Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:4202506-IMAGp.5.5              37 PI      90        653      792                (no blast hit)
     2   0.0    0Xl3.1-XL496j03ex.5                         12 PI      87        652      805                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6638961.5                      11 PI      90        656      805                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:8542662.5                      10 PI      89        653      805                (no blast hit)
     5   0.0    0Xl3.1-IMAGE:6633762.5                       9 PI      89        653      803                (no blast hit)
     6   0.0    0Xl3.1-IMAGE:8820864.3                       9 PI      87        653      805                (no blast hit)
     7   0.0    0Xl3.1-IMAGE:7209453.5                       6 PI      88        653      803                (no blast hit)
     8   0.0    0Xl3.1-IMAGE:8075188.3                       5 PI      88        653      805                (no blast hit)
     9   0.0    0Xl3.1-IMAGE:3200711.3                       5 PI      88        653      805                (no blast hit)
    10   0.0    0Xl3.1-IMAGE:5161999.5                       5 PI      86        653      805                (no blast hit)
    11   0.0    0Xl3.1-IMAGE:6877297.3                       4 PI      89        658      805                (no blast hit)
    12   0.0    0Xl3.1-XL200i22.5                            4 PI      88        654      805                (no blast hit)
    13   0.0    0Xl3.1-xl286f12.3                            4 PI      87        653      805                (no blast hit)
    14   0.0    0Xl3.1-XL164m03.3                            4 PI      80        232      463                (no blast hit)
    15   0.0    0Xl3.1-IMAGE:8635351.3                       3 PI      91        653      787                (no blast hit)
    16   0.0    0Xl3.1-xl292o22.5                            3 PI      90        653      805                (no blast hit)
    17   0.0    0Xl3.1-rxlk77i12ex.3                         3 PI      87        653      805                (no blast hit)
    18   0.0    0Xl3.1-XL423j17ex.3                          3 PI      87        653      805                (no blast hit)
    19   0.0    0Xl3.1-xlk1f13ex.3                           3 PI      87        653      803                (no blast hit)
    20   0.0    0Xl3.1-IMAGE:4682692-IMAGp.5                 2 PI      92        654      775                (no blast hit)
    21   0.0    0Xl3.1-IMAGE:6948349.3                       2 PI      91        653      787                (no blast hit)
    22   0.0    0Xl3.1-XL048n11.5                            2 PI      90        651      803                (no blast hit)
    23   0.0    0Xl3.1-IMAGE:3581682.5                       2 PI      88        653      805                (no blast hit)
    24   0.0    0Xl3.1-IMAGE:3557209.5                       2 PI      87        653      805                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012801740 Xl3.1-xlk55l05ex.5 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xlk55l05ex.5 ACTATGAGTGGGTTTTTAGAGGTGCAACATTACGACTGTATTTGCTTATTCTGCTTTCAGTATCTTTATTAGAGAATTGTCACCCATGCAATAAATATGTCCCAGTTTCACTGTAACAGCACCACCCCCCAATAATAATAATAATAGTCTAGTGCCTTTTTATTTTCACAAGCACAGGCCCCTATCCTTTCCAGCAGGTTGGGGAAGCAGATATTATATAGGTTTCATTTTTTTTTTTTTTTGCACTACGAATCAAATGATCGTCATAGGGAAAAGGCAATAAAGATGGAAGATGGAAAATGCACAAATTTCTATATAAATATTATACCACCTGCCCCTTTCTTAGGAGAACAATATATTTAAGGCTCAGTGACCTTTATGCTTGCTTGGTACTGAAATTGGGGTGATTTATTAATATTGGTGCTAAACTGCAGTTCCACATACAACCAATCAGATGTTGCTGTTTAGTAGGAGTGTTATAAATGAGCCCCACATAATAAACAGCAGTCCAGAGGAAATGGCAAAAGCAGAAAAAAAGATATTTGAAATATTATTTGCTGTTTTAAGCAGAGTGTTTATATGAAGAGGGATTCCTTTGCACACCGTCTGTCCTCTAAAGCAGGAAGCTCTCTCTGTGCTCCTGGTTTACGACTACAGGTATGGGACCTGTTATCCAGAATGTTTAGGACCTGGGGTTTTCCAGATAATAGATCTTTCTGTAATTTGGATCTTCATACCTTAAGTCTACTACAAAATCATGTAAACATTAAATAAATCCAATAGTCTGATTTTTCTTCCAATAAGGCAGTGGTCCCCAACCTTTTTTTTACCTGTGAGCCACATTCAAAGTAAGAAGAGTTGGGGAGCAACACAAGCATGAAAAAAGTC
                                                  Xl3.1-CHK-1012707590       AGTGGGTTTTTAGAGGTGCAACATTACGACTGTATTTGCTTATTCTGCTTTCAGTATCTTTATTAGAGAATTGTCACCCATGCAATAAATATGTCCCAGTTTCACTGTAACAGCACCACCCCCCAATAATAATAATAATAGTCTAGTGCCTTTTTATTTTCACAAGCACAGGCCCCTATCCTTTCCAGCAGGTTGGGGAAGCAGATATTATATAGGTTTCATTTTTTTTTTTTTTTGCACTACGAATCAAATGATCGTCATAGGxAAxAxGCAATAAAGATGGAAGATGGAAAATGCACAxAxxTxTxTATAAATATTATACCACCTGCCCCTTTCTTAGGAGAACAATATATTTAAGGCTCAGTGACCTTTATGCTTGCTTGGTACTGAAATTGGGGTGATTTATTAATATTGGTGCTAAACTGCAGTTCCACATACAACCAATCAGATGTTGCTGTTTAGTAGGAGTGTTATAAATGAGCCCCACATAATAAACAGCAGTCCAGAGGAAATGGCAAAAGCAGAAAAAAAGATATTTGAAATATTATTTGCTGTTTTAAGCAGAGTGTTTATATGAAGAGGGATTCCTTTGCACACCGTCTGTCCTCTAAAGCAGGAAGCTCTCTCTGTGCTCCTGGTTTACGACTACAGGTATGGGACCTGTTATCCAGAATGTTTAGGACCTGGGGTTTTCCAGATAATAGATCTTTCTGTAATTTGGATCTTCATACCTTAAGTCTACTACAAAATCATGTAAACATTAAATAAATCCAATAGTCTGATTTTTCTTCCAATAAGGCAGTGGTCCCCAACCTTTTTTTTACCTGTGAGCCACATTCAAAGTAAGAAGAGTTGGGGAGCAACACAAGCATGAAA
                                                      consensus depths      1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     3     2     3     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1
                                                    Xl3.1-xlk55l05ex.5    ATG---------------------------------------------------------------TAG------------------------ATG---------------------------------TAATAATAATAATAG------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------TAA---------------ATG------------TGA---------------------------------------------------------------------TAGTAG------------TGA---------------------------------------------------------TGA---------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------TAA------TAG------------------------------------------------------------------TAA------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                         ...
  5   1   2      seed Ga18      in                       xlk55l05ex.5p ACTATGAGTGGGTTTTTAGAGGTGCAACATTACGACTGTATTTGCTTATTCTGCTTTCAGTATCTTTATTAGAGAATTGTCACCCATGCAATAAATATGTCCCAGTTTCACTGTAACAGCACCACCCCCCaataataataataataGTCTAGTGCCTTTTTATTTTCACAAGCACAGGCCCCTATCCTTTCCAGCAGGTTGGGGAAGCAGATATTATATAGGTTTCAtttttttttttttttGCACTACGAATCAAATGATCGTCATAGGGAAAAGATGCAATAAAGATGGAAGATGGAAAATGCACAAATTTCTATATAAATATTATACCACCTGCCCCTTTCTTAGGAGAACAATATATTTAAGGCTCAGTGACCTTTATGCTTGGGGTGATTTATTAATATTGGTGCTAAACTGCAGTTCCACATACAACCAATCAGATGTTGCTGTTTAGTAGGAGTGTTATAAATGAGCCCCACATAATAAACAGCAGTCCAGAGGAAATGGCAAAAGCAGaaaaaaaaaa
  5   1   1       add Te2                             IMAGE:7392256.5p        CCGGATTCCCGGGATTGCAACATTACGACTGTATTTGCTTATTCTGCTTTCAGTATCTTTATTAGAGAATTGTCACCCATGCAATAAATATGTCCCAGTTTCACTGTAACAGCACCACCCCCCaataataataataataGTCTAGTGCCTTTTTATTTTCACAAGCACAGGCCCCTATCCTTTCCAGCAGGTTGGGGAAGCAGATATTATATAGGTTTCAtttttttttttttGCACTACGAATCAAATGATCGTCATAGGGAAAAGATGCAATAAAGATGGAAGATGGAAAATGCACAAATTTCTATATAAATATTATACCACCTGCCCCTTTCTTAGGAGAACAATATATTTAAGGCTCAGTGACCTTTATGCTTGCTTGGTACTGAAATTGGGGTGATTTATTAATATTGGTGCTAAACTGCAGTTCCACATACAACCAATCAGATGTTGCTGTTTAGTAGGAGTGTTATAAATGAGCCCCACATAATAAACAGCAGTCCAGAGGAAATGGCAAAAGCAGAAAAAAAGATATTTGAAATATTATTTGCTGTTTTAAGCAGAGTGTTTATATGAAGAGGGATTCCTTTGCACACCGTCTGTCCTCTAAAGCAGGAAGCTCTCTCTGTGCTCCTGGTTTACGACtacaggtatgggacctgttatccagaatgtttaggacctggggttttccagataatagatctttctgtaatttgggatctcataccntaagtctactacaaatcatgtaaacattaaataaTCCATAGTCTGATTTTCTCCNNATANGCAGTGTCCCCACCTTTTTTT
  3  -1   1       add Neu7      out                        XL011e16.3p                                                                                                                                                                                                                                                                              AAAGATGCAATAACAGATGGAAGATGGAAAATGCACAAATNTCTATATAAATATTATACCACCTGCCCCTTTCTTAGGAGAACAATATATTTAAGGCTCAGTGACCTTTATGCTTGCTTGGTACTGAAATTGGGGTGATTTATTAATATTGGTGCTAAACTGCAGTTCCACATACAACCAATCAGATGTTGCTGTTTAGTAGGAGTGTTATAAATGAGCCCCACATAATAAACAGCAGTCCAGAGGAAATGGCAAAAGCAGAAAAAAAGATATTTGAAATATTATTTGCTGTTTTAAGCAGAGTGTTTATATGAAGAGGGATTCCTTTGCACACCGTCTGTCCTCTAAAGCAGGAAGCTCTCTCTGTGCTCCTGGTTTACGACTACAGGTATGGGACCTGTTATCCAGAATGTTTAGGACCTGGGGTTTTCCAGATAATAGATCTTTCTGTAATTTGGATCTTCATACCTTAAGTCTACTACAAAATCATGTAAACATTAAATAAATCCAATAGTCTGATTTTTCTTCCAATAAGGCAGTGGTCCCCAACCTTTTTTTTACCTGTGAGCCACATTCAAAGTAAGAAGAGTTGGGGAGCAACACAAGCATGAAAAAAGTC
  3  -1   2       bld Ga18      in                       xlk55l05ex.3p                                                                                                                                                                                                                                                                                                          GAAAANGCACAAATTTCTATATAAATATTATACCACCTGCCCCTTTCTTAGGAGAACAATATATTTAAGGCTCAGTGACCTTTATGCTTGGGGTGATTTATTAATATTGGTGCTAAACTGCAGTTCCACATACAACCAATCAGATGTTGCTGTTTAGTAGGAGTGTTATAAATGAGCCCCACATAATAAACAGCAGTCCAGAGGAAATGGCNAAAGCAGAAAAAAAAAAAAAAANAANA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)