Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:4057931-IMAGp.5                 3 PI      94         78      870                hypothetical protein LOC100125069 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 78%

 1012801105 Xl3.1-IMAGE:7020087.5 - 2 ESTs
                                                                       ..-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7020087.5             GTCCGGAATTCCNCGGGATGCACCATGAGCACCAGTATCCGCTACAAGAGCAAGCTGCTGAAAACAGATGAGAAGGAGGACCAAGAGAAGCAGTATGTTGGGTTTGCTACTCTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGCTTTGACTTCACACTCATGGTGGCTGGGGAGTCGGGCCTCGGAAAGTCTACCTTGGTGAATAGTCTGTTTCTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAGACAGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTGAAACTGAAATTAACCATAGTGGACACGCCTGGCTTTGGGGATGCTGTCAATAACAATGAAAGCTGGAAGCCCATCACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGTCTGAACAGGAAGAACATTCAGGATAACAGAGTGCACTGCTGCCTGTACTTCATCTCACCTTTTGGACATGGGCTGCGACCAGTGGATGTCGCTGTCATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTTTGATCGCTAAGGCTGACTGCCTGATTCCTAGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGAGAAATTTGGAATTAAGGTTTATCAGTTCCCAGAATGTGACTCTGATGAGGATGATGACTTTTAACAACAAGACAGAGAATTGAAGGAAAGTGCACCCTTTTGCAGTCATTGGCAGCAACACTGTGGTAGAGGCCAAAAGGCAAAGAGTGAGAAGGTCGTCTGTACCCTTGGGGGCATTGTAGAAGTTGGAGGAACAAGGCACATTGTGGACTTTTGTTGAAGTTGAAGAAAT
                                                  Xl3.1-CHK-1012717984                   AATTCCNCGGGATGCACCATGAGCACCAGTATCCGCTACAAGAGCAAGCTGCTGAAAACAGATGAGAAGGAGGACCAAGAGAAGCAGTATGTTGGGTTTGCTACTCTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGCTTTGACTTCACACTCATGGTGGCTGGGGAGTCGGGCCTCGGAAAGTCTACCTTGGTGAATAGTCTGTTTCTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAGACAGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTGAAACTGAAATTAACCATAGTGGACACGCCTGGCTTTGGGGATGCTGTCAATAACAATGAAAGCTGGAAGCCCATCACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGTCTGAACAGGAAGAACATTCAGGATAACAGAGTGCACTGCTGCCTGTACTTCATCTCACCTTTTGGACATGGGCTGCGACCAGTGGATGTCGCTGTCATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTTTGATCGCTAAGGCTGACTGCCTGATTCCTAGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGAGAAATTTGGAATTAAGGTTTATCAGTTCCCAGAATGTGACTCTGATGAGGATGATGACTTTTAACAACAAGACAGAGAATTGAAGGAAAGTGCACCCTTTTGCAGTCATTGGCAGCAACACTGTGGTAGAGGCCAAAAGGCAAAGAGTGAGAAGGTCGTCTGTACCCTTGGGGGCATTGTAGAAGTTGGAGGAACAAGGCACATTGTGGACTTTTGTTGAAGTTGA
                                                      consensus depths                  1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG      24     213             
                                               BLH MIN      21     138             
                                               BLH MPR      -3     138             
                                                                                            PROTEIN --- Ce ==== 1e-056     NP_493388.1 UNCoordinated locomotion UNC-59, septin (52.9 kD) (unc-59) [Caenorhabditiselegans] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Sp ==== 2e-066     XP_792592.2 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PROTEIN --- Ag ---- 3e-087     XP_311306.4 AGAP000768-PA [Anopheles gambiae str. PEST] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                            PROTEIN --- Dm ---- 7e-094     NP_996489.1 CG9699-PG, isoform G [Drosophila melanogaster] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                PREDICTED - Cf ---- 3e-121     XP_543545.2 PREDICTED: similar to Sept5 [Canis familiaris] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN === Dr ==== 6e-122     NP_956282.1 Unknown (protein for MGC:73218) [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN === Bt ==== 3e-127     NP_001069839.1 septin 5 [Bos taurus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN === Hs ==== 8e-128     NP_002679.2 peanut-like 1; septin HCDCREL-1 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN === Mm ==== 4e-128     NP_998779.2 septin 5 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN === Gg ==== 2e-129     NP_001025825.1 septin 5 [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PREDICTED = Xt ==== 6e-137     NP_001096453.1 hypothetical protein LOC100125069 [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN === Xl ==== 2e-138     NP_001090512.1 septin 1 [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7020087.5                                     ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------TGA---TGA
                                                                   ORF                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2      seed Eye1 5x3                        IMAGE:7020087.5p GCTGGTTNNCCGGTCCGGAATTCCNCGGGATGCACCATGAGCACCAGTATCCGCTACAAGAGCAAGCTGCTGAAAACAGATGAGAAGGAGGACCAAGAGAAGCAGTATGTTGGGTTTGCTACTCTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGCTTTGACTTCACACTCATGGTGGCTGGGGAGTCGGGCCTCGGAAAGTCTACCTTGGTGAATAGTCTGTTTCTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAGACAGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTGAAACTGAAATTAACCATAGTGGACACGCCTGGCTTTGGGGATGCTGTCAATAACAATGAAAGCTGGAAGCCCATCACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGTCTGAACAGGAAGAACATTCAGGATAACAGAGTGCACTGCTGCCTGTACTTCATCTCACCTTTTGGACATGGGCTGCGACCAGTGGATGTCGCTGTCATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTTTGATCGCTAAGGCTGACTGCCTGATTCCTAGCGAGATCCGCAAGCTCAAGGACCGGATTANGGAGGAGATAGAGAAATTTGGAATTAAGGTTTATCAGTTCCCAGAATGTGACTCTGATGAGGATGATGACTTTTAACAACAAGACAGAGAATTGAAGGAAAGTGCACCCTTTTGCAGTCATTGGCAGCAACACTGTGGTAGAGGCCAAAAGGCAAAGAGTGAGAAGGTCGTCTGTACCCTTGGGGGCATTGTAGAAGTTGGAGGAACAAGGCACATTGTGGACTTTTGTTGAAGTTGAAGAAATATG
  5   1   2       bld Sp1                             IMAGE:4174228.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCATCttttttttAGGCTGCGACCAGTGGATGTCGCTGTCATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTTTGATCGCTAAGGCTGACTGCCTGATTCCTAGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGAGAAATTTGGAATTAAGGTTTATCAGTTCCCAGAATGTGACTCTGATGAGGATGATGACTTTAAACAACAAGACAGAGAATGAAGGANAGTGCACCTTTTGCAGTCATTGGCAGCAACACTGTGGTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)