Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 21 Sep 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.5    0Xl3.1-IMAGE:6880520.5                       3 END     2         100       66                homeobox protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6880520.5                       3 PI      87          1      173                homeobox protein [Xenopus laevis]
     3   0.0    0Xl3.1-xl221n06.3                            2 PI      82          1      364                homeobox protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012801504 Xl3.1-XL087i12.3 - 2 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2
                                                                       PREDICTED - Cf ---- 1e-006     XP_864659.1 PREDICTED: similar to homeobox protein A7 isoform 4 [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================
                                                                       PROTEIN --- Hs ---- 8e-007     NP_008827.2 homeobox protein A7; homeobox protein HOX-1A [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================
                                                                          PROTEIN --- Mm ---- 2e-008     NP_034585.1 homeobox protein A7 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================
                                                                          PROTEIN --- Gg ---- 1e-008     NP_989926.1 homeodomain transcription factor HoxA-7 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================
                                                                                               PROTEIN --- Xl ---- 1e-019     NP_001082538.1 homeobox protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================
                                                      Xl3.1-XL087i12.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------TAA------------------------------------------------------------------TAA---------TAA---------------------------------------------------------------------------------------TAA------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                ]
  3   1   2       bld Tbd7      out                        XL071e19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAATGTCATTATTTTCATAAATGTAAAGTTGAAGACTGGATGGAAGCCCCCAGGAGTCAGCAAAGGGTTCATTCCAGGTGGATCTGTAGTCTATAAAAAAAAACAAAAATGAAGTTATTTTACTTTACATTCGTATTATATATAAATATCTATTGTACATTTGATACGGAATTTCAGTAGTAACAAGAAACAACTTCTTTTCTTAACTACCTAACCCACCAGATAAATCCCAGGTACAGGGAAATTAAAACTGAGCTACCTATGCGACAGAATCGTTTCGTTTGACTGTCTATGTGCGTCTCCACGATTCAAATAAAGGGCGAAACGCCACGAAACGACCACTACATGTGTGCTACCTTGCTGTATACTACCTAGTCGAGTCTAACAACTACCTGTNTGTGACTTTTTTNNTGTGCATGACTTTGAATTTTAG

In case of problems mail me! (