Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 06 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 87%

 1012800169 Xl3.1-XL071i20.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL071i20.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGCGGGAAGTAAGGCAGCAAAAATGGATTTCAAAAGAAAGAAAGGACCATCTTCCAGCCTGCCTTCTTCACAGACCAAAAAATTAAGAGGAGACTGGGACGACGATATGCCTTCTCAGTTTGAGGAGGAACTGGCCTACCTGGATGAAGTCGAAGCAGACATGGCTATGGAGCTGAGTGAGGGACAGCTCAGTGCTGATATTCTGCCTGTTGGAAAACTCATCTCTGACAATATCCCTCCAAAGTGGTTAAGGCCACCAGTTTCACTCACCGACCCCAAAGAGCAACATCTTTGCTTTCAACAGGTTGAACTGGACCACTATGTGGGAAGTCATGTCTCGGGAATGCTGGGAGCGACAAAGGGACCTGTACCCATCATACGCATGTTTGGGATCACAGAAGAAGGAAACAGTGTCTGTTGCCATATCCATGGCTTTGCTCCTTACTTCTATGTGCCCTGTCATACTGGTTTCAAGCAGGAGGATTTAAGTGACTTTAAGAAGGAGTTAAATACAGCTGTGATTAAAGACATGCGCTCCAACAAAGACGGCATCTCACAGGCCGTCCTTGCTGTGGACGTCTGCCACAAAGAAAATATGTATGGATACCATGNGGAAGAGGATAATGCCTTTTATGAAGATTACCATGGGCTCTTCCACGTCTCATTGCCCCCGCAAAGCGTCTCCTAGAAACAAGGCTTGCGGGTTTGGGAGGCACCCCATACATTGTTACCAAGCCTATGAAGCAAACATTGATTTTGAAATCAGGGTTATGGTGGACAATGATATCGTTGGGTGTAACTGATTGAGCTCCCTGCAGGCAAATACCGTGTGCGGAAAGAATCGCAAGATGAAGAACCTTCTAAAGACAATCCCCGCAAGGTGTCCCTTGCTCAGATTGAGGTGGACATCAGCTGGGCTGATCTGATCAGTCACCCTGCAGAAGGGGAATGGCAGAAAATTGCCCCTCAGCGAGTTCTCAGCTTTGATATTGAATGCGCTGGAAGGAAAGGTGTTTTCCCTGAGCCCGACAAGGATCCTGTGATCCAGATTGCAAACATGGTGCTGCGCCAAGGAGAAAAGGATCCATTTATTCGCAACGTGTTCACACTGGGCACTTGTGCAAGCATTGTGGGTTCCCAGGAGCTCTGCTTTGAACGGGAGGATGCACTTCTCAAGGCTTGGGCTGAGTTTGTTCGCATTATCGACCCGGATATTATCACTGGATACAACATTCAGAACTTTGACATGCCGTACCTGATCAACAGGGCCCAAACGCTCAAGGTTTCTACTTTTCCTTTTCTTGGCAGAATCCGATCTCTCAAATCTGTTATCCGAGATTCTTCTTTCCAGTCCAAACAGATGGGCCGACGGGAGAACAAAGTCATTAACACAGAGGGTCGGGTTCAATTCGACTTGTTGCAGGTTCTCCTGCGAGACTATAAGCTCCGTTCTTATACTTTANATGCTGTGAGTTTCCATTTCCTACAAGAACAGAAGGAAGATGTGCAGCACTCCATCATTACTGACTTACAGAATGGCAACGAGCAGACCCGCAGGCGACTGGCTGTTTATTGCCTANAGGGATGCTACCTGCCCCTTCGTCTCCTGNAGAAACTTATGTGCGTCATCAACTACATGGAAATGGCACGTGTGACTGGCGTTCCCCTCAGNTACCTACTGTCTCGTGGCCAGCAGAATAAAAGTGGTGTCTCAGCTTTTTAAGACAGGGCCATGAAC------------GATGCCCTGTGGGTCAGGTCCAAAAGGGAAGGTGAAAGATTTACACCTGGGGGCCCACCGGTCCAATTGAAACCCCCTGGAAAAGGGGAATTAACCCATGGGGGCCAATTAACCCAACCCTTGGAAATTTTCCCCGGCCCCCTGTGATACCCCCTCCAATTTATTGGA
                                                  Xl3.1-CHK-1012714305                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAGTAAGGCAGCAAAAATGGATTTCAAAAGAAAGAAAGGACCATCTTCCAGCCTGCCTTCTTCACAGACCAAAAAATTAAGAGGAGACTGGGACGACGATATGCCTTCTCAGTTTGAGGAGGAACTGGCCTACCTGGATGAAGTCGAAGCAGACATGGCTATGGAGCTGAGTGAGGGACAGCTCAGTGCTGATATTCTGCCTGTTGGAAAACTCATCTCTGACAATATCCCTCCAAAGTGGTTAAGGCCACCAGTTTCACTCACCGACCCCAAAGAGCAACATCTTTGCTTTCAACAGGTTGAACTGGACCACTATGTGGGAAGTCATGTCTCGGGAATGCTGGGAGCGACAAAGGGACCTGTACCCATCATACGCATGTTTGGGATCACAGAAGAAGGAAACAGTGTCTGTTGCCATATCCATGGCTTTGCTCCTTACTTCTATGTGCCCTGTCATACTGGTTTCAAGCAGGAGGATTTAAGTGACTTTAAGAAGGAGTTAAATACAGCTGTGATTAAAGACATGCGCTCCAACAAAGACGGCATCTCACAGGCCGTCCTTGCTGTGGACGTCTGCCACAAAGAAAATATGTATGGATACCATGNGGAAGAGGATAATGCCTTTTATGAAGATTACCATGGGCTCTTCCACGTCTCATTGCCCCCGCAAAGCGTCTCCTAGAAACAAGGCTTGCGGGTTTGGGAGGCACCCCATACATTGTTACCAAGCCTATGAAGCAAACATTGATTTTGAAATCAGGGTTATGGTGGACAATGATATCGTTGGGTGTAACTGxxTxxxCTCCCTGCAGGCAAATACCGTGTGCGGAAAGAATCGCAAGATGAAGAACCTTCTAAAGACAATCCCCGCAAGGTGTCCCTTGCTCAGATTGAGGTGGACATCAGCTGGGCTGATCTGATCAGTCACCCTGCAGAAGGGGAATGGCAGAAAATTGCCCCTCAGCGAGTTCTCAGCTTTGATATTGAATGCGCTGGAAGGAAAGGTGTTTTCCCTGAGCCCGACAAGGATCCTGTGATCCAGATTGCAAACATGGTGCTGCGCCAAGGAGAAAAGGATCCATTTATTCGCAACGTGTTCACACTGGGCACTTGTGCAAGCATTGTGGGTTCCCAGGAGCTCTGCTTTGAACGGGAGGATGCACTTCTCAAGGCTTGGGCTGAGTTTGTTCGCATTATCGACCCGGATATTATCACTGGATACAACATTCAGAACTTTGACATGCCGTACCTGATCAACAGGGCCCAAACGCTCAAGGTTTCTACTTTTCCTTTTCTTGGCAGAATCCGATCTCTCAAATCTGTTATCCGAGATTCTTCTTTCCAGTCCAAACAGATGGGCCGACGGGAGAACAAAGTCATTAACACAGAGGGTCGGGTTCAATTCGACTTGTTGCAGGTTCTCCTGCGAGACTATAAGCTCCGTTCTTATACTTTANATGCTGTGAGTTTCCATTTCCTACAAGAACAGAAGGAAGATGTGCAGCACTCCATCATTACTGACTTACAGAATGGCAACGAGCAGACCCGCAGGCGACTGGCTGTTTATTGCCTANAGGGATGCTACCTGCCCCTTCGTCTCCTGNAGAAACTTATGTGCGTCATCAACTACATGGAAATGGCACGTGTGACTGGCGTTCCCCTCAGNTACCTACTGTCTCGTGGCCAGCAGAATAAAAGTGGTGTCTCAGCTTTTTAAGACAGGGCCATGAACANGGACCTGNTTGATGCCCTGTGGGTCAGGTCCAAAAGGGAAGGTGAAAGATTTACACCTGGGGGCCCACCGGTCCAATTGAAACCCCCTGGAAAAGGGGAATTAACCCATGGGGGCCAATTAACCCAACCCTTGGAAATTTTCCCCGGCCCCCTGTGATACCCCCTCCAATTTATTGGATTGGCG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     0     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG      24     388                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      24     226                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 5e-012     XP_001186044.1 PREDICTED: similar to DNA polymerase delta1 catalytic subunit [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 1e-012     XP_426179.2 PREDICTED: similar to DNA polymerase zeta catalytic subunit [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN -== Ce ==== 5e-104     NP_506017.1 polymerase delta (120.8 kD) (5M525) [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- ?? ---- 5e-112     XP_638283.1 DNA polymerase delta catalytic subunit [Dictyostelium discoideum AX4] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- At ---- 1e-118     NP_201201.2 EMB2780 (EMBRYO DEFECTIVE 2780); DNA-directed DNA polymerase [Arabidopsis thaliana] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Os ---- 5e-119     NP_001067405.1 Os11g0186400 [Oryza sativa (japonica cultivar-group)] --------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dm ==== 8e-150     NP_524099.2 DNA-polymerase-delta CG5949-PA [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Bt ==== 1e-159     NP_776852.1 polymerase (DNA directed), delta 1, catalytic subunit 125kDa [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 2e-160     NP_035261.2 polymerase (DNA directed), delta 1, catalytic subunit; DNA polymerase delta 1,catalytic domain; polymerase (DNA directed), delta 1, catalytic subunit (125kDa)[Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 2e-162     NP_002682.2 polymerase (DNA directed), delta 1, catalytic subunit 125kDa [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Cf ==== 8e-163     XP_863454.1 PREDICTED: similar to DNA polymerase delta catalytic subunit (DNA polymerase delta subunit p125) isoform 2 [Canis familiaris] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 0          NP_001034899.1 DNA polymerase delta1 catalytic subunit [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 0          AAI57513.1 Unknown (protein for MGC:180510) [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 0          NP_001087694.1 polymerase (DNA directed), delta 1, catalytic subunit [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL071i20.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATG---------------------------------------------------------------------------------ATG---------------------------------------------------ATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------------------------------------------------------------------------------TAG---------------------------------------------------TGA---------TGA---TGA---------------------TGA------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---ATG---------------------------------------------------------------------------TAA---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...
  5   1   1       add Emb1 5g                         IMAGE:6632249.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGCGGGAAGTAAGGCAGCAAAAATGGATTTCAAAAGAAAGAAAGGACCATCTTCCAGCCTGCCTTCTTCACAGACCAAAAAATTAAGAGGAGACTGGGACGACGATATGCCTTCTCAGTTTGAGGAGGAACTGGCCTACCTGGATGAAGTCGAAGCAGACATGGCTATGGAGCTGAGTGAGGGACAGCTCAGTGCTGATATTCTGCCTGTTGGAAAACTCATCTCTGACAATATCCCTCCAAAGTGGTTAAGGCCACCAGTTTCACTCACCGACCCCAAAGAGCAACATCTTTGCTTTCAACAGGTTGAACTGGACCACTATGTGGGAAGTCATGTCTCGGGAATGCTGGGAGCGACAAAGGGACCTGTACCCATCATACGCATGTTTGGGATCACAGAAGAAGGAAACAGTGTCTGTTGCCATATCCATGGCTTTGCTCCTTACTTCTATGTGCCCTGTCATACTGGTTTCAAGCAGGAGGATTTAAGTGACTTTAAGAAGGAGTTAAATACAGCTGTGATTAAAGACATGCGCTCCAACAAAGACGGCATCTCACAGGCCGTCCTTGCTGTGGACGTCTGCCACAAAGAAAATATGTATGGATACCATGNGGAAGAGGATAATGCCTTTTATGAAGATTACCATGGGCTCTTCCACGTCTCATTGCCCCCGCAAAGCGTCTCCTAGAAACAAGGCTTGCGGGTTTGGGAGGCACCCCATACATTGTTACCAAGCCTATGAAGCAAACATTGATTTTGAAATCAGGGTTATGGTGGACAATGATATCGTTGGGTGTAACTGGATTGAGCTCCCCTGCAGCAAATACCGTGTGGCGGAAAGAATCACAAGAA
  5   1   2      seed Tbd7                                 XL071i20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATTTTGAAATNGGTTTATGGTGGACAATGATATCGTGGGTGTAACTGGATTGAGCTCCCTGCAGGCAAATACCGTGTGCGGAAAGAATCGCAAGATGAAGAACCTTCTAAAGACAATCCCCGCAAGGTGTCCCTTGCTCAGATTGAGGTGGACATCAGCTGGGCTGATCTGATCAGTCACCCTGCAGAAGGGGAATGGCAGAAAATTGCCCCTCAGCGAGTTCTCAGCTTTGATATTGAATGCGCTGGAAGGAAAGGTGTTTTCCCTGAGCCCGACAAGGATCCTGTGATCCAGATTGCAAACATGGTGCTGCGCCAAGGAGAAAAGGATCCATTTATTCGCAACGTGTTCACACTGGGCACTTGTGCAAGCATTGTGGGTTCCCAGGAGCTCTGCTTTGAACGGGAGGATGCACTTCTCAAGGCTTGGGCTGAGTTTGTTCGCATTATCGACCCGGATATTATCACTGGATACAACATTCAGAACTTTGACATGCCGTACCTGATCAACAGGGCCCAAACGCTCAAGGTTTCTACTTTTCCTTTTCTTGGCAGAATCCGATCTCTCAAATCTGTTATCCGAGATTCTTCTTTCCAGTCCAAACAGATGGGCCGACGGGAGAAC
  5   1   2       bld Oo1                             IMAGE:6640166.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAAGGTGTTTTCCCTGAGCCCGACAAGGATCCTGTGATCCAGATTGCAAACATGGTGCTGCGCCAAGGAGAAAAGGATCCATTTATTCGCAACGTGTTCACACTGGGCACTTGTGCAAGCATTGTGGGTTCCCAGGTGCTCTGCTTTGAACGGGAGGATGCACTTCTCAAGGCTTGGGCTGAGTTTGTTCGCATTATCGACCCGGATATTATCACTGGATACAACATTCAGAACTTTGACATGCCGTACCTGATCAACAGGGCCCAAACGCTCAAGGTTTCTACTTTTCCTTTTCTTGGCAGAATCCGATCTCTCAAATCTGTTATCCGAGATTCTTCTTTCCAGTCCAAACAGATGGGCCGACGGGAGAACAAAGTCATTAACACAGAGGGTCGGGTTCAATTCGACTTGTTGCAGGTTCTCCTGCGAGACTATAAGCTCCGTTCTTATACTTTANATGCTGTGAGTTTCCATTTCCTACAAGAACAGAAGGAAGATGTGCAGCACTCCATCATTACTGACTTACAGAATGGCAACGAGCAGACCCGCAGGCGACTGGCTGTTTATTGCCTANAGGGATGCTACCTGCCCCTTCGTCTCCTGNAGAAACTTATGTGCGTCATCAACTACATGGAAATGGCACGTGTGACTGGCGTTCCCCTCAGNTACCTACTGTCTCGTGGCCAGCAGAATAAAAGTGGTGTCTCAGCTTTTTAAGACAGGGCCATGAACANGGACCTGNTTGATGCCCTGTGGGTCAGGTCCAAAAGGGAAGGTGAAAGATTTACACCTGGGGGCCCACCGGTCCAATTGAAACCCCCTGGAAAAGGGGAATTAACCCATGGGGGCCAATTAACCCAACCCTTGGAAATTTTCCCCGGCCCCCTGTGATACCCCCTCCAATTTATTGGATTGGCGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)