Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 23 Sep 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012801329 Xl3.1-XL069h13.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL069h13.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGTTTCACCGTCCCCTCACTCTTACATGGATGACCAGTCAACCAAGGCTATAGACATCCAGACTGCCAATCTTCATGGTATTGGAGATTTCAGTGTCTGGGAATTTTCTGGAAACCCAACGTATTATTGCAGCTATGATTATTTTGCTGCCAACGATCCCACATCAATTCACGTTGTAGTTTTTAGCCTTGAAGAACCCTATGAGACTCTTCTTTATCAAGTCATATTCTGGCTCAACTTCATAAAATCACTTGTTCCTGTAGAAGAACCAATAGCATATGGCGGAAAGCTGAAGAATCTACTCCACGTTGTGTTGGTGGCCACACATGCAGATATTGTAAACCTTCCTCGCCCTGCTGGAGGAGAATTTGGTTATGACAAAAGTCTACCATTGCTAAAAGAAGTAAGAAATAGATTTGGAAATGATCTCCAGATTTTGGATAAGCTGTTTGTTCTGGATGCTGGGGCATCAGGGTCCAAGGAAATGAAGCTTCTGAGGAATCACCTCCAGGAATTAAAAAGCCAGTTGATATCTGATTGTCCACCTATGACACCACTGTGCGAGAAGGTGATGTCAACTCTTCCATCCTGGAGAAAGCAGAATGGTCCCAACCAACTTCTTTCCCTTCAACAATTTGTTTATGATGTCCAGGATCAACTGAATCCACTAGCAAGTGAAGAGGATGTTAGAAATCTCGCATTGCAACTGCACAGTATCGGAGAAGTTAATATAATGCAGAGTGAGACTGTCCAAGATGTTGTGCTTTTAGATCCACGATGGCTGTGCCACAATGTCCTTGGAAAGCTACTGTCTGTAGAAAGCCCAAAAGCCCTACACCATTACAGGGGGAGATATACAATGGAAGATATTCAGCGATTGGTCACAGACAGTGATGTTGATGAGCTTGTGCAGATCTTGGATGCAATGGACATTTGTGCTCGAGATCTAAGCAGCGGAACTATGGTGGACATCCCTGCCCTCATTAAAACTGACAACCTCCACAGATCATGGGCTGATGAAGAAGAGGACATACTAACTTATGGGGGTGTTAGAATTGTTCCTGTGGAACACATTACTCCTTTTCCATGTGGAATTTTTCACAAAGTTCAAGTTAATTTATGCCGATGGGTACATCAACAGAGCGCAGACGGAGATGCCGACATACGTTTATGGGTGAACGGATGTAAAATAGCCAATCGAGGGGCAGAGGTTTTGGTGTTGATGGTCAACCACGGCCAAGGAATTGAAGTGCAAGTCAGAGGTCTTGAGACTGAGAAAATCAAGTGCTGTTTACTTCTTGAATCCATTTGCAGTATCATTGACAACTTATTTGCAGCAACGTTGCCTGGTCTTTTACCTGTAAAACATTACTTGAGCCCTCAGCAGCTGAGAGAACATCATGAGCCCCCTGATGGGTTACCCACCCTAGAGAATTTTTTTCCGGGCCCAAATACAAAAGGGAGAACTTCACTGGCCTAACACCCATGGCTGGGGTACC
                                                  Xl3.1-CHK-1012711588                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACCGTCCCCTCACTCTTACATGGATGACCAGTCAACCAAGGCTATAGACATCCAGACTGCCAATCTTCATGGTATTGGAGATTTCAGTGTCTGGGAATTTTCTGGAAACCCAACGTATTATTGCAGCTATGATTATTTTGCTGCCAACGATCCCACATCAATTCACGTTGTAGTTTTTAGCCTTGAAGAACCCTATGAGACTCTTCTTTATCAAGTCATATTCTGGCTCAACTTCATAAAATCACTTGTTCCTGTAGAAGAACCAATAGCATATGGCGGAAAGCTGAAGAATCTACTCCACGTTGTGTTGGTGGCCACACATGCAGATATTGTAAACCTTCCTCGCCCTGCTGGAGGAGAATTTGGTTATGACAAAAGTCTACCATTGCTAAAAGAAGTAAGAAATAGATTTGGAAATGATCTCCAGATTTTGGATAAGCTGTTTGTTCTGGATGCTGGGGCATCAGGGTCCAAGGAAATGAAGCTTCTGAGGAATCACCTCCAGGAATTAAAAAGCCAGTTGATATCTGATTGTCCACCTATGACACCACTGTGCGAGAAGGTGATGTCAACTCTTCCATCCTGGAGAAAGCAGAATGGTCCCAACCAACTTCTTTCCCTTCAACAATTTGTTTATGATGTCCAGGATCAACTGAATCCACTAGCAAGTGAAGAGGATGTTAGAAATCTCGCATTGCAACTGCACAGTATCGGAGAAGTTAATATAATGCAGAGTGAGACTGTCCAAGATGTTGTGCTTTTAGATCCACGATGGCTGTGCCACAATGTCCTTGGAAAGCTACTGTCTGTAGAAAGCCCAAAAGCCCTACACCATTACAGGGGGAGATATACAATGGAAGATATTCAGCGATTGGTCACAGACAGTGATGTTGATGAGCTTGTGCAGATCTTGGATGCAATGGACATTTGTGCTCGAGATCTAAGCAGCGGAACTATGGTGGACATCCCTGCCCTCATTAAAACTGACAACCTCCACAGATCATGGGCTGATGAAGAAGAGGACATACTAACTTATGGGGGTGTTAGAATTGTTCCTGTGGAACACATTACTCCTTTTCCATGTGGAATTTTTCACAAAGTTCAAGTTAATTTATGCCGATGGGTACATCAACAGAGCGCAGACGGAGATGCCGACATACGTTTATGGGTGAACGGATGTAAAATAGCCAATCGAGGGGCAGAGGTTTTGGTGTTGATGGTCAACCACGGCCAAGGAATTGAAGTGCAAGTCAGAGGTCTTGAGACTGAGAAAATCAAGTGCTGTTTACTTCTTGAATCCATTTGCAGTATCATTGACAACTTATTTGCAGCAACGTTGCCTGGTCTTTTACCTGTAAAACATTACTTGAGCCCTCAGCAGCTGAGAGAACATCATGAGCCCCCTGATGGGTTACCCACCCTAGAGAATTTTTTTCCGGGCCCAAATACAAAAGGGAGAACTTCACTGGCCTAACACCCATGGCTGG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                       ...PROTEIN --- At ---- 1e-008     NP_200365.1 expressed protein [Arabidopsis thaliana] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 3e-009     XP_311349.4 AGAP000810-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 9e-054     NP_490840.2 DAP (Death-Associated Protein) Kinase homolog family member (dapk-1) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 2e-080     XP_001196325.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Gg ==== 3e-150     XP_425037.2 PREDICTED: hypothetical protein, partial [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 0          NP_001093460.1 si:ch211-66i11.1 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_083929.2 death associated protein kinase 1 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 0          XP_541259.2 PREDICTED: similar to Death-associated protein kinase 1 (DAP kinase 1) [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 0          XP_613544.4 PREDICTED: similar to death-associated protein kinase 1 isoform 1 [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_004929.2 death-associated protein kinase 1 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 0          NP_001116911.1 death-associated protein kinase 1 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          NP_001086727.1 death-associated protein kinase 1 [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL069h13.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ...
  5   1   1       add Emb4                            IMAGE:4680079.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGTTTCACCGTCCCCTCACTCTTACATGGATGACCAGTCAACCAAGGCTATAGACATCCAGACTGCCAATCTTCATGGTATTGGAGATTTCAGTGTCTGGGAATTTTCTGGAAACCCAACGTATTATTGCAGCTATGATTATTTTGCTGCCAACGATCCCACATCAATTCACGTTGTAGTTTTTAGCCTTGAAGAACCCTATGAGACTCTTCTTTATCAAGTCATATTCTGGCTCAACTTCATAAAATCACTTGTTCCTGTAGAAGAACCAATAGCATATGGCGGAAAGCTGAAGAATCTACTCCACGTTGTGTTGGTGGCCACACATGCAGATATTGTAAACCTTCCTCGCCCTGCTGGAGGAGAATTTGGATATGACAAAAGTCTAGCATTGCTAAAAGAAGTAAGAAATAGATTTGGAAACGATCTGCAGATTTTGGATAAACTGTTTGCTCTGGATGCTGGGGCATCAGGGTCCAAGGAGATGAAGCATCTGAAGAATCACCTCCAAGAATTACAAAGCCAGTTGATATCTGATTGCCCACCCATGACACCACTG
  5   1   2      seed Tbd7                                 XL069h13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATTGTGGTTTTTAGCCTTGAAGAGCCCTATGAAATTCAACTTAATNAAGTAATATTCTGGCTCAACTTCCTAAAGTCACTTGTTCCTGTGGAGGAACCAATAGCATATGGTGGGAAGCTAAAGAATCTACTCCACGTTGTATTGGTGGCCACACATGCTGATATTGTTAACCTTCCTCGCCCTGCGGGAGGAGAATTTGGTTATGACAAAAGTCTACCATTGCTAAAAGAAGTAAGAAATAGATTTGGAAATGATCTCCAGATTTTGGATAAGCTGTTTGTTCTGGATGCTGGGGCATCAGGGTCCAAGGAAATGAAGCTTCTGAGGAATCACCTCCAGGAATTAAAAAGCCAGTTGATATCTGATTGTCCACCTATGACACCACTGTGCGAGAAGGTGATGTCAACTCTTCCATCCTGGAGAAAGCAGAATGGTCCCAACCAACTTCTTTCCCTTCAACAATTTGTTTATGATGTCCAGGATCAACTGAATCCACTAGCAAGTGAAGAGGATGTTAGAAATCTCGCATTGCAACTGCACAGTATCGGAGAAGTTAATATAATGCAGAGTGAGACTGTCCAAGATGTTGTGCTTTTAGATCCACGATGGCTGTGCCAC
  5   1   2       bld Emb1                            IMAGE:6634544.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAGAATGGTCCCAACCAACTTCTTTCCCTTCAACAATTTGTTTATGATGTCCAGGATCAACTGAATCCACTAGCAAGTGAAGAGGATGTTAGAAATCTCGCATTGCAACTGCACAGTATCGGAGAAGTTAATATAATGCAGAGTGAGACTGTCCAAGATGTTGTGCTTTTAGATCCACGATGGCTGTGCCACAATGTCCTTGGAAAGCTACTGTCTGTAGAAAGCCCAAAAGCCCTACACCATTACAGGGGGAGATATACAATGGAAGATATTCAGCGATTGGTCACAGACAGTGATGTTGATGAGCTTGTGCAGATCTTGGATGCAATGGACATTTGTGCTCGAGATCTAAGCAGCGGAACTATGGTGGACATCCCTGCCCTCATTAAAACTGACAACCTCCACAGATCATGGGCTGATGAAGAAGAGGACATACTAACTTATGGGGGTGTTAGAATTGTTCCTGTGGAACACATTACTCCTTTTCCATGTGGAATTTTTCACAAAGTTCAAGTTAATTTATGCCGATGGGTACATCAACAGAGCGCAGACGGAGATGCCGACATACGTTTATGGGTGAACGGATGTAAAATAGCCAATCGAGGGGCAGAGGTTTTGGTGTTGATGGTCAACCACGGCCAAGGAATTGAAGTGCAAGTCAGAGGTCTTGAGACTGAGAAAATCAAGTGCTGTTTACTTCTTGAATCCATTTGCAGTATCATTGACAACTTATTTGCAGCAACGTTGCCTGGTCTTTTACCTGTAAAACATTACTTGAGCCCTCAGCAGCTGAGAGAACATCATGAGCCCCCTGATGGGTTACCCACCCTAGAGAATTTTTTTCCGGGCCCAAATACAAAAGGGAGAACTTCACTGGCCTAACACCCATGGCTGGGGTACCAAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)