Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 13%

 1012801135 Xl3.1-IMAGE:8328381.3 - 2 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8328381.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCTGGTGAAGGGAGCTAGAAGTGGAGGCGCGCGCCCATTGGAGTTTAGTCACGGCAGTGCGCTGCATGCTGGGAAAGCTTGAGCTTGTGCTGAACTGTAACTCTCACACCCAGTCACATAACCGGGCCCTAATGGCAGCTGATGATGCTCAGACTGTCCGTCGCCGGGGGGACGAACCCAAATCGAGGGGCCACAAGGAGAAGGGCCACAGTAAAGCTGAACCCCCTAAACTGAACAGCAACAGCCTAGTCAGGGATGAGACCATATCTTCCACCTGCCCCCCTGCTGAGGATCCTCCCAGGAGGAAGAAGCACCGACTGGAGAAGGCAGGAAAGGCCAAGTCTGCCGACAGTTCAAAGAAAATCAAATCTCCCGACCCCAAAACAGAAAGTGATACAGAGGAGCCTCTGCCCAAACACACAAAGGCAGAAAATACCTTCACAGAAAAGCTGCTGCAGGACAGTGTGATTAGCAGTGCCCCAGACAATGGGATGTATAAATCAGTGGAACCAAGTGACGTCCGTAAGGAGATGGCTTCCGAAGTCACCACACGATTGGATGAGAACAGCAACATCACTGCAATGGAGTGCAATGGGGAAGTTGCACTGTACAGGAAGGATGAGGGGGTGGAACCCCAATTCCAAACCAGTAAAAAGGAACCCAGTGAGGAAAGTTCTAGTGATGAATTTCAGGTTGGAGAAGAGAAACACATAGATGGTCAAAGGAATCAAGTCTTTCTATCTGCCAGCTCCCAAGGAGAGTTCAGTGGGATATCTAACTCTGCAGATATTGGGGTGAAGGTGGACCCCCCCTTCAGTAAAGATAACATAACTATACAGGAACATGAATGGGCAAAACCAGAGAAGGAGACAGACCGCCATAACAAAGCCAAAAAGGAGGAAGCTGATAGGTTGGAGAGGAAAAAGGAGCGTGCAGAGAAAAAGGGG
                                                  Xl3.1-CHK-1012718210                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAAGGGAGCTAGAAGTGGAGGCGCGCGCCCATTGGAGTTTAGTCACGGCAGTGCGCTGCATGCTGGGAAAGCTTGAGCTTGTGCTGAACTGTAACTCTCACACCCAGTCACATAACCGGGCCCTAATGGCAGCTGATGATGCTCAGACTGTCCGTCGCCGGGGGGACGAACCCAAATCGAGGGGCCACAAGGAGAAGGGCCACAGTAAAGCTGAACCCCCTAAACTGAACAGCAACAGCCTAGTCAGGGATGAGACCATATCTTCCACCTGCCCCCCTGCTGAGGATCCTCCCAGGAGGAAGAAGCACCGACTGGAGAAGGCAGGAAAGGCCAAGTCTGCCGACAGTTCAAAGAAAATCAAATCTCCCGACCCCAAAACAGAAAGTGATACAGAGGAGCCTCTGCCCAAACACACAAAGGCAGAAAATACCTTCACAGAAAAGCTGCTGCAGGACAGTGTGATTAGCAGTGCCCCAGACAATGGGATGTATAAATCAGTGGAACCAAGTGACGTCCGTAAGGAGATGGCTTCCGAAGTCACCACACGATTGGATGAGAACAGCAACATCACTGCAATGGAGTGCAATGGGGAAGTTGCACTGTACAGGAAGGATGAGGGGGTGGAACCCCAATTCCAAACCAGTAAAAAGGAACCCAGTGAGGAAAGTTCTAGTGATGAATTTCAGGTTGGAGAAGAGAAACACATAGATGGTCAAAGGAATCAAGTCTTTCTATCTGCCAGCTCCCAAGGAGAGTTCAGTGGGATATCTAACTCTGCAGATATTGGGGTGAAGGTGGACCCCCCCTTCAGTAAAGATAACATAACTATACAGGAACATGAATGGGCAAAACCAGAGAAGGAGACAGACCGCCATAACAAAGCCAAAAAGGAGGAAGCTGATAGGTTGGAGAGGAAAAAGGAGCGTGCAGAGAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     132      18                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     111      11                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PREDICTED - Mm ---- 2e-007     NP_082518.1 RIKEN cDNA 2600017A12 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 9e-009     XP_312188.4 AGAP002737-PA [Anopheles gambiae str. PEST] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 3e-084     AAI22924.1 Unknown (protein for IMAGE:7683037) [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8328381.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGA---------------------------------------------------------ATG---------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ...
  5   1   2      seed Ov1       in                    IMAGE:8328381.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCTGGTGAAGGGAGCTAGAAGTGGAGGCGCGCGCCCATTGGAGTTTAGTCACGGCAGTGCGCTGCATGCTGGGAAAGCTTGAGCTTGTGCTGAACTGTAACTCTCACACCCAGTCACATAACCGGGCCCTAATGGCAGCTGATGATGCTCAGACTGTCCGTCGCCGGGGGGACGAACCCAAATCGAGGGGCCACAAGGAGAAGGGCCACAGTAAAGCTGAACCCCCTAAACTGAACAGCAACAGCCTAGTCAGGGATGAGACCATATCTTCCACCTGCCCCCCTGCTGAGGATCCTCCCAGGAGGAAGAAGCACCGACTGGAGAAGGCAGGAAAGGCCAAGTCTGCCGACAGTTCAAAGAAAATCAAATCTCCCGACCCCAAAACAGAAAGTGATACAGAGGAGCCTCTGCCCAAACACACAAAGGCAGAAAATACCTTCACAGAAAAGCTGCTGCAGGACAGTGTGATTAGCAGTGCCCCAGACAATGGGATGTATAAATCAGTGGAACCAAGTGACGTCCGTAAGGAGATGGCTTCCGAAGTCACCACACGATTGGATGAGAACAGCAACATCACTGCAATGGAGTGCAATGGGGAAGTTGCACTGTACAGGAAGGATGAGGGGGTGGAACCCCAATTCCAAACCAGTAAAAAGGAACCCAGTGAGGAAAGTTCTAGTGATGAATTTCAGGTTGGGAGAGAGAAACACATAGATGGTCAAAGGAA
  3   1   2       bld Ov1       in                    IMAGE:8328381.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAAGGCCAAGTCTGCCGACAGTTCAAAGAAAATCAAATCTCCCGACCCCAAAACAGAAAGTGATACAGAGGAGCCTCTGCCCAAACACACAAAGGCAGAAAATACCTTCACAGAAAAGCTGCTGCAGGACAGTGTGATTAGCAGTGCCCCAGACAATGGGATGTATAAATCAGTGGAACCAAGTGACGTCCGTAAGGAGATGGCTTCCGAAGTCACCACACGATTGGATGAGAACAGCAACATCACTGCAATGGAGTGCAATGGGGAAGTTGCACTGTACAGGAAGGATGAGGGGGTGGAACCCCAATTCCAAACCAGTAAAAAGGAACCCAGTGAGGAAAGTTCTAGTGATGAATTTCAGGTTGGAGAAGAGAAACACATAGATGGTCAAAGGAATCAAGTCTTTCTATCTGCCAGCTCCCAAGGAGAGTTCAGTGGGATATCTAACTCTGCAGATATTGGGGTGAAGGTGGACCCCCCCTTCAGTAAAGATAACATAACTATACAGGAACATGAATGGGCAAAACCAGAGAAGGAGACAGACCGCCATAACAAAGCCAAAAAGGAGGAAGCTGATAGGTTGGAGAGGAAAAAGGAGCGTGCAGAGAAAAAGGGGAATTCAAAAAAAAAAAAAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)