Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL202d12.3                            4 END     2         100       50                platelet-derived growth factor A chain short form precursor

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL047l21.5                            2 PI      94        283      550                platelet-derived growth factor A chain, long form [Xenopus laevis]

 This cluster: approximate FL confidence score = 62%

 1012802264 Xl3.1-XL202d12.5 - 2 ESTs
                                                                       .........-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL202d12.5                                                                                                                                                                                                                                                                                                                                                                                            CAGCGTTGTGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCAGAGACGCCAGTGTGTTCCATCTGCCGCAAAGGGAGCCGCTGTTCGTGTTTGGAAAGTTCATTCACCCTGCTCTTTGCCTGCTTTGTGCTAATAACGCTGGATTGAGAGGCGGCGCAGAAGGAGACAGGTGATGGGCGTTTCACTGGATCCGTTGGGCTGATCCGAGCGCTAAACCATGCGCATCCTGCGCCTCATCCTCTGCTGAAGCCTCAGCCGGCCGGAGTGGATTTGAAAGCTGCGATTTGCTGGGCTGTTGTTTTGCCCCTGAGGGATGTTACTGACTCCCCCGGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCGTTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTCTTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAGCGACCTGCAGCGTCTCCTGGACATTGATTCCGTAGGAGGAGGCGAGGATGCTTCTGCAGCCAACATAAGATCACAAAAACACGACTTCCATCATAATAGGCTGGTGCCAGAAAAGCGCTCCGTTCCCAGTCGCAGAAAAAGAAGTGTTGAAGAAGCAGTCCCTGCTATCTGTAAAACAAGAACTGTTATATACGAGATACCTCGTAGCCAAATTGATCCAACATCTGCCAATTTTCTGATCTGGCCTCCATGCGTGGAGGTGAAACGATGCACGGGATGCTGCAACACCAGCAGTGTCAAGTGCCAGCCATCAAGGATACACCACAGGAGTGTCAAGGTGGCAAAAGTAG
                                                  Xl3.1-CHK-1012718128                                                                                                                                                                                                                                                                                                                                                                                                  TGTGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCAGAGACGCCAGTGTGTTCCATCTGCCGCAAAGGGAGCCGCTGTTCGTGTTTGGAAAGTTCATTCACCCTGCTCTTTGCCTGCTTTGTGCTAATAACGCTGGATTGAGAGGCGGCGCAGAAGGAGACAGGTGATGGGCGTTTCACTGGATCCGTTGGGCTGATCCGAGCGCTAAACCATGCGCATCCTGCGCCTCATCCTCTGCTGAAGCCTCAGCCGGCCGxxxxGxATTTGAAAGCTGCGATTTGCTGGGCTGTTGTTTTGCCCCTGAGGGATGTTACTGACTCCCCCGGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCGTTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTCTTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAGCGACCTGCAGCGTCTCCTGGACATTGATTCCGTAGGAGGAGGCGAGGATGCTTCTGCAGCCAACATAAGATCACAAAAACACGACTTCCATCATAATAGGCTGGTGCCAGAAAAGCGCTCCGTTCCCAGTCGCAGAAAAAGAAGTGTTGAAGAAGCAGTCCCTGCTATCTGTAAAACAAGAACTGTTATATACGAGATACCTCGTAGCCAAATTGATCCAACATCTGCCAATTTTCTGATCTGGCCTCCATGCGTGGAGGTGAAACGATGCACGGGATGCTGCAACACCAGCAGTGTCAAGTGCCAGCCATCAAGGATACACCACAGGAGTGTCAAGGTGGCAAAAGTAGAATATG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                 1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     407     112                                                                                                                                                                                                                                                                                                                                                                                            
                                               BLH MIN     314      59                                                                                                                                                                                                                                                                                                                                                                                            
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dm ---- 3e-008     NP_523407.1 CG7103-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dr ---- 3e-045     NP_919407.1 platelet-derived growth factor alpha polypeptide; Platelet-derived growth factorA [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Bt ==== 2e-060     NP_001068699.1 platelet-derived growth factor alpha polypeptide [Bos taurus] ====================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 2e-060     NP_002598.4 platelet-derived growth factor alpha isoform 1 preproprotein [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Gg ==== 1e-061     NP_989637.1 platelet-derived growth factor alpha polypeptide [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 1e-062     NP_032834.1 platelet derived growth factor, alpha [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 1e-067     XP_848598.1 PREDICTED: similar to Platelet-derived growth factor A chain precursor (PDGF A-chain) (Platelet-derived growth factor alpha polypeptide) (PDGF-1) [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 8e-084     AAI58257.1 Unknown (protein for MGC:185184) [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 4e-090     NP_001081304.1 platelet-derived growth factor A chain, long form [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL202d12.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   2       bld Ga12 5g3  out                        XL202d12.5p                                                                                                                                                                                                                                                                                                                                                                                            CAGCGTTGTGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCAGAGACGCCAGTGTGTTCCATCTGCCGCAAAGGGAGCCGCTGTTCGTGTTTGGAAAGTTCATTCACCCTGCTCTTTGCCTGCTTTGTGCTAATAACGCTGGATTGAGAGGCGGCGCAGAAGGAGACAGGTGATGGGCGTTTCACTGGATCCGTTGGGCTGATCCGAGCGCTAAACCATGCGCATCCTGCGCCTCATCCTCTGCTGAAGCCTCAGCCGGCCGAGTGGATTTANAAAGCTGCGATTTGCTGGGCTGTTGTTTTGCCCCTGAGGGATGTTACTGACTCCCCCGGCTACNGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCGTTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTCTTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCA
  5   1   2      seed Tbd7 5g3  out                        XL068m14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGCCGAGTGGATTTGAAAGCTGCGATTTGCTGGGCTGTTGTTTTGCCCCTGAGGGATGTTACTGACTCCCCCGGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCGTTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTCTTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAGCGACCTGCAGCGTCTCCTGGACATTGATTCCGTAGGAGGAGGCGAGGATGCTTCTGCAGCCAACATAAGATCACAAAAACACGACTTCCATCATAATAGGCTGGTGCCAGAAAAGCGCTCCGTTCCCAGTCGCAGAAAAAGAAGTGTTGAAGAAGCAGTCCCTGCTATCTGTAAAACAAGAACTGTTATATACGAGATACCTCGTAGCCAAATTGATCCAACATCTGCCAATTTTCTGATCTGGCCTCCATGCGTGGAGGTGAAACGATGCACGGGATGCTGCAACACCAGCAGTGTCAAGTGCCAGCCATCAAGGATACACCACAGGAGTGTCAAGGTGGCAAAAGTAGAATATGTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)