Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012800161 Xl3.1-XL141j16.3 - 4 ESTs
                                                                       ...-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL141j16.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAGAATTCTGTTGCCCATGCTAAGAGGCACAGCCGATCCTAAAGAGCCATCAACGTACGAATTTGTAAAGTTTATTGGAAACTTCAAGTCTTTAAATAATGTGCCCAGCTCTACACATAATGGATTTGATGGTGCATTACAGAGGTCTCTGCGGCCACCCTATGAAGAGAGAGTGTGCTTTGTAGCCACTGTAAGGCTAGCTACTCCACAGTTCATTAAGGAAATGTGCACTGTAGAGGAATCCAATGAAGAGTTCACATCAAGGCACAGTCTGGAATGGAAGTTCCTTTTCTTGGACCACAGGGCCCCTCCAATCATTGGATATTTGCCTTTTGAGGTGCTAGGAACTTCTGGCTATGATTATTATCACGTGGATGACCTGGAAAACCTTGCAAAATGCCATGAACACTTAATGCAGTATGGAAAAGGCAAGTCATGCTATTACAGGTTCCTGACAAAAGGACAGCAATGGATATGGCTGCAGACGCGCTACTATATCACCTACCATCAGTGGAATTCCAGGCCAGAGTTTATAGTTTGTACGCATACTGTAGTAAGCTATGCAGAGGTTGGAGCAGAAAGAAGACGTGAGCGGGGCAATGAAGATTCCCCTCCTGCCATAACTGCAGAAAAAAATCAGGACTCTGTCTCAGACAATCACATGAACACAGTCAGTCTGAAGGAAGCTTTGGAAAGATTTGATGACAGCCGAACGCCTTCACCGTCATCCAAAAGCTCAATTAAATCATCCTCTCACACAGCAGTTTCCGACCCATCATCAACGCCAACAAAGATCCCAACAGACACAAGCACACCACCTAGACAAGCTTTAACTGGCCTTGACAAGAGGAGGTCATCAATCAGCAGCCAGTCTATGAGCTCTCAGTCAGTCAGTCAGCCTCTGTCGAGTCAGTGATGAAGCAAACAGCATCTATTCAGCTCCAGCAAGGAATGACACAGCCCATGTTTCAGTTCACGGCGCAGTTTGGAGCTATGAAGCACCTGAAGGACCAGCTGGAGCAGAGAACTCGGATCATTGAAGAAAACATCCAGCGGCAGCAGGAGGA
                                                  Xl3.1-CHK-1012706378                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCTGTTGCCCATGCTAAGAGGCACAGCCGATCCTAAAGAGCCATCAACGTACGAATTTGTAAAGTTTATTGGAAACTTCAAGTCTTTAAATAATGTGCCCAGCTCTACACATAATGGATTTGATGGTGCATTACAGAGGTCTCTGCGGCCACCCTATGAAGAGAGAGTGTGCTTTGTAGCCACTGTAAGGCTAGCTACTCCACAGTTCATTAAGGAAATGTGCACTGTAGAGGAATCCAATGAAGAGTTCACATCAAGGCACAGTCTGGAATGGAAGTTCCTTTTCTTGGACCACAGGGCCCCTCCAATCATTGGATATTTGCCTTTTGAGGTGCTAGGAACTTCTGGCTATGATTATTATCACGTGGATGACCTGGAAAACCTTGCAAAATGCCATGAACACTTAATGCAGTATGGAAAAGGCAAGTCATGCTATTACAGGTTCCTGACAAAAGGACAGCAATGGATATGGCTGCAGACGCGCTACTATATCACCTACCATCAGTGGAATTCCAGGCCAGAGTTTATAGTTTGTACGCATACTGTAGTAAGCTATGCAGAGGTTGGAGCAGAAAGAAGACGTGAGCGGGGCAATGAAGATTCCCCTCCTGCCATAACTGCAGAAAAAAATCAGGACTCTGTCTCAGACAATCACATGAACACAGTCAGTCTGAAGGAAGCTTTGGAAAGATTTGATGACAGCCGAACGCCTTCACCGTCATCCAAAAGCTCAATTAAATCATCCTCTCACACAGCAGTTTCCGACCCATCATCAACGCCAACAAAGATCCCAACAGACACAAGCACACCACCTAGACAAGCTTTAACTGGCCTTGACAAGAGGAGGTCATCAATCAGCAGCCAGTCTATGAGCTCTCAGTCAGTCAGTCAGCCTCTGTCGAGTCAGTGATGAAGCAAACAGCATCTATTCAGCTCCAGCAAGGAATGACACAGCCCATGTTTCAGTTCACGGCGCAGTTTGGAGCTATGAAGCACCTGAAGGACCAGCTGGAGCAGAGAACTCGGATCATTGAAGAAAACATCCAGCGGCAGCAGGAGGAGCTGCG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     3     1     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN      17     155                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                                                       PROTEIN --- Ci ---- 2e-014     NP_001071651.1 transcription factor protein [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PREDICTED - Sp ---- 3e-035     XP_001190768.1 PREDICTED: similar to clock protein [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                           PROTEIN --- Dm ---- 8e-065     NP_001014576.1 Clock CG7391-PD, isoform D [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                       PROTEIN --- Ag ---- 9e-069     XP_315720.4 AGAP005711-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                          PROTEIN --- Bt ---- 2e-110     NP_001077232.1 neuronal PAS domain protein 2 [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PREDICTED - ?? ---- 5e-109     XP_001254268.2 PREDICTED: similar to clock [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PROTEIN --- Dr ---- 1e-153     NP_571032.1 clock [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PROTEIN --- Gg ---- 4e-143     NP_989505.2 clock [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PREDICTED - Cf ---- 5e-143     XP_532376.2 PREDICTED: similar to clock [Canis familiaris] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PROTEIN --- Mm ---- 2e-143     NP_031741.1 circadian locomoter output cycles kaput [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PROTEIN --- Hs ---- 1e-144     NP_004889.1 clock [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PROTEIN --- Xt ---- 2e-170     NP_001122127.1 clock homolog [Xenopus (Silurana) tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PROTEIN --- Xl ---- 6e-175     NP_001083854.1 circadian rhythmicity protein CLOCK [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL141j16.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------TGATGA---------------------------------TGA---------------------------------------TGA------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  5   1   1       add Ga12                                 XL153l21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAGAATTCTGTTGCCCATGCTAAGAGGCACAGCCGATCCTAAAGAGCCATCAACGTACGAATTTGTAAAGTTTATTGGAAACTTCAAGTCTTTAAATAATGTGCCCAGCTCTACACATAATGGATTTGATGGTGCATTACAGAGGTCTCTGCGGCCACCCTATGAAGAGAGAGTGTGCTTTGTAGCCACTGTAAGGCTAGCTACTCCACAGTTCATTAAGGAAATGTGCACTGTAGAGGAATCCAATGAAGAGTTCACATCAAGGCACAGTCTGGAATGGAAGTTCCTTTTCTTGGACCACAGGGCCCCTCCAATCATTGGATATTTGCCTTTTGAGGTGCTAGGAACTTCTGGCTATGATTATTATCACGTGGATGACCTGGAAAACCTTGCAAAATGCCATGAACACTTAATGCAGTATGGAAAAGGCAAGTCATGCTATTACAGGTTCCTGACAAAAGGACAGCAATGGATATGGCTGCAGACGCGCTACTATATCACCTACCATCAGTGGAATTCCAGGCCAGAGTTTATAGTTTGTACGCATACTGTAGTA
  3   1   2      seed Ga12      out                        XL141j16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGACCACAGGGCCCCTCCAATCATTGGATATTTGCCTTTTGAGGTGCTAGGAACTTCTGGCTATGATTATTATCACGTGGATGACCTGGAAANCCTTGCAAAATGCCATGAACACTTAATGCAGTATGGAAAAGGCAAGTCATGCTATTACAGGTTCCTGACAAAAGGACAGCAATGGATATGGNTGCAGACACGNTACTATATCACCTACCATCAGTGGAATTCCAGGCCAGAGTTTATAGTTTGTACGCATACTGTAGTAAGCTATGCAGAGGTTGGAGCAGAAAGAAGACGTGAGCGGGGCAATGAAGATTCCCCTCCTGCCATAACTGCAGAAAAAAATCAGGACTCTGTCTCAGNCAATCACATGAACACAGTCAGTCTGAAGGAAGCTTTGGAAAGATTTGATGACAGCCGAACGCCTTCACCGTCATCCAAAAGCTCAATTANATCATCCTCTCACACAGCAGTTTCCGACCCATCATCAACGCCAACAAAGATCCCAACAGACACAAGCACACCACCTAGACAAGACTTTAACGGCCTNACAAGAGGAGGTCATCAATCAGCAGCCA
  5   1   2       bld Ga12                                 XL157i02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGGGCAATGAAGATTCCCCTCCTGCCTAACTGCAGAAAAAAATCAGGACTCTGTCTCAGACAATCACATGAACACAGTCAGTCTGAAGGAAGCTTTGGAAAGATTTGATGACAGCCGAACGCCTTCACCGTCATCCAAAAGCTCAATTAAATCATCCTCTCACACAGCAGTTTCCGACCCATCATCAACGCCAACAAAGATCCCAACAGACACAAGCACACCACCTAGACAAGCTTTAACTGGCCTTGACAAGAGGAGgtcatcaatcagcagccagtctatgagctctcagtcagtcagtcagcctctgtcgagtcagTGATGAAGCAAACAGCATCTATTCAGCTCCAGCAAGGAATGACACAGCCCATGTTTCAGTTCACGGCGCAGTTTGGAGCTATGAAGCACCTGAAGGACCAGCTGGAGCAGAGAACTCGGATCATTGAAGAAAACATCCAGCGGCAGCAGGAGGAGCTGCGTAAGA
  5   1   2       bld Ga12                                 XL158i02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGGCAATGAAGATTCCCCTCCTGCCTANCTGCAGAAAAAAATAGGACTCTGTCTCAGACAATCACATGAACACAGTCAGTCTGAAGGAAGCTTTGGNAAGATTTGATGACAGCCGAACGCCTTCACCGTCATCCAAAAGCTCAATTAAATCATCCTCTCACACAGCAGTTTCCGACCCATCATCAACGCCAACAAAGATCCCAACAGACACAAGCACACCACCTAGACAAGCTTTAACTGGCCTTGACAAGAGGAGGTCATCAATCAGCAGCCAGTCTATGAGCTCTCAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)