Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL043i05.3                            7 END     1          25       14                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:7979434.5                       7 PI      78        840     1156                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012801046 Xl3.1-IMAGE:8531452.5 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8531452.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCTGGTCCGGTCCGGATTCCTTGCATCGCCCGAATACTGGTCACCACGTGAGAGATGAAGGAGATCTGTGTAGGTTGGACTGGATGCGGCAACAGGAGTCTCCGTGCAGAACAAGCCGTCAAGATTCATATCAACTTCCAAAACCCTCGCGGGGAGATTCGCACGAAGACTACGAGACGTCCCAGAAGGACCAGGGCTACTTGGATTTCGAGCACTGGGAGTCGCGGGAATATCAGCCTGACAAATACGACCCCGAGTCCAGCGCGAGTTCCAGCGAGTGTCACCTGAGCGACGGCAGCCTCAGTCCTACCAGGATATACGGGGACCCCTCGACGGCCCTGCCCCTGCACCCCACAAAGAGACCCGCCTCCAACCCTCCTCCTATCAGCAACCAGGCAACTAAAGGTAAACGGCCAAAGAAGGGCATGGCGACGGCTAAGCAACGACTCGGGAAAATCCTGAAGCTCAACCGCACCGGCCACACCCGCTTCTTTGTCTGACGCCAAGACGCCACTTACCCTTTAATCCTGCGCATAACAGTATTGGGGCGACCCGAGGCCCGTCACCCAATAAGCACTGCCGCAAGAACAAAGATGTCCGCTCTTACACTCACGCCCACTCAGCAATAACCACAGAACGATCACGCCTGGACTTTTCGGGGGGTCGGCGACCCATTAACAGACGACACTGTTCCTTTTTTATCATTTGCATTTTGGATGGTTCGATAAACAAGGAGCCAAGGGGTTAGGGTCGATGGTCTTCAATAATTTATTTCTAAATAATTTTTTCCCATTTCTAAAAAAAAACATAAAAAATATTTATTTCAAAGACGCTCTGATTTTTTTGTTTGGATTTTAAGCAATGTGAAGGTTTTTATTTGACTTTGATGGGGTTTAATTGTTATTTGCGAGGTGTGCGGCGAAACCACTGGGGAGAAGGACAAGGGGGGGGTTTCATTTTAACCTCGATATTCAGGTTGGTTTCTTAAACAGGGATTTTTTTTGTAATTATTTTTAAATTAATATGAAATCCATATTTTTATTTTTGCTATCAATGTTTTCTTTTGTTTTCTGTGCTGATTTTAATCAATAAGCTGTCGGCTCAGGGGCAGCCGGGTGTCAGTCAACACTGTATTCTGTTTTATTATGGGGAGGGGGCGGGGT
                                                  Xl3.1-CHK-1012706662                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCGGTCCGGATTCCTTGCATCGCCCGAATACTGGTCACCACGTGAGAGATGAAGGAGATCTGTGTAGGTTGGACTGGATGCGGCAACAGGAGTCTCCGTGCAGAACAAGCCGTCAAGATTCATATCAACTTCCAAAACCCTCGCGGGGAGATTCGCACGAAGACTACGAGACGTCCCAGAAGGACCAGGGCTACTTGGATTTCGAGCACTGGGAGTCGCGGGAATATCAGCCTGACAAATACGACCCCGAGTCCAGCGCGAGTTCCAGCGAGTGTCACCTGAGCGACGGCAGCCTCAGTCCTACCAGGATATACGGGGACCCCTCGACGGCCCTGCCCCTGCACCCCACAAAGAGACCCGCCTCCAACCCTCCTCCTATCAGCAACCAGGCAACTAAAGGTAAACGGCCAAAGAAGGGCATGGCGACGGCTAAGCAACGACTCGGGAAAATCCTGAAGCTCAACCGCACCGGCCACACCCGCTTCTTTGTCTGACGCCAAGACGCCACTTACCCTTTAATCCTGCGCATAACAGTATTGGGGCGACCCGAGGCCCGTCACCCAATAAGCACTGCCGCAAGAACAAAGATGTCCGCTCTTACACTCACGCCCACTCAGCAATAACCACAGAACGATCACGCCTGGACTTTTCGGGGGGTCGGCGACCCATTAACAGACGACACTGTTCCTTTTTTATCATTTGCATTTTGGATGGTTCGATAAACAAGGAGCCAAGGGGTTAGGGTCGATGGTCTTCAATAATTTATTTCTAAATAATTTTTTCCCATTTCTAAAAAAAAACATAAAAAATATTTATTTCAAAGACGCTCTGATTTTTTTGTTTGGATTTTAAGCAATGTGAAGGTTTTTATTTGACTTTGATGGGGTTTAATTGTTATTTGCGAGGTGTGCGGCGAAACCACTGGGGAGAAGGACAAGGGGGGGGTTTCATTTTAACCTCGATATTCAGGTTGGTTTCTTAAACAGGGATTTTTTTTGTAATTATTTTTAAATTAATATGAAATCCATATTTTTATTTTTGCTATCAATGTTTTCTTTTGTTTTCTGTGCTGATTTTAATCAATAAGCTGTCGGCTCAGGGGCAGCCGGGTGTCAGTCAACACTGTATTCTGTTTTATTATGGGGAGGGGG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     2     4     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN      33      31                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PREDICTED - ?? ---- 4e-008     XP_617909.4 PREDICTED: similar to PHD finger protein 2 [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Dr ---- 1e-021     XP_001922089.1 PREDICTED: im:7141664 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 3e-033     NP_001028602.2 jumonji C domain-containing histone demethylase 1 homolog D [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 4e-034     XP_539885.2 PREDICTED: similar to PHD finger protein 8 [Canis familiaris] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bt ---- 1e-034     XP_599768.3 PREDICTED: similar to KIAA1718 protein [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-034     NP_085150.1 jumonji C domain-containing histone demethylase 1 homolog D [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 5e-036     XP_416344.2 PREDICTED: similar to KIAA1718 protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 2e-064     NP_001072664.1 jumonji C domain containing histone demethylase 1 homolog D [Xenopus (Silurana) tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8531452.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------ATG------------------------------TAA---------------------------------------------------------------------------------------ATG------TAA------------------------------------TAA------------TAA------------------------------------------------------------------------------------------------TGA---TGA------------------------------------------------------------------------TAA------------------------------------------TAA------------TAA------------------------------------------------------TGA---TAA------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   1       add Oo1                             IMAGE:6861007.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCTGGTCCGGTCCGGATTCCTTGCATCGCCCGAATACTGGTCACCACGTGAGAGATGAAGGAGATCTGTGTAGGTTGGACTGGATGCGGCAACAGGAGTCTCCGTGCAGAACAAGCCGTCAAGATTCATATCAACTTCCAAAACCCTCGCGGGGAGATTCGCACGAAGACTACGAGACGTCCCAGAAGGACCAGGGCTACTTGGATTTCGAGCACTGGGAGTCGCGGGAATATCAGCCTGACAAATACGACCCCGAGTCCAGCGCGAGTTCCAGCGAGTGTCACCTGAGCGACGGCAGCCTCAGTCCTACCAGGATATACGGGGACCCCTCGACGGCCCTGCCCCTGCACCCCACAAAGAGACCCGCCTCCAACCCTCCTCCTATCAGCAACCAGGCAACTAAAGGTAAACGGCCAAAGAAGGGCATGGCGACGGCTAAGCAACGACTCGGGAAAATCCTGAAGCTCAACCGCACCGGCCACACCCGCTTCTTTGTCTGACGCCAAGACGCCACTTACCCTTTAATCCTGCGCATAACAGTATTGGGGCGACCCGAGGCCCGTCACCCAATAAGCACTGCCGCAAGAACAAAGATGTCCGCTCTTACACTCACGCCCACTCAGCAATAACCACAGAACGATCACGCCTGGACTTTTCGGGGGGTCGGCGACCCATTAACAGACGACACTGTTCCTTTTTTATCATTTGCATTTTTGGATGGTTCGATAAACAAGGAGCCAAGGGCTTGGGGGTCGATGGTCTTTCAATATTTATTTTCTAANTAATTTTTTTCCCATTTCTaaaaaaaaacataaaaaaatattttatttcaaaagacgcctcctgattttttttggtttggaatttttagccaatgtggaagggtttttaatttggacttttgatgggggtttAATTTGGTTA
  5   1   1       add Lmb1                            IMAGE:8531452.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAAANGNNCCATAGCTNNGNGGAGGTACTATATCTATTCGTCCCGCGGGGAGATTCGCACGAAGACTACGAGACGTCCCAGAAGGACCAGGGCTACTTGGATTTCGAGCGCTGGGAGTCGCGGGAATATCAGCCTGACAAATACGACCCCGAGTCCAGCGCGAGTTCCAGCGAGTGTCACCTGAGCGACGGCAGCCTCAGTCCTACCAGGATATACGGGGACCCCTCGACGGCCCTGCCCCTGCACCCCACAAAGAGACCCGCCTCCAACCCTCCTCCTATCAGCAACCAGGCAACTAAAGGTAAACGGCCAAAGAAGGGCATGGCGACGGCTAAGCAACGACTCGGGAAAATCCTGAAGCTCAACCGCACCGGCCACACCCGCTTCTTTGTCTGACGCCAAGACGCCACTTACCCTTTAATCCTGCGCATAACAGTATTGGGGCGACCCGAGGCCCGTCACCCAATAAGCACTGCCGCAAGAACAAAGATGTTCGCTCTTACACTGTGCCACGCCCACTCAGCAATAACCACAGAACGATCACGCCTGGACTTTTCGGGGGGTCGGCGACCCATTAACAGACGACACGGTTCCTTTTTTATCATTTGCATTTTGGATGGTTCGATAAACAAGGAGCCAAGGGCTTGGGGTCGATGGTCTTCAATAATTTATTTCTAAATAATTTTTTCCCATTTCTaaaaaaaaacataaaaaaTATTTATTTCAAAGACGCTCTGATTTTTTTGTTTGGGATTTAANGCATGTGAAAGGTTT
  5   1   2      seed Tbd7      out                        XL064h11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGGCTAAGCAACGACTCGGGAAAATCCTGAAGCTCAACCGCACCGGCCACACCCGCTTCTTTGTCTGACGCCAAGACGCCACTTACCCTTTAATCCTGCGCATAACAGTATTGGGGCGACCCGAGGCCCGTCACCCAATAAGCACTGCCGCAAGAACAAAGATGTCCGCTCTTACACTCACGCCCACTCAGCAATAACCACAGAACGATCACGCCTGGACTTTTCGGGGGGTCGGCGACCCATTAACAGACGACACTGTTCCTTTTTTATCATTTGCATTTTGGATGGTTCGATAAACAAGGAGCCAAGGGGTTAGGGTCGATGGTCTTCAATAATTTATTTCTAAATAATTTTTTCCCATTTCTaaaaaaaaacaaaaaaaatatttatttcaaagacgctctgatttttttgtttggattttAAGCAATGTGAAGGTTTTTATTTGACTTTGATGGGGTTTAATTGTTATTTGCGAGGTGTGCGGCGAAACCACTGGGGAGAAGGACAAggggggggTTTCATTTTAACCTCGATATTCAGGTTGGTTTCTTAAACAGGgatttttttgtaattatttttaaattaatatgaaatccatatttttatttttGCTAT
  5   1   2       bld Gas8                            IMAGE:3516810.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTCTaaaaaaaaacataaaaaatatttatttcaaagacgctctgatttttttgtttggattttAAGCAATGTGAAGGTTTTTATTTGACTTTGATGGGGTTTAATTGTTATTTGCGAGGTGTGCGGCGAAACCACTGGGGAGAAGGACAAggggggggTTTCATTTTAACCTCGATATTCAGGTTGGTTTCTTAAACAGGGAttttttttgtaattatttttaaattaatatgaaatccatatttttatttttgctatcaatgttttcttttgttttCTGTGCTGATTTTAATCAATAAGCTGTCGGCTCAGGGGCAGCCGGGTGTCAGTCAACACTGTATTCTGTTTTATTATGGGGAGGGGGCGGGGTTTAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)