Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7980327.5                       6 END     1          50       16                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:5079754.5                       5 END     1          50       20                (no blast hit)

 This cluster: approximate FL confidence score = 85%

 1012802268 Xl3.1-IMAGE:4959608.5 - 2 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:4959608.5 TGCACAGATAAAAAGCGTTACAGCCTGCAGCACCTCGGACAGTGCAGGAGAGCGCGAGCAGCAGCAGCAGCAGCAGCACCTCGGACAGTGCCAGACACAGCGAGCGCCAAAGCATTCAGCCCAGACTCACTGGGACCGACCCAACATGCCTAAAGGTTTCCTGGTCAAGCGCAACAGGAAGTCCCCGCCGGTGTCCTACCGAGTGCGGGAAGATGAGGAGAACCGCGGGGAGTCGCTCCCGGGCTGGATGCTCTTAGCGACCATGTGTCCCACCGGCGGGGCCCCACCTCCTTCCAGTCCCGAAAGACTCGCCTCCGCGGCCCCATCCTGCAACAACCCCCGGCCGCCCCCCGCCGGTCAGTTCGGGAACCCCGAGGCGGTGCCGCAGACTCTGTACAGCCCGACCCGCCCGGTCAGCCGGGAGCAGCGCGAGAGGAAATACCTGGGTTCCCCGGTGTCTGCAGAGTCTTTCCCGGGCCTGGGCAGCTCCAGCGAGGCGCTCCTCTTCCCTCCCACGGGCACTGCCAATGGGCATCACGGACTGGCGCTCCTGCCCCCGGTCTCCTCCTCCTCTTCCATCAGCCGCACTCACGGCAAGAGACCGGCCCCCGAGCCCGACGTTAAAGCCGGCGCTGCCCCCGGCACTGCCTGTAAACCCCCCGCCGCCAAGAAAACCAAGCCATCCGCAGTTTGACTTTGAGGACGAGGTGACACATCCCCGGTGCTCGGGCTGAAAATCAGGAGGACGGTGGAGCTCCCGCCTCGTGCCCAGCTCGGCCCCGACCCTGGCGAGTCTCTGCAGTGTGTANGAGATACACGACCCTCTCCTGCACACAAATGCTCAGATCTCGG
                                                  Xl3.1-CHK-1012715253       GATAAAAAGCGTTACAGCCTGCAGCACCTCGGACAGTGCAGGAGAGCGCGAGCAGCAGCAGCAGCAGCAGCACCTCGGACAGTGCCAGACACAGCGAGCGCCAAAGCATTCAGCCCAGACTCACTGGGACCGACCCAACATGCCTAAAGGTTTCCTGGTCAAGCGCAACAGGAAGTCCCCGCCGGTGTCCTACCGAGTGCGGGAAGATGAGGAGAACCGCGGGGAGTCGCTCCCGGGCTGGATGCTCTTAGCGACCATGTGTCCCACCGGCGGGGCCCCACCTCCTTCCAGTCCCGAAAGACTCGCCTCCGCGGCCCCATCCTGCAACAACCCCCGGCCGCCCCCCGCCGGTCAGTTCGGGAACCCCGAGGCGGTGCCGCAGACTCTGTACAGCCCGACCCGCCCGGTCAGCCGGGAGCAGCGCGAGAGGAAATACCTGGGTTCCCCGGTGTCTGCAGAGTCTTTCCCGGGCCTGGGCAGCTCCAGCGAGGCGCTCCTCTTCCCTCCCACGGGCACTGCCAATGGGCATCACGGACTGGCGCTCCTGCCCCCGGTCTCCTCCTCCTCTTCCATCAGCCGCACTCACGGCAAGAGACCGGCCCCCGAGCCCGACGTTAAAGCCGGCGCTGCCCCCGGCACTGCCTGTAAACCCCCCGCCGCCAAGAAAACCAAGCCATCCGCAGTTTGACTTTGAGGACGAGGTGACACATCCCCGGTGCTCGGGCTGAAAATCAGGAGGACGGTGGAGCTCCCGCCTCGTGCCCAGCTCGGCCCCGACCCTGGCGAGTCTCTGCAGTGTGTANGAGATACACGACCCTCTCCTGCACACAAATGCTCAGA
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     145      92 
                                               BLH MIN     145      36 
                                               BLH MPR     145      36 
                                               BLH OVR     145     170 
                                               CDS MIN     145      36 
                                               ORF LNG     145       5 
                                                                                                                                                                                                                        
                                                                                                                                                                                                                        PREDICTED = Cf ==== 7e-012     XP_547774.1 PREDICTED: similar to insulinoma-associated protein IA-6 [Canis familiaris] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                        PROTEIN === Dr ==== 5e-027     NP_955952.1 insulinoma-associated 1 [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                        PROTEIN === Bt ==== 3e-027     NP_001094700.1 insulinoma-associated 1 [Bos taurus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                        PROTEIN === Hs ==== 2e-028     NP_002187.1 insulinoma-associated 1 [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                        PROTEIN === Mm ==== 6e-030     NP_058585.2 insulinoma-associated 1 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                        PROTEIN === Xt ==== 1e-088     NP_001076827.1 insulinoma-associated 1 [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                        PROTEIN === Xl ==== 4e-106     NP_001104189.1 insuloma-associated 1 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:4959608.5                                                                                                                                                  ATG---------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---TGA
                                                                   ORF                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   2      seed Emb4 5g3  out                   IMAGE:4959608.5p TGCACAGATAAAAAGCGTTACAGCCTGCAGCACCTCGGACAGTGCAGGAGAGCGCGagcagcagcagcagcagcagcaCCTCGGACAGTGCCAGACACAGCGAGCGCCAAAGCATTCAGCCCAGACTCACTGGGACCGACCCAACATGCCTAAAGGTTTCCTGGTCAAGCGCAACAGGAAGTCCCCGCCGGTGTCCTACCGAGTGCGGGAAGATGAGGAGAACCGCGGGGAGTCGCTCCCGGGCTGGATGCTCTTAGCGACCATGTGTCCCACCGGCGGGGCCCCACCTCCTTCCAGTCCCGAAAGACTCGCCTCCGCGGCCCCATCCTGCAACAACCCCCGGCCGCCCCCCGCCGGTCAGTTCGGGAACCCCGAGGCGGTGCCGCAGACTCTGTACAGCCCGACCCGCCCGGTCAGCCGGGAGCAGCGCGAGAGGAAATACCTGGGATCCCCGGTGTCTGCAGAGTCTTTCCCGGGCCTGGGCAGCTCCAGCGAGGCGCTCCTCTTCCCTCCCACCAGCACTGCCAATGGGCATC
  3  -1   2       bld Bla2      out                   IMAGE:7296076.3p                                                                                                                                                                                                                                 GCGGGGAGTCGCTCCCGGGCTGGATGCTCTTAGCGACCATGTGTCCCACCGGCGGGGCCCCACCTCCTTCCAGTCCCGAAAGACTCGCCTCCGCGGCCCCATCCTGCAACAACCCCCGGCCGCCCCCCGCCGGTCAGTTCGGGAACCCCGAGGCGGTGCCGCAGACTCTGTACAGCCCGACCCGCCCGGTCAGCCGGGAGCAGCGCGAGAGGAAATACCTGGGTTCCCCGGTGTCTGCAGAGTCTTTCCCGGGCCTGGGCAGCTCCAGCGAGGCGCTCCTCTTCCCTCCCACGGGCACTGCCAATGGGCATCACGGACTGGCGCTCCTGCCCCCGGTCTCCTCCTCCTCTTCCATCAGCCGCACTCACGGCAAGAGACCGGCCCCCGAGCCCGACGTTAAAGCCGGCGCTGCCCCCGGCACTGCCTGTAAACCCCCCGCCGCCAAGAAAACCAAGCCATCCGCAGTTTGACTTTGAGGACGAGGTGACACATCCCCGGTGCTCGGGCTGAAAATCAGGAGGACGGTGGAGCTCCCGCCTCGTGCCCAGCTCGGCCCCGACCCTGGCGAGTCTCTGCAGTGTGTANGAGATACACGACCCTCTCCTGCACACAAATGCTCAGATCTCGGTAGAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)