Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:4033069.5.5                    51 PI      98          1      108                (no blast hit)
     2   0.0    0Xl3.1-XL482m01ex.5                          4 PI      99          1      108                PREDICTED: hypothetical protein [Gallus gallus]
     3   0.0    0Xl3.1-IMAGE:8821312.5                       3 PI      90        107      488                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012801098 Xl3.1-IMAGE:7201995.5 - 2 ESTs
                                                                       ..-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7201995.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCACCAGGCAGTGCATTCCACAACCTCACTGTCCTGACTGTGAAGAACCCCCTACGTTGCTTCAAATGAAAGTTCTTTTCTTCTAGTCTAAAGGGGTGGCCTCTGGTGGAAGGTATCTTGGTGCAGAACCAGCAGTTTGGAGAGAGTGTCTCGGAGCCTGGCAGTACTTTTGTTGATGCTGAATTTGATGGCATACTTGGCCTGGGATATCCTTCTATTGCAGTAGGGGACTGCACACCTGTATTTGATAACATGATAGCTCAGAACTTGGTGGAATTGCCAATGTTTTCCGTCTATATGAGCAGAAATCCAAATTCGGCAGTAGGGGGGGAACTGGTGTTTGGGGGGTTTGATGCATCTCGCTTCTCTGGCCAGTTAAATTGGGTGCCTGTCACTAACCAAGGCTACTGGCAGATACAGCTGGATAATGTCCAAATAAATGGTGAGGTGTTATTCTGCAGTGGTGGATGTCAGGCTATTGTTGACACAGGCACATCCTTGATTACCGGTCCTTCTTCTGACATTGTTCAGCTTCAAAACATAATTGGAGCATCTGCTGCAAATGGAGATTATGAAGTGGATTGCAGTGTTTTAAATGAAATGCCAACCGTCACTTTTACTATAAATGGAATTGGGTACCAGATGACACCACAACAATATACTCTACAGGATGGTGGTGGTGTATGCAGCAGTGGCTTCCAAGGTCTCGATATTCCTCCCCCTGCTGGACCTCTCTGGATCCTGGGAGATGTTTTTATTGGCCAATATTACTCTGTATTTGATAGGGGTAATAATAGAGTTGGGCTTGCCCCAGTAGTACCTTACCCACCTCTAAAAAATGGTGTGTAATTGACTCAATAGGACTTTACAAACTTACATCTGAAGATAATTTTATTATCGAACTCTGTGTAATACACCATCATTTTGCATTTGTCAAATACCTCTGTTTTGCCTCTAACGGATACATTACACAAGGTACTATTACAGATTTGTAACTTTACATATGACATGAGCCTTGGGAAGTGCAAGTAACACCTCTACATCTGAAAAAAGCATTTCAAATTTCCTAAATCTAGGATATGCACACTTTTGCTTCTATAACGTCTAATTGTTACAACTTGCAGTTCAATATAATCATATGCTATTTGTCTTTTAACTGTTGTATTTAGAAAAATACCAATAAAACG
                                                  Xl3.1-CHK-1012716492                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGCAGTGCATTCCACAACCTCACTGTCCTGACTGTGAAGAACCCCCTACGTTGCTTCAAATGAAAGTTCTTTTCTTCTAGTCTAAAGGGGTGGCCTCTGGTGGAAGGTATCTTGGTGCAGAACCAGCAGTTTGGAGAGAGTGTCTCGGAGCCTGGCAGTACTTTTGTTGATGCTGAATTTGATGGCATACTTGGCCTGGGATATCCTTCTATTGCAGTAGGGGACTGCACACCTGTATTTGATAACATGATAGCTCAGAACTTGGTGGAATTGCCAATGTTTTCCGTCTATATGAGCAGAAATCCAAATTCGGCAGTAGGGGGGGAACTGGTGTTTGGGGGGTTTGATGCATCTCGCTTCTCTGGCCAGTTAAATTGGGTGCCTGTCACTAACCAAGGCTACTGGCAGATACAGCTGGATAATGTCCAAATAAATGGTGAGGTGTTATTCTGCAGTGGTGGATGTCAGGCTATTGTTGACACAGGCACATCCTTGATTACCGGTCCTTCTTCTGACATTGTTCAGCTTCAAAACATAATTGGAGCATCTGCTGCAAATGGAGATTATGAAGTGGATTGCAGTGTTTTAAATGAAATGCCAACCGTCACTTTTACTATAAATGGAATTGGGTACCAGATGACACCACAACAATATACTCTACAGGATGGTGGTGGTGTATGCAGCAGTGGCTTCCAAGGTCTCGATATTCCTCCCCCTGCTGGACCTCTCTGGATCCTGGGAGATGTTTTTATTGGCCAATATTACTCTGTATTTGATAGGGGTAATAATAGAGTTGGGCTTGCCCCAGTAGTACCTTACCCACCTCTAAAAAATGGTGTGTAATTGACTCAATAGGACTTTACAAACTTACATCTGAAGATAATTTTATTATCGAACTCTGTGTAATACACCATCATTTTGCATTTGTCAAATACCTCTGTTTTGCCTCTAACGGATACATTACACAAGGTACTATTACAGATTTGTAACTTTACATATGACATGAGCCTTGGGAAGTGCAAGTAACACCTCTACATCTGAAAAAAGCATTTCAAATTTCCTAAATCTAGGATATGCACACTTTTGCTTCTATAACGTCTAATTGTTACAACTTGCAGTTCAATATAATCATATGCTATTTGTCTTTTAACTGTTGTATTTAGAAAAATACCAATAAAACGGCAATT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                          1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN      37     115                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sp ---- 1e-012     XP_001182455.1 PREDICTED: similar to Ctsd protein, partial [Strongylocentrotus purpuratus] =====================================
                                                                                                                                                                                               PROTEIN --- Dm ---- 7e-063     NP_652013.1 CG1548-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                PROTEIN --- Ce ---- 2e-063     NP_510191.1 aspartic protease (49.3 kD) (asp-4) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- Ag ---- 3e-066     XP_307784.1 ENSANGP00000013568 [Anopheles gambiae str. PEST] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                   PREDICTED - ?? ---- 9e-068     XP_609913.4 PREDICTED: cathepsin D isoform 1 [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                      PROTEIN --- Dr ---- 7e-070     NP_571785.1 cathepsin D [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                             PROTEIN --- Bt ---- 1e-070     NP_001001600.1 pepsinogen A [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                    PROTEIN --- Mm ---- 7e-095     NP_031825.2 cathepsin E preproprotein [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 3e-098     XP_545694.2 PREDICTED: similar to cathepsin E isoform a preproprotein [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                    PREDICTED - Gg ---- 3e-099     XP_001235024.1 PREDICTED: similar to cathepsin E [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                      PROTEIN --- Hs ---- 3e-102     NP_001901.1 cathepsin E isoform a preproprotein [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PREDICTED - Xt ---- 4e-139     NP_001120469.1 hypothetical protein LOC100145572 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN --- Xl ---- 2e-144     NP_001079043.1 cathepsin E1 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7201995.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------TAG------------------------------------------------TAA------------------------------------------------------------------------------------------------ATG------------------TAA------------TGA---------------------------------------------------TAA------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   2      seed Te2N      in                    IMAGE:7201995.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCACCAGGCAGTGCATTCCACAACCTCACTGTCCTGACTGTGAAGAACCCCCTACGTTGCTTCAAATGAAAGTTCTTTTCTTCTAGTCTAAAGGGGTGGCCTCTGGTGGAAGGTATCTTGGTGCAGAACCAGCAGTTTGGAGAGAGTGTCTCGGAGCCTGGCAGTACTTTTGTTGATGCTGAATTTGATGGCATACTTGGCCTGGGATATCCTTCTATTGCAGTAGGGGACTGCACACCTGTATTTGATAACATGATAGCTCAGAACTTGGTGGAATTGCCAATGTTTTCCGTCTATATGAGCAGAAATCCAAATTCGGCAGTAGGGGGGGAACTGGTGTTTGGGGGGTTTGATGCATCTCGCTTCTCTGGCCAGTTAAATTGGGTGCCTGTCACTAACCAAGGCTACTGGCAGATACAGCTGGATAATGTCCAAATAAATGGTGAGGTGTTATTCTGCAGTGGTGGATGTCAGGCTATTGTTGACACAGGCACATCCTTGATTACCGGTCCTTCTTCTGACATTGTTCAGCTTCAAAACATAATTGGAGCATCTGCTGCAAATGGAGATTATGAAGTGGATTGCAGTGTTTTAAATGAAATGCCAACCGTCACTTTTACTATAAATGGAATTGGGTACCAGATGACACCACAACAATATACTCTACAGGATGGTGGTGGTGTATGCAGCAGTGGCTTCCAAGGTCTCGATATTCCTCCCCCTGCTGGACCTCTCTGGATCCTGGGAGATGTTTTTATTTGGCAATATTACTC
  3   1   2       bld Te2N      in                    IMAGE:7201995.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGTGGATGTCAGGCTATTGTTGACACAGGCACATCCTTGATTACCGGTCCTTCTTCTGACATTGTTCAGCTTCAAAACATAATTGGAGCATCTGCTGCAAATGGAGATTATGAAGTGGATTGCAGTGTTTTAAATGAAATGCCAACCGTCACTTTTACTATAAATGGAATTGGGTACCAGATGACACCACAACAATATACTCTACAGGATGGTGGTGGTGTATGCAGCAGTGGCTTCCAAGGTCTCGATATTCCTCCCCCTGCTGGACCTCTCTGGATCCTGGGAGATGTTTTTATTGGCCAATATTACTCTGTATTTGATAGGGGTAATAATAGAGTTGGGCTTGCCCCAGTAGTACCTTACCCACCTCTAAAAAATGGTGTGTAATTGACTCAATAGGACTTTACAAACTTACATCTGAAGATAATTTTATTATCGAACTCTGTGTAATACACCATCATTTTGCATTTGTCAAATACCTCTGTTTTGCCTCTAACGGATACATTACACAAGGTACTATTACAGATTTGTAACTTTACATATGACATGAGCCTTGGGAAGTGCAAGTAACACCTCTACATCTGAAAAAAGCATTTCAAATTTCCTAAATCTAGGATATGCACACTTTTGCTTCTATAACGTCTAATTGTTACAACTTGCAGTTCAATATAATCATATGCTATTTGTCTTTTAACTGTTGTATTTAGAAAAATACCAATAAAACGGCAATTGGTGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)