Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 28 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.5    0Xl3.1-IMAGE:6880520.5                       3 END     2         100       66                homeobox protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6880520.5                       3 PI      87          1      173                homeobox protein [Xenopus laevis]
     3   0.0    0Xl3.1-xl221n06.3                            2 PI      82          1      364                homeobox protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012801504 Xl3.1-XL087i12.3 - 2 ESTs
                                                                       ....-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL087i12.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCAGATCAAAATCTGGTTCCAGAACAGGAGAATGAAATGGAAGAAAGAACNCAAGGAGGAAAGTGACCAGACCCCCGACGCTGGGGAGGAATCCACTGCACCCACTACTACTGCAGATGATGATAAAGATAAAATAAAACGCAATGAACAAGGGACAATTTGTAATATGGGGTTTGCACGTGACAGGGAGAAATCTCTGCTAAATGTCATTATTTTCATAAATGTAAAGTTGAAGAATGGATGGAGGCCCCCAGGAGTCAGCAAAGGGTTCATTCCAGGTGGATCTGTAGTCTATAAAAAAAAACAAAAATGAAGTTATTTTACTTTACATTCGTATTATATATAAATATCTATTGTACATTTGATACGGAATTTCAGTAGTAACAAGAAACAACTTCTTTTCTTAACTACCTAACCCACCAGATAAATCCCAGGTACAGGGAAATTAAAACTGAGCTACCTATGCGACAGAATCGTTTCGTTTGACTGTCTATGTGCGTCTCCACGATTCAAATAAAGGGCGAAACGCCACGAAACGACCACTACATGTGTGCTACCTTGCTGTATACTACCTAGTCGAGTCTAACAACTACCTGTTTGTGCTTTTTTTTNTGTGCATGACT
                                                  Xl3.1-CHK-1012717912                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAAAATCTGGTTCCAGAACAGGAGAATGAAATGGAAGAAAGAACNCAAGGAGGAAAGTGACCAGACCCCCGACGCTGGGGAGGAATCCACTGCACCCACTACTACTGCAGATGATGATAAAGATAAAATAAAACGCAATGAACAAGGGACAATTTGTAATATGGGGTTTGCACGTGACAGGGAGAAATCTCTGCTAAATGTCATTATTTTCATAAATGTAAAGTTGAAGAATGGATGGAGGCCCCCAGGAGTCAGCAAAGGGTTCATTCCAGGTGGATCTGTAGTCTATAAAAAAAAACAAAAATGAAGTTATTTTACTTTACATTCGTATTATATATAAATATCTATTGTACATTTGATACGGAATTTCAGTAGTAACAAGAAACAACTTCTTTTCTTAACTACCTAACCCACCAGATAAATCCCAGGTACAGGGAAATTAAAACTGAGCTACCTATGCGACAGAATCGTTTCGTTTGACTGTCTATGTGCGTCTCCACGATTCAAATAAAGGGCGAAACGCCACGAAACGACCACTACATGTGTGCTACCTTGCTGTATACTACCTAGTCGAGTCTAACAACTACCTGTTTGTGCTTTTTTTTTxxxxxATGACTTTGAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2
                                                                       PREDICTED - Cf ---- 1e-006     XP_864659.1 PREDICTED: similar to homeobox protein A7 isoform 4 [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================
                                                                       PROTEIN --- Hs ---- 8e-007     NP_008827.2 homeobox protein A7; homeobox protein HOX-1A [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================
                                                                          PROTEIN --- Mm ---- 2e-008     NP_034585.1 homeobox protein A7 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================
                                                                          PROTEIN --- Gg ---- 1e-008     NP_989926.1 homeodomain transcription factor HoxA-7 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================
                                                                                               PROTEIN --- Xl ---- 1e-019     NP_001082538.1 homeobox protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================
                                                      Xl3.1-XL087i12.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------TAA------------------------------------------------------------------TAA---------TAA---------------------------------------------------------------------------------------TAA------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                ]
  3   1   2      seed Tbd7      out                        XL087i12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCAGATCAAAATCTGGTTCCAGAACAGGAGAATGAAATGGAAGAAAGAACNCAAGGAGGAAAGTGACCAGACCCCCGACGCTGGGGAGGAATCCACTGCACCCACTACTACTGCAGATGATGATAAAGATAAAATAAAACGCAATGAACAAGGGACAATTTGTAATATGGGGTTTGCACGTGACAGGGAGAAATCTCTGCTAAATGTCATTATTTTCATAAATGTAAAGTTGAAGAATGGATGGAGGCCCCCAGGAGTCAGCAAAGGGTTCATTCCAGGTGGATCTGTAGTCTATAAAAAAAAACAAAAATGAAGTTATTTTACTTTACATTCGTATTATATATAAATATCTATTGTACATTTGATACGGAATTTCAGTAGTAACAAGAAACAACTTCTTTTCTTAACTACCTAACCCACCAGATAAATCCCAGGTACAGGGAAATTAAAACTGAGCTACCTATGCGACAGAATCGTTTCGTTTGACTGTCTATGTGCGTCTCCACGATTCAAATAAAGGGCGAAACGCCACGAAACGACCACTACATGTGTGCTACCTTGCTGTATACTACCTAGTCGAGTCTAACAACTACCTGTTTGTGCTTTTTTTTTGTGATGCTTNAATTTTAGC
  3   1   2       bld Tbd7      out                        XL071e19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAATGTCATTATTTTCATAAATGTAAAGTTGAAGACTGGATGGAAGCCCCCAGGAGTCAGCAAAGGGTTCATTCCAGGTGGATCTGTAGTCTATAAAAAAAAACAAAAATGAAGTTATTTTACTTTACATTCGTATTATATATAAATATCTATTGTACATTTGATACGGAATTTCAGTAGTAACAAGAAACAACTTCTTTTCTTAACTACCTAACCCACCAGATAAATCCCAGGTACAGGGAAATTAAAACTGAGCTACCTATGCGACAGAATCGTTTCGTTTGACTGTCTATGTGCGTCTCCACGATTCAAATAAAGGGCGAAACGCCACGAAACGACCACTACATGTGTGCTACCTTGCTGTATACTACCTAGTCGAGTCTAACAACTACCTGTNTGTGACTTTTTTNNTGTGCATGACTTTGAATTTTAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)