Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:3397679-IMAGp.5                 2 PI      93        598      868                Thrombospondin 1 precursor

 This cluster: approximate FL confidence score = 0%

 1012800267 Xl3.1-IMAGE:6880333.3 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6880333.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAAACTGTGGCGGTCTTTGGGTTTTTGGGAGCACCCCAACCTTTGGAAAAGCTTATTTTTGGAAGAAAAACGAAAAGGGGTGTGTCCCCAAGCCATGGACCCAAAATTCCCGGGCCAATTACCTTTGGGGACCAAATGCCAGGGAAACCGGTTACAAAGGCCCCAGCCCATCCCGGAAACAGAATTTAACGTTTGCCCCCCAAAAACCAAAAGGAATTCTCCCATGCCTGGGGGGGGGGCAATTTCCCGGCAAATCAAACTGTGCAATCAACTGTCCGAACTGTTTGCAGAAATGAAAGGCTTACAGACTCTGGTGAAATCTCTCCAGGACCAAGTCACCAAAGAGACAGAGATAAATGAACTTATTTCTAAGCGAATAACAATGATGCCAGGTGCTTGTCTCCACAATGGAGTCTTGCATAAGAATAGAGATGAGTGGACCGTTGACAGCTGCACTGAATGCACATGTCAGAACTCAGCAACTATATGCCGAAAAGTATCTTGCCCTCTGATGCCCTGCACCAATGCCACCATTCCAGATGGAGAATGCTGTCCTAGATGTTGGCCAAGTGACTCAGCGGATGATGATTGGTCTCCATGGTCAGATTGGACACCTTGCTCTGTGACTTGTGGTCATGGCATCCAGCAGAGAGGACGTTCCTGCGACAGCCTTAATAACCCCTGTGAAGGCTCCTCTGTACAGACACGGTCTTGCCATATCCAGGAATGTGACAAGAGATTTAAGCAAGATGGTGGTTGGAGCCATTGGTCACCATGGTCATCATGTTCAGTTACCTGCGGAAGTGGTCAAATCACCAGAATCCGTCTCTGCAACTCTCCTGTTCCTCAGCTGAACGGAAAGCCATGGAAGAGAAAGAACGCCAAGAAGGGACAAGGCGGTACTGGAGGCGGAGATGAGGAGGAGGAAGATTAAGCCTTAAATAAAAGGACTTCCCTTGCCGCGAGGGGGAGTATTGCAAAAAAAAACAAAATAAAAAATAAAAAAA
                                                  Xl3.1-CHK-1012713457                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTGGCGGTCTTTGGGTTTTTGGGAGCACCCCAACCTTTGGAAAAGCTTATTTTTGGAAGAAAAACGAAAAGGGGTGTGTCCCCAAGCCATGGACCCAAAATTCCCGGGCCAATTACCTTTGGGGACCAAATGCCAGGGAAACCGGTTACAAAGGCCCCAGCCCATCCCGGAAACAGAATTTAACGTTTGCCCCCCAAAAACCAAAAGGAATTCTCCCATGCCTGGGGGGGGGGCAATTTCCCGGCAAATCAAACTGTxCxxxxAACTGTCCGAACTGTTTGCAGAAATGAAAGGCTTACAGACTCTGGTGAAATCTCTCCAGGACCAAGTCACCAAAGAGACAGAGATAAATGAACTTATTTCTAAGCGAATAACAATGATGCCAGGTGCTTGTCTCCACAATGGAGTCTTGCATAAGAATAGAGATGAGTGGACCGTTGACAGCTGCACTGAATGCACATGTCAGAACTCAGCAACTATATGCCGAAAAGTATCTTGCCCTCTGATGCCCTGCACCAATGCCACCATTCCAGATGGAGAATGCTGTCCTAGATGTTGGCCAAGTGACTCAGCGGATGATGATTGGTCTCCATGGTCAGATTGGACACCTTGCTCTGTGACTTGTGGTCATGGCATCCAGCAGAGAGGACGTTCCTGCGACAGCCTTAATAACCCCTGTGAAGGCTCCTCTGTACAGACACGGTCTTGCCATATCCAGGAATGTGACAAGAGATTTAAGCAAGATGGTGGTTGGAGCCATTGGTCACCATGGTCATCATGTTCAGTTACCTGCGGAAGTGGTCAAATCACCAGAATCCGTCTCTGCAACTCTCCTGTTCCTCAGCTGAACGGAAAGCCATGGAAGAGAAAGAACGCCAAGAAGGGACAAGGCGGTACTGGAGGCGGAGATGAGGAGGAGGAAGATTAAGCCTTAAATAAAAGGACTTCCCTTGCCGCGAGGGGGAGTATTGCAAAAAAAAACAAAATAAAAAATA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN     188      94                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Dm ---- 2e-015     NP_611293.3 CG5661-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 3e-017     XP_583112.4 PREDICTED: similar to Semaphorin-5A precursor (Semaphorin-F) (Sema F) [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 2e-021     NP_510116.2 ADAMTS family member (162.6 kD) (adt-1) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Xt ---- 2e-024     NP_001011066.1 hypothetical LOC496476 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================
                                                                                                        PREDICTED - Sp ---- 1e-044     XP_001175918.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ci ---- 7e-046     NP_001029015.1 thrombospondin A [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Dr ---- 8e-091     XP_690395.3 PREDICTED: thrombospondin 1 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Hs ---- 3e-096     NP_003237.2 thrombospondin 1 precursor [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PREDICTED - Cf ---- 2e-096     XP_544610.2 PREDICTED: similar to thrombospondin 1 precursor [Canis familiaris] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Bt ---- 3e-097     NP_776621.1 thrombospondin [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PREDICTED - Mm ---- 1e-097     XP_922484.3 PREDICTED: similar to Thrombospondin 1 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Gg ---- 2e-106     XP_421205.2 PREDICTED: similar to precursor polypeptide (AA -31 to 1139) [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Xl ---- 2e-127     NP_001079818.1 hypothetical protein LOC379508 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6880333.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ...
  3   1   1       add Tad1      out                   IMAGE:6880333.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAAACTGTGGCGGTCTTTGGGTTTTTGGGAGCACCCCAACCTTTGGAAAAGCTTATTTTTGGAAGAAAAACGAAAAGGGGTGTGTCCCCAAGCCATGGACCCAAAATTCCCGGGCCAATTACCTTTGGGGACCAAATGCCAGGGAAACCGGTTACAAAGGCCCCAGCCCATCCCGGAAACAGAATTTAACGTTTGCCCCCCAAAAACCAAAAGGAATTCTCCCATGCCTGGGGGGGGGGCAATTTCCCGGCAAATCAAACTGTCCCGAAACTGGTTTGGCAGAAAAATGAAAGGCCTTACAGGACTCTGGGTGAAATCTCTCCCAGGACCAAGTCACCCAAAGAGACCAGAGATAAATGAACTTATTTCTAAGCGAATAACAATGATGCCAGGTGCTTGTCTCCACAATGGAGTCTTGCATAAGAATAGAGATGAGTGGACCGTTGACAGCTGCACTGAATGCACATGTCAGAACTCAGCAACTATATGCCGAAAAGTATCTTGCCCTCTGATGCCCTGCACCAATGCCACCATTCCAGATGGAGAATGCTGTCCTAGATGTTGGCCAAGTGACTCAGCGGATGATGATTGGTCTCCATGGTCAGATTGGACACCTTGCTCTGTGACTTGTGGTCATGGCATCCAGCAGAGAGGACGTTCCTGCGACAGCCTTAATAACCCCTGTGAAGGCTCCTCTGTACAGACACGGTCTTGCCATATCCAGGAATGTGACAAGAGATTTAAGCAAGATGGTGGTTGGAGCCATTGGTCACCATGGTCATCATGTTCAGTTACCTGCGGAAGTGGTCAAATCACCAGAATCCGTCTCTGCAACTCTCCTGTTCCTCAGCTGAACGGAAAGCCATGGAAGAGAAAGAACGCCAAGAAGGGACAAGGCGGTACTGGAGGCGGAGATGAGGAGGAGGAAGATTAAGCCTTAAATAAAAGGACTTCCCTTGCCGCGAGGGGGAGTATTGCAAAAAAAAACAAAATAAAAAATAAAAAAAAAA
  5   1   2       bld Sp1                             IMAGE:4964166.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCATTGTTCGTCTTCGAGTAGCAAAGGGAGGAGTAAAGGACAACTTTCAGGGAGTCCTTCAGAACGTGCGCTTTGTGTTTGGAACCACATTAGAAGCTATTCTGAGAAACAAAGGCTGTCCAAGCATGACAAACTCAGTCATTACTTTGGACAATGCAGTGAACGGCTCAAGCCCAGCCATCCGAACGAATTACGTTGGCCACAAAACAAAGGATCTGCATGCTGTGTGTGGCATTTCCTGCAATCAACTGTCCGAACTGTTTGCAGAAATGAAAGGCTTACAGACTCTGGTGAAATCTCTCCAGGACCAAGTCACCAAAGAGACAGAGATAAATGAACTTATTTCTAAGCGAATAACAATGATGCCAGGTGCTTGTCTCCACAATGGAGTCTTGCATAAGAATAGAGATGAGTGGACCGTTGACAGCTGCACTGAATGCACATGTCAGAACTCAGCAACTATATGCCGAAAAGTATCTTGCCCTCTGATGCCCTGCACCAATGCCACCATTCCAGATGGAGAATGCTGTCCTAGATGTTGGCCAAGTGACTCAGCGGATGATGATTGGTCCTCATGGTCA
  5   1   2      seed Li1                             IMAGE:3396845.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCTGCAATCAACTGTCCGAACTGTTTGCAGAAATGAAAGGCTTACAGACTCTGGTGAAATCTCTCCAGGACCAAGTCACCAAAGAGACAGAGATAAATGAACTTATTTCTAAGCGAATAACAATGATGCCAGGTGCTTGTCTCCACAATGGAGTCTTGCATAAGAATAGAGATGAGTGGACCGTTGACAGCTGCACTGAATGCACATGTCAGAACTCAGCAACTATATGCCGAAAAGTATCTTGCCCTCTGATGCCCTGCACCAATGCCACCATTCCAGATGGAGAATGCTGTCCTAGATGTTGGCCAAGTGACTCAGCGGATGATGATTGGTCTCCATGGTCAGATTGGACACCTTGCTCTGTGACTTGTGGTCATGGCATCCAGCAGAGAGGACGATCATGCGACAGCCTTAATAACCCCTGTGAAAGCTCCTCTGTACAGACACGGGTGTTGCCATATCTCAGAATGTGACAGGAGATTTAACGCAAAAAGGCGGTGGGAGCCATTGGTCGCAATGGTCGATATGCTAAGATACATGCAGAAATGAAGAGATAACACGATCGGCTGTTGCATAGTGATCGAAGCAAGATAACATGCGAGACTATCGACGCGACGGACAGGGACCAGAGCAAGCAAGCATGAGCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)