Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 26 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8073038.5                       3 PI      89        433      697                heart and neural crest derivatives expressed 2 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 87%

 1012801935 Xl3.1-IMAGE:8824088.5 - 2 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8824088.5 CATGAGTGGGAGGCATCACTAATCTCCATGCCGACAAAGAGACCAGAGAGGACAGATGTGCAGCCCAGCAGTGGCCTCTACCACCTGTTTTGTCCGTGGGGTGAATCGGGATCAGGGAATGGGAGCCGCTCGCACTGAAAGCTCCTCACTCAGCCTTTACTGCAGGGACGTCCCATTGGAGATTATGGAGCTGGTGTAACTATTCAGAGATCGCGCATGCAGCTCTTCTACGGGCACAATCGCACAGGAGCCAAATGAGAGCATGTCCCGGCTTACTTGAAATCGCAGCGTCTGCAACGTTATTGCTGCTGCTTCTCACACACACTCTGTTCAGAAAACGTTTCGATAATAAGAGTGAGAGAGACTGACTGTGGATTTATTAATGGAGAGCCAGGGATAACCTATATTTAATACATAGATTGCCGGCGGGAGGACAAGACTATAGTGTAGCTGACATGAGTCTGGTTGGGGGGTTTCCTCACCACTCAGTGGTGCACCATGACGGTTATCCTTTTGCAGCTGCTGCTGCAGCCGCTAGTCGCTGCCACGAAGAGAACCCTTATTTCCACGGCTGGCTAATCAGTCACCCCGAAATGTCTCCCCCCGACTACAGCATGGCACCGTCTTACAGCCCGGAGTACGCCAATGGCGCGGCCGGCCTGGACCACTCCCATTACGGGGGAGTCCCGGGAAGCGGCGCAGGAGGCTTGATGCAACGGCCTGTAAAGCGAAGGGGGACCGCTAACCGCAAGGAAAGGCGCAGGACTCAAAGCATCAACAGCGCCTTCTCAGAGCTGCGGGATTGTATCCCCAATGTGCCGGCCGATACCAAACTGTCAAAGATCAAAACTCTGCGGCTGGCCACCAGCTATATAGCCTACCTCATGGACCTGCTGGCCAAGACGACCAGAATGGGGAGACAGAGGCCTTTACGCAGACATCAAAAAGACAGATTTGAAGAGAGAGAGAGAAGAAATGACGACTTTTGAAGCCACAGTTTGCAGTACGATAGAACAAGGAGGACTGGTTGGCCGCAACATGTCTTGGCTCTGAGCTAAACAGGAACCTTGGGGAATTGAG
                                                  Xl3.1-CHK-1012718866       TGGGAGGCATCACTAATCTCCATGCCGACAAAGAGACCAGAGAGGACAGATGTGCAGCCCAGCAGTGGCCTCTACCACCTGTTTTGTCCGTGGGGTGAATCGGGATCAGGGAATGGGAGCCGCTCGCACTGAAAGCTCCTCACTCAGCCTTTACTGCAGGGACGTCCCATTGGAGATTATGGAGCTGGTGTAACTATTCAGAGATCGCGCATGCAGCTCTTCTACGGGCACAATCGCACAGGAGCCAAATGAGAGCATGTCCCGGCTTACTTGAAATCGCAGCGTCTGCAACGTTATTGCTGCTGCTTCTCACACACACTCTGTTCAGAAAACGTTTCGATAATAAGAGTGAGAGAGACTGACTGTGGATTTATTAATGGAGAGCCAGGGATAACCTATATTTAATACATAGATTGCCGGCGGGAGGACAAGACTATAGTGTAGCTGACATGAGTCTGGTTGGGGGGTTTCCTCACCACTCAGTGGTGCACCATGACGGTTATCCTTTTGCAGCTGCTGCTGCAGCCGCTAGTCGCTGCCACGAAGAGAACCCTTATTTCCACGGCTGGCTAATCAGTCACCCCGAAATGTCTCCCCCCGACTACAGCATGGCACCGTCTTACAGCCCGGAGTACGCCAATGGCGCGGCCGGCCTGGACCACTCCCATTACGGGGGAGTCCCGGGAAGCGGCGCAGGAGGCTTGATGCAACGGCCTGTAAAGCGAAGGGGGACCGCTAACCGCAAGGAAAGGCGCAGGACTCAAAGCATCAACAGCGCCTTCTCAGAGCTGCGGGATTGTATCCCCAATGTGCCGGCCGATACCAAACTGTCAAAGATCAAAACTCTGCGGCTGGCCACCAGCTATATAGCCTACCTCATGGACCTGCTGGCCAAGACGACCAGAATGGGGAGACAGAGGCCTTTACGCAGACATCAAAAAGACAGATTTGAAGAGAGAGAGAGAAGAAATGACGACTTTTGAAGCCACAGTTTGCAGTACGATAGAACAAGGAGGACTGGTTGGCCGCAACATGTCTTGGCTCTGAGCTAAACAGGAACCTTGGGGA
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     455     118 
                                               BLH MIN     413      73 
                                               BLH MPR     293      73 
                                               BLH OVR     455     248 
                                               ORF LNG     455       5 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 3e-010     NP_509367.1 Helix Loop Helix containing protein HLH-8 (20.5 kD) (hlh-8) [Caenorhabditiselegans] ==================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Sp ==== 2e-010     XP_001175808.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 3e-016     NP_001071729.1 transcription factor protein [Ciona intestinalis] ==============================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 1e-019     NP_609370.2 CG18144-PA [Drosophila melanogaster] -------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ag ---- 4e-021     XP_313672.4 AGAP004386-PA [Anopheles gambiae str. PEST] ---------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Bt ==== 1e-037     NP_001069229.1 heart and neural crest derivatives expressed 1 [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Cf ---- 4e-056     XP_849189.1 PREDICTED: similar to heart and neural crest derivatives expressed transcript 2 [Canis familiaris] --------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Gg ==== 1e-066     NP_990297.1 HAND2 [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 2e-076     NP_034532.3 heart and neural crest derivatives expressed transcript 2 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 2e-076     NP_068808.1 basic helix-loop-helix transcription factor HAND2 [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dr ==== 1e-077     NP_571701.2 heart and neural crest derivatives expressed transcript 2 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 4e-087     NP_001093695.1 heart and neural crest derivatives expressed 2 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 3e-090     NP_001107665.1 heart and neural crest derivatives expressed 2 [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8824088.5   TGA------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------TGA------------TAA------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------------------------TGA------------------------------------------------------------------TAA------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ...
  5   1   2       bld Ga12      out                        XL213i17.5p CATGAGTGGGAGGCATCACTAATCTCCATGCCGACAAAGAGACCAGAGAGGACAGATGTGCAGCCCAGCAGTGGCCTCTACCACCTGTTTTGTCCGTGGGGTGAATCGGGATCAGGGAATGGGAGCCGCTCGCACTGAAAGCTCCTCACTCAGCCTTTACTGCAGGGACGTCCCATTGGAGATTATGGAGCTGGTGTAACTATTCAGAGATCGCGCATGCAGCTCTTCTACGGGCACAATCGCACAGGAGCCAAATGAGAGCATGTCCCGGCTTACTTGAAATCGCAGCGTCTGCAACGTTATTGCTGCTGCTTCTCACACACACTCTGTTCAGAAAACGTTTCGATAATAAGAGTGAGAGAGACTGACTGTGGATTTATTAATGGAGAGCCAGGGATAACCTATATTTAATACATAGATTGCCGGCGGGAGGACAAGACTATAGTGTAGCTGACATGAGTCTGGTTGGGGGGTTTCCTCACCACTCAGTGGTGCACCATGACGGTTATCCTTTTGCAGCTGCTGCAGCCGCCAGTCGCTGCCACGAAGAGAACCCTTATTTCCACGGCTGGCTAATTAGTCACCCCGAAATGTCTCCCCCTGACTACAGCATGGCACCGTCTTACAGCCCGGAGTACGCCAATGGCGCGGCCGGCCTGGACCACTCCCATTACGGGGGAGTCCCGGGNAAGCGGCGCAGGAGGCTTGATGCAACGG
  5   1   2      seed Int2 5x                         IMAGE:8824088.5p                                                                                                                                                                                  CCGCGCGGACGCCAGAAGAGCTGACGAGTCGCTTCGTCCCTGCAGCTCTTCTACGGGCACAATCGCACAGGAGCCAAATGAGAGCATGTCCCGGCTTACTTGAAATCGCAGCGTCTGCAACGTTATTGCTGCTGCTTCTCACACACACTCTGTTCAGAAAACGTTTCGATAATAAGAGTAAGAGAGACTGACTGTGGATTTATTAATGGAGAGCCAGGGATAACCTATATTTAATACATAGATTGCCGGCGGGAGGACAAGACTATAGTGTAGCTGACATGAGTCTGGTTGGGGGGTTTCCTCACCACTCAGTGGTGCACCATGACGGTTATCCTTTTGCAGCTGCTGCTGCAGCCGCTAGTCGCTGCCACGAAGAGAACCCTTATTTCCACGGCTGGCTAATCAGTCACCCCGAAATGTCTCCCCCCGACTACAGCATGGCACCGTCTTACAGCCCGGAGTACGCCAATGGCGCGGCCGGCCTGGACCACTCCCATTACGGGGGAGTCCCGGGAAGCGGCGCAGGAGGCTTGATGCAACGGCCTGTAAAGCGAAGGGGGACCGCTAACCGCAAGGAAAGGCGCAGGACTCAAAGCATCAACAGCGCCTTCTCAGAGCTGCGGGATTGTATCCCCAATGTGCCGGCCGATACCAAACTGTCAAAGATCAAAACTCTGCGGCTGGCCACCAGCTATATAGCCTACCTCATGGACCTGCTGGCCAAGACGACCAGAATGGGGAGACAGAGGCCTTTACGCAGACATCAAAAAGACAGATTTGaagagagagagagaagaAATGACGACTTTTGAAGCCACAGTTTGCAGTACGATAGAACAAGGAGGACTGGTTGGCCGCAACATGTCTTGGCTCTGAGCTAAACAGGAACCTTGGGGAATTGAGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)