                   CCTCTGTCTTTTCTCTCCCACCCTCTCCTCTTCCTCTGTAACCCCAGCTCCCTCTCTCCTGTCTCGTCTCACACTGGCACATTCTCCGGGAAGGGAGGCTGCTATTTATTAAAAAAAAGAAGGACAAAGGGAAACAATCCATTTGGGGGAAxxGxxAGCACGAGAGTGCACTACAAAATAGACTTCTGCATCTTCACTCTCAATCCTTACCTGGAGCTGTAACAGCCACTGGGGCTGCCGCAGATGTTGCTGCTTGTCTACAGAACCCGGACTGTCCCAGTCACTCTCTGATCTCCGCACAAGCGAAACTCTTGGAGCAGAATACTTTTGGCCGGGGAATTTCATCTCTTCTTCTTCTCTCTAGTCGAATTAAAACACAACCCAGTCTGAGAATTAGCCGGCAGTTTGTGTCAATGCTTGTTTCTGCCACTTTAATGTGCCCGTGAAGATCCTTCAGACTGGACTGAGCCCCAAACGGTGACATCCAAAGGGTGCAAGTGAATGAATTTACCCATGAGAGACCCAGTAATTTCAGGGTCAGGCATGGCTTACCATCCATTCCTATCCCACAGGGCACCAGACTTTGCAATGAGTGCTGTTCTTGGACACCAACCTCCCTTTTTTCCAACCCTGGCTCTGCCACCCAATGGGGCTGCTCTTTCCCTTTCTAGTGCCCTGGCCAAGCCCATCATGGATCAATTAATGGGTGCCGCAGAGACTGGCATCCCCTTTTCATCTTTGGGTCATCAGGCAGCTGCTCATTTGAGGCCTCTTAAAACCCTTGAACCAGAAGAAGAAGTTGAA
                                                      consensus depths                  1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     2     3     2     3     2     3     1     3     2     2     1     2     2     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     507     270             
                                               BLH MIN     507      39             
                                               BLH MPR     507      39             
                                               BLH OVR     507     559             
                                               CDS MIN     507      39             
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Dr ==== 7e-039     NP_001095140.1 T-box 3b [Danio rerio] ========================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Gg ==== 2e-039     XP_001234535.1 PREDICTED: similar to T-box 3 protein [Gallus gallus] ===========================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = ?? ==== 2e-040     XP_001787873.1 PREDICTED: similar to T-box transcription factor TBX3 (T-box protein 3) [Bos taurus] ======================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Mm ==== 2e-040     XP_001477682.1 PREDICTED: similar to T-box 3 protein [Mus musculus] ======================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Cf ==== 9e-041     XP_534692.2 PREDICTED: similar to T-box 3 protein isoform 1 [Canis familiaris] ===========================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 8e-041     NP_057653.3 T-box 3 protein isoform 2; bladder cancer related protein XHL; T-boxtranscription factor TBX3; T-box 3 protein [Homo sapiens] ================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Xt ==== 2e-049     NP_001027524.1 hypothetical protein LOC613116 [Xenopus tropicalis] =======================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 3e-052     NP_001081402.1 transcription factor Tbx3 [Xenopus laevis] ================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:3400653-IMAGp.5                                                                                                                                                                                                                                              TAA---------------------ATG------------------------------------------TGA------------------------------------------------------------------------------------------------TGA------------------------------------------TAA---------------------------------------------------------------TGAATG---------ATG---------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                   ...
  5   1   2      seed Ga18 5g                           xlk148b18ex.5p GAANNNGNCTGtctctttcctctgtcttttctctcccaccctctcctcttcctctgtaaccccagctccctctctcctgtctcgtctcACACTGGCACATTCTCCGGGAAGGGAGGCTGCTATTTATTaaaaaaaaGAAGGACAAAGGGAAACAATCCATTTGGGGGAACAGCGNAAGNNGAGANNNNNTACAAAATAGACTTCTGCATCTTCACTCTCAATCCTTACCTGGAGCTGTAACAGCCACTGGGGCTGCCGCAGATGTTGCTGCTTGTCTACAGAACCCGGACTGTCCCAGTCACTCTCTGATCTCCGCACAAGCGAAACTCTTGGAGCAGAATACTTTTGGNCGGGGAATTTGAtctcttcttcttctctctAGTCGAATTAAAACACAACCCAGTCTGAGAATTAGCCGGCAGTTTGTGTCAATGCTTGTTTCTGCCACTTTAATGTGCCCGTGAAGATCCTTCAGACTGGACTGAGCCCCAAACGGTGACATCCAAAGGGTGCAAGTGANTGAATTTACCCATGAGAGANCCAGTAATTTCAGGGTCAGGCATGGNTTACCATCCATTCCTATCCCACAGGGCACCAGACTTTGCAATGAGTGCTGTTCTTGGNCACCAACCTCCCTTTTTTCCAACCCTGGCTCTNCACCCAATGGGGCTGNTCTTTCNNNTTCTAGTGC
  5   1   1       add Emb3 5x3  out                   IMAGE:3400653.5p                                                   TCTGTAACCCCAGCTCCCTCTCTCCTGTCTCGTCTCACACTGGCACATTCTCCGGGAAGGGAGGCTGCTATTTATTaaaaaaaaGAAGGACAAAGGGAAACAATCCATTTGGGGGAACAGCGGAAGCACGAGAGTGCACTACAAAATAGACTTCTGCATCTTCACTCTCAATCCTTACCTGGAGCTGTAACAGCCACTGGGGCTGCCGCAGATGTTGCTGCTTGTCTACAGAACCCGGACTGTCCCAGTCACTCTCTGATCTCCGCACAAGCGAAACTCTTGGAGCAGAATACTTTTGGCCGGGGAATTTCAtctcttcttcttctctctAGTCGAATTAAAACACAACCCAGTCTGAGAATTAGCCGGCAGTTTGTGTCAATGCTTGTTTCTGCCACTTTAATGTGCCCCGGAAGATCCTTCAGACTGGACTGAGCCCCAAACGGTGACATTCCAAAGGTGCCAGTGAATGAATTTACCCATGAGAGACCCAGTAATTTCAGGGTCAGGCATTGCTTACCATCCATACCTAGTCCACAGGGCACCAGAACTGGGAATGAGTGCCCGTCTGGGACACAACCCTCCTTGNTNCCAACCCCTGCTGCTGCCACCAAATGGGCCTGTTGTTGCCTTTTTTAGTGCCTGGCCAAGCCCNATAATGGATCATTGAATGGNGCCCCANGAAACTGCA
  5   1   2       bld Emb3 5g                IMAGE:3400653-IMAGp.IMAGp                                                                                                                                                                                       AGTGCACTACAAAATAGACTTCTGCATCTTCACTCTCAATCCTTACCTGGAGCTGTAACAGCCACTGGGGCTGCCGCAGATGTTGCTGCTTGTCTACAGAACCCGGACTGTCCCAGTCACTCTCTGATCTCCGCACAAGCGAAACTCTTGGAGCAGAATACTTTTGGCCGGGGAATTTCAtctcttcttcttctctctAGTCGAATTAAAACACAACCCAGTCTGAGAATTAGCCGGCAGTTTGTGTCAATGCTTGTTTCTGCCACTTTAATGTGCCCGTGAAGATCCTTCAGACTGGACTGAGCCCCAAACGGTGACATCCAAAGGGTGCAAGTGAATGAATTTACCCATGAGAGACCCAGTAATTTCAGGGTCAGGCATGGCTTACCATCCATTCCTATCCCACAGGGCACCAGACTTTGCAATGAGTGCTGTTCTTGGACACCAACCTCCCTTTTTTCCAACCCTGGCTCTGCCACCCAATGGGGCTGCTCTTTCCCTTTCTAGTGCCCTGGCCAAGCCCATCATGGATCAATTAATGGGTGCCGCAGAGACTGGCATCCCCTTTTCATCTTTGGGTCATCAGGCAGCTGCTCATTTGAGGCCTCTTAAAACCCTTGAACCAGAAGAAGAAGTTGAAGAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)