Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6958507.5                       3 PI      93          1      155                neurofilament protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012801472 Xl3.1-IMAGE:6946469.5 - 2 ESTs
                                                                       ........-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6946469.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCGCCTTCCTGAAGAAAGTACACGAGGAAGAACTGTCGCAGCTACAGTCGCAAGTGCAATACGCGCAGGTCTCCCTCGAAGTCGAAGTGGCCAAGCCGGACCTCAGCTCTGCCCTGCGGGATATAAGGGGTCAGTACGAGAAACTGGCCGCCAAGAACATGCAGTCCGCCGAGGAATGGTTCAAGTCGCGATTCACCGTCCTGACGCAAAGCGCAGCCCGCAACACTGACGCAGTCAGAGCCGCCAAGGACGAGATGTCCGAGAGTCGCAGGATGCTCAGCGCCAAGGGACTGGAGATAGAGGCTTGTAGGGGGGTCAATGAAGCTCTACAGAGGCAGATCCAGGAACTGGAGGACAAGCAGAGCGGGGAAATCGCAGGAATGCAGGATGCTATAAACAAATTAGAGGAAGAACTGAGGAACACCAAGAGTGAAATGGCCAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTCAAGATGGCTTTGGATATAGAAATTGCAGCCTACAGGAAGTTGCTTGAGGGGGAGGAGACCCGACTGAGTTTCTCTGGGGTCGGAGCCATCACTAGTGGATACACGCAGAGTGCCCCTGTTTTTGGCCGTTCAGCTTACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGAGCATTCCCTACATACTATTCCAGCCATGTCCAAGAGGAGCAGCTTGACATAGAGGAGACCATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCTCCAGAGGAGGAAGAAGAAGAGGCTGCAGAGGGAAGAGGGAGAAGGCGGAANAGGAGGCTGAANAAAGAAAGTGAAAGAGGGG
                                                  Xl3.1-CHK-1012715751                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCTGAAGAAAGTACACGAGGAAGAACTGTCGCAGCTACAGTCGCAAGTGCAATACGCGCAGGTCTCCCTCGAAGTCGAAGTGGCCAAGCCGGACCTCAGCTCTGCCCTGCGGGATATAAGGGGTCAGTACGAGAAACTGGCCGCCAAGAACATGCAGTCCGCCGAGGAATGGTTCAAGTCGCGATTCACCGTCCTGACGCAAAGCGCAGCCCGCAACACTGACGCAGTCAGAGCCGCCAAGGACGAGATGTCCGAGAGTCGCAGGATGCTCAGCGCCAAGGGACTGGAGATAGAGGCTTGTAGGGGGGTCAATGAAGCTCTACAGAGGCAGATCCAGGAACTGGAGGACAAGCAGAGCGGGGAAATCGCAGGAATGCAGGATGCTATAAACAAATTAGAGGAAGAACTGAGGAACACCAAGAGTGAAATGGCCAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTCAAGATGGCTTTGGATATAGAAATTGCAGCCTACAGGAAGTTGCTTGAGGGGGAGGAGACCCGACTGAGTTTCTCTGGGGTCGGAGCCATCACTAGTGGATACACGCAGAGTGCCCCTGTTTTTGGCCGTTCAGCTTACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGAGCATTCCCTACATACTATTCCAGCCATGTCCAAGAGGAGCAGCTTGACATAGAGGAGACCATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCTCCAGAGGAGGAAGAAGAAGAGGCTGCAGAGGGAAGAGGGAGAAGGCGGAANAGGAGGCTGAANAAAGAAAGTGAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                                                                                                 PROTEIN --- Sp ---- 1e-018     NP_999665.1 nuclear intermediate filament protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                       PROTEIN --- Ce ---- 4e-022     NP_001076764.1 Intermediate Filament, A family member (ifa-1) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                            PROTEIN --- Dm ---- 3e-022     NP_476616.1 CG6944-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 9e-044     NP_001027681.1 intermediate filament protein IF-A [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                           PREDICTED - ?? ---- 3e-046     XP_870725.3 PREDICTED: similar to Neurofilament heavy polypeptide (NF-H) (Neurofilament triplet H protein) (200 kDa neurofilament protein) isoform 2 [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PROTEIN --- Xt ---- 6e-067     AAI61014.1 Unknown (protein for IMAGE:7663363) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                    PREDICTED - Dr ---- 1e-079     XP_001333768.2 PREDICTED: similar to neurofilament, light polypeptide [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                 PROTEIN --- Bt ---- 1e-109     NP_776546.1 neurofilament, light polypeptide [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                              PREDICTED - Gg ---- 2e-110     XP_417679.1 PREDICTED: similar to neurofilament-L [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                 PROTEIN --- Mm ---- 2e-110     NP_035040.1 neurofilament, light polypeptide [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                 PROTEIN --- Hs ---- 1e-110     NP_006149.2 neurofilament, light polypeptide 68kDa [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PREDICTED - Cf ---- 3e-111     XP_858626.1 PREDICTED: similar to neurofilament, light polypeptide isoform 3 [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN --- Xl ---- 2e-139     NP_001081414.1 neurofilament protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6946469.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATG---------------------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ...
  5   1   2      seed Eye1                            IMAGE:6946469.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCGCCTTCCTGAAGAAAGTACACGAGGAAGAACTGTCGCAGCTACAGTCGCAAGTGCAATACGCGCAGGTCTCCCTCGAAGTCGAAGTGGCCAAGCCGGACCTCAGCTCTGCCCTGCGGGATATAAGGGGTCAGTACGAGAAACTGGCCGCCAAGAACATGCAGTCCGCCGAGGAATGGTTCAAGTCGCGATTCACCGTCCTGACGCAAAGCGCAGCCCGCAACACTGACGCAGTCAGAGCCGCCAAGGACGAGATGTCCGAGAGTCGCAGGATGCTCAGCGCCAAGGGACTGGAGATAGAGGCTTGTAGGGGGGTCAATGAAGCTCTACAGAGGCAGATCCAGGAACTGGAGGACAAGCAGAGCGGGGAAATCGCAGGAATGCAGGATGCTATAAACAAATTAGAGGAAGAACTGAGGAACACCAAGAGTGAAATGGCCAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTCAAGATGGCTTTGGATATAGAAATTGCAGCCTACAGGAAGTTGCTTGAGGGGGAGGAGACCCGACTGAGTTTCTCTGGGGTCGGAGCCATCACTAGTGGATACACGCAGAGTGCCCCTGTTTTTGGCCGTTCAGCTTACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGAGCATTCCCTACATACTATTCCAGCCATGTCCAAGAGGAGCAGCTTGACATAGAGGAGACCATAGAGTCTTctagagcagaagaagccaaggcagaagctccagaggaggaagaagaagaggctgcagagggaagagggagaaggcggaaNAGGAGGCTGAANAAAGAAAGTGAAAGAGGGG
  5  -1   2       bld Brn2                             Brn2-za48c03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGGAATGCAGGATGCTATAAACAAATTAGAGGAAGAATTGAGGAACACCAAGAGTGAAATGGCCAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTCAAGATGGCTTTGGATATAGAAATTGCAGCCTACAGGAAGTTGCTTGAGGGGGAGGAGACCCGACTGAGTTTCTCTGGGGTCGGAGCCATCACTAGTGGATACACGCAGAGTGCCCCTGTTTTTGGCCGTTCAGCTTACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGAGCATTCCCTACATACTATTCCAGCCATGTCCAAGAGGAGCAGCTTGTCATAGAGGAGACCATAGAGTCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)