Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 01 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-PBX0069E08.5                          4 END     1          50       25                hypothetical protein LOC431965 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6640105.5                       5 PI      91        486      756                (no blast hit)

 This cluster: approximate FL confidence score = 49%

 1012800917 Xl3.1-IMAGE:5048938.5 - 2 ESTs
                                                                       ..-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5048938.5                                                                                                                                                                                                                                                                                                               TTCTATTTCTGTTACTGCTTCAGCTGCTGCCACTCTTCACCTCAATCACAAACAAACAAAACAGGGTTCGCTGGTCGGAGGAGTGGGTAGGATACATGGCTGCCAGAGCGTCCCTTCCAGCTTCCGGCCCTGTGTGTTGCTCGCACTGAGCGACTGGCACAACTTTACAGCAGGAACCTGTAAGTACCAGGCTGAGTGGCCGCCTTCCTTTGAGCTGTAGTCTTTGTACAGTTTTTCCCGACGAAGCTAAAAGGCGAAACCTATTACTTGGGTTTTTGTTTACTCACGAATCGCCATTACCTTGCGCCAAGAAATCCCATTGCCATTGTAAGTAAATTAGGAAGCAGAAACATAACTCAAGTGCTTTAACAGAGACAACACTGTTGTGTCATTTACTCTTTGTATTATGGATACAGGCGAGTCCTAATCAACACACACATACTGGTCAAAACAAGTCAACTTCTTTTTAACAAAAATTCCCTTTATTTGGACGAGCCAGCCTGAAAGGATATACAGCAGGAGCTGGACTATGTCACGGTGCTATTCTGGTCTACTATGGGATGTGAGGAAACGCTCTCTTGGATTGGGTGAGCCTGATGTGGTCCGAATCAACTATTTGGGGAGAAGAGAGTTTGTCCAAAGACTTAAATTGGAAGCAACGTTAAATGTACATGATGGCTGCGTAAACTCAATTTCTTGGGGTAGTACAGGCGAATACATTTTATCTGGATCTGATGATACCACTTTGGTTATCAC
                                                  Xl3.1-CHK-1012715586                                                                                                                                                                                                                                                                                                                     TTCTGTTACTGCTTCAGCTGCTGCCACTCTTCACCTCAATCACAAACAAACAAAACAGGGTTCGCTGGTCGGAGGAGTGGGTAGGATACATGGCTGCCAGAGCGTCCCTTCCAGCTTCCGGCCCTGTGTGTTGCTCGCACTGAGCGACTGGCACAACTTTACAGCAGGAACCTGTAAGTACCAGGCTGAGTGGCCGCCTTCCTTTGAGCTGTAGTCTTTGTACAGTTTTTCCCGACGAAGCTAAAAGGCGAAACCTATTACTTGGGTTTTTGTTTACTCACGAATCGCCATTACCTTGCGCCAAGAAATCCCATTGCCATTGTAAGTAAATTAGGAAGCAGAAACATAACTCAAGTGCTTTAACAGAGACAACACTGTTGTGTCATTTACTCTTTGTATTATGGATACAGGCGAGTCCTAATCAACACACACATACTGGTCAAAACAAGTCAACTTCTTTTTAACAAAAATTCCCTTTATTTGGACGAGCCAGCCTGAAAGGATATACAGCAGGAGCTGGACTATGTCACGGTGCTATTCTGGTCTACTATGGGATGTGAGGAAACGCTCTCTTGGATTGGGTGAGCCTGATGTGGTCCGAATCAACTATTTGGGGAGAAGAGAGTTTGTCCAAAGACTTAAATTGGAAGCAACGTTAAATGTACATGATGGCTGCGTAAACTCAATTTCTTGGGGTAGTACAGGCGAATACATTTTATCTGGATCTGATGATACCACTTTGGTTATCACTAACCC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                    1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     529      25                                                                                                                                                                                                                                                                                                               
                                               BLH MIN     529      26                                                                                                                                                                                                                                                                                                               
                                               BLH OVR     529     109                                                                                                                                                                                                                                                                                                               
                                                                       PROTEIN --- Dm ---- 6e-008     NP_647657.1 CG8001-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Gg ---- 1e-016     XP_001231356.1 PREDICTED: similar to MSTP055, partial [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Cf ---- 3e-026     XP_862672.1 PREDICTED: similar to IQ motif and WD repeats 1 isoform a isoform 5 [Canis familiaris] =====================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Mm ---- 3e-026     XP_981532.2 PREDICTED: IQ motif and WD repeats 1 [Mus musculus] ========================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Bt ---- 2e-026     XP_001254045.1 PREDICTED: similar to IQ motif and WD repeats 1 isoform 2 [Bos taurus] ==================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Hs ---= 1e-026     NP_001017977.1 IQ motif and WD repeats 1 isoform b [Homo sapiens] ======================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Dr ==== 9e-027     XP_692923.3 PREDICTED: novel protein similar to vertebrate Q motif and WD repeats 1 (IQWD1) [Danio rerio] =====================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xt ==== 2e-036     NP_001073033.1 novel protein similar to IQ motif and WD repeats 1 (IQWD1) [Xenopus tropicalis] ===================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Xl ==== 3e-038     NP_001098734.1 hypothetical protein LOC445867 [Xenopus laevis] ===================================================================================================================================
                                                 Xl3.1-IMAGE:5048938.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAG---------------------------TAA------------------------------------------------------------------------------TAA------TAG------------TAA---------------------------------------------------ATG---------------TAA------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                             ...
  5   1   2       bld Emb4                            IMAGE:4680393.5p                                                                                                                                                                                                                                                                                                               TTCTATTTCTGTTACTGCTTCAGCTGCTGCCACTCTTCACCTCAATCACAAACAAACAAAACAGGGTTCGCTGGTCGGAGGAGTGGGTAGGATACATGGCTGCCAGAGCGTCCCTTCCAGCTTCCGGCCCTGTGTGTTGCTCGCACTGAGCGACTGGCACAACTTTACAGCAGGAACCTGTAAGTACCAGGCTGAGTGGCCGCCTTCCTTTGAGCTGTAGTCTTTGTACAGTTTTTCCCGACGAAGCTAAAAGGCGAAACCTATTACTTGGGTTTTTGTTTACTCACGAATCGCCATTACCTTGCGCCAAGAAATCCCATTGCCATTGTAAGTAAATTAGGAAGCAGAAACATAACTCAAGTGCTTTAACAGAGACAACACTGTTGTGTCATTTACTCTTTGTATTATGGATACAGGCGAGTCCTAATCAACACACACATACTGGTCAAAACAAGTCAACTTCTTTTTAACAAAAATT
  5   1   2      seed Ov1       out                   IMAGE:5048938.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATATCGTCGACCCACGCGTCCGCTTTGAGCTGTAGTCTTTGTACAGTTTTTCCCGACGAAGCTAAAAGGCGAAACCAAGCACTTGGGTTTTTGTTTACTCACGAATCGCCATTACCTTGCGCCAAGAAATCCCATTGCCATTGTAAGTAAATTAGGAAGCAGAAACATAACTCAAGTGCTTTAACAGAGACAACACTGTTGTGTCATTTACTCTTTGTATTATGGATACAGGCGAGTCCTAATCAACACACACATACTGGTCAAAACAAGTCAACTTCTTTTTAACAAAAATTCCCTTTATTTGGACGAGCCAGCCTGAAAGGATATACAGCAGGAGCTGGACTATGTCACGGTGCTATTCTGGTCTACTATGGGATGTGAGGAAACGCTCTCTTGGATTGGGTGAGCCTGATGTGGTCCGAATCAACTATTTGGGGAGAAGAGAGTTTGTCCAAAGACTTAAATTGGAAGCAACGTTAAATGTACATGATGGCTGCGTAAACTCAATTTCTTGGGGTAGTACAGGCGAATACATTTTATCTGGATCTGATGATACCACTTTGGTTATCACTAACCCCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)