Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 85%

 1012802293 Xl3.1-XL073a16.5 - 2 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL073a16.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGAAGATTTAACAGTCTCCTTCTCTATCTCTCCTTCTGTAGCTATCTCTCCTCTGCCTGGATCTCTCTCCCCTAACCAGTCTCTACTACTCAAATCTCAAAAGCCTGGAGGATATTACTTTGAGGCTGATCCATTTGTTTGCCCGCAGCTAAGTGCAGTTCAGGAAGACACTGTCAGCACAAGGGATGTTTCTAGACAAATGTGAAGGAGATTTGTGTGACTTGAGGGAAGACGGCAGCACACCAACGCGTGGCACTCCTGAGGAGGATAATGAGATACCTAAAAAGAAACACCGCAGGAATCGAACAACATTCACAACCTACCAGCTTCATGAATTAGAGCGTGCCTTTGAGCGTTCACACTATCCTGATGTATACAGTCGAGAAGAGCTAGCTATGAAGGTCAGCCTGCCAGAGGTTCGAGTTCAGGTTTGGTTCCAGAATAGACGAGCAAAATGGAGGCGGCAAGAGAAACTGGAGTCTTCCTCTAGCACACTACATGATTCCCCACTACTATCTTTCTCAAGATCCCCAAGAGCTACAACTATGGGGCCTCTGAGCAATACTCTTCCTCTGGAATCCTGGCTCACTTCACCAATCTCAGGGACTACCACCATCCACAGTATGCCAGCATTCATGGCTCCTTCCCAGGCCCTTCAGCCAACTTACCCAAGTCACACATTTTTGAACAGTGGCCCTGCAATGACCCCTATCCAACCTCTCAGCAGTGCTCCTTATCATCAGTGTATGGGGGGATTTGCGGACAAATTTCCCTTAGAGGAAATGGATCAAAGAAGTTCAAGCATTGCTGCACTGAGAATGAAGGCAAAGGAGCACATCCAGACGATAGATAAAACATGGCAGCCAATCTGATCAAAATAGCTTTTACGAAACGCTATACCTCAACTTTTGACTTCAAAATCGCAATGTTCTGTTTTGAAGTCTAGCATTCTTAGACCTGGGTGTATTCAAGCCAAAGCAGACTTTTGACAGAATTATGGAGTATGCTATAGAGCTTACATAAGATGACCTGTTTATTTGTAGGTGGTCTTAAGCTGAATGTGACTTTTAAATTGGTGTCAGCACGGTTAAGAAAAAGAGACTTGTTTGTTAGAAGCTGATGTCCGTGTTGTAGTTTTACTTCATTGGGTCGGTAAATCAGTATTTAAGAAGAAAAACAATAAACCN
                                                  Xl3.1-CHK-1012716091                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTTAACAGTCTCCTTCTCTATCTCTCCTTCTGTAGCTATCTCTCCTCTGCCTGGATCTCTCTCCCCTAACCAGTCTCTACTACTCAAATCTCAAAAGCCTGGAGGATATTACTTTGAGGCTGATCCATTTGTTTGCCCGCAGCTAAGTGCAGTTCAGGAAGACACTGTCAGCACAAGGGATGTTTCTAGACAAATGTGAAGGAGATTTGTGTGACTTGAGGGAAGACGGCAGCACACCAACGCGTGGCACTCCTGAGGAGGATAATGAGATACCTAAAAAGAAACACCGCAGGAATCGAACAACATTCACAACCTACCAGCTTCATGAATTAGAGCGTGCCTTTGAGCGTTCACACTATCCTGATGTATACAGTCGAGAAGAGCTAGCTATGAAGGTCAGCCTGCCAGAGGTTCGAGTTCAGGTTTGGTTCCAGAATAGACGAGCAAAATGGAGGCGGCAAGAGAAACTGGAGTCTTCCTCTAGCACACTACATGATTCCCCACTACTATCTTTCTCAAGATCCCCAAGAGCTACAACTATGGGGCCTCTGAGCAATACTCTTCCTCTGGAATCCTGGCTCACTTCACCAATCTCAGGGACTACCACCATCCACAGTATGCCAGCATTCATGGCTCCTTCCCAGGCCCTTCAGCCAACTTACCCAAGTCACACATTTTTGAACAGTGGCCCTGCAATGACCCCTATCCAACCTCTCAGCAGTGCTCCTTATCATCAGTGTATGGGGGGATTTGCGGACAAATTTCCCTTAGAGGAAATGGATCAAAGAAGTTCAAGCATTGCTGCACTGAGAATGAAGGCAAAGGAGCACATCCAGACGATAGATAAAACATGGCAGCCAATCTGATCAAAATAGCTTTTACGAAACGCTATACCTCAACTTTTGACTTCAAAATCGCAATGTTCTGTTTTGAAGTCTAGCATTCTTAGACCTGGGTGTATTCAAGCCAAAGCAGACTTTTGACAGAATTATGGAGTATGCTATAGAGCTTACATAAGATGACCTGTTTATTTGTAGGTGGTCTTAAGCTGAATGTGACTTTTAAATTGGTGTCAGCACGGTTAAGAAAAAGAGACTTGTTTGTTAGAAGCTGATGTCCGTGTTGTAGTTTTACTTCATTGGGTCGGTAAATCAGTATTTAAGAAGAAAAACAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN     186      76                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     186     134                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     186       8                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 5e-028     NP_492246.2 C.Elegans Homeobox family member (ceh-8) [Caenorhabditis elegans] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 4e-033     NP_001027683.1 Prx1 protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 3e-038     XP_313972.3 AGAP005096-PA [Anopheles gambiae str. PEST] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Sp ---- 1e-038     XP_001177341.1 PREDICTED: similar to retinal homeobox protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-039     NP_726006.2 CG10052-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Bt ---= 6e-043     NP_872594.1 retina and anterior neural fold homeobox 2 [Bos taurus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Cf ---= 4e-045     XP_854816.1 PREDICTED: similar to Retinal homeobox protein Rx1 [Canis familiaris] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Mm ---- 1e-066     NP_038861.2 retina and anterior neural fold homeobox [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Hs ---- 5e-069     NP_038463.2 retina and anterior neural fold homeobox [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dr ---- 1e-085     NP_571300.2 retinal homeobox gene 1 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Gg ==== 8e-091     XP_001232119.1 PREDICTED: retina and anterior neural fold homeobox [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 8e-133     NP_001089185.1 retinal homeobox-like transcription factor [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL073a16.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAA---------------------------TAG------------------------------------------------------------------------------------------------------------TAA---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------ATG------------------------------------------ATG---------------------------------ATG---------------------------------ATG------------------------------------------------TGA------TAG---------------------------------------------------------------------------------------------------------TGA------------------------------------TGA------------TAG------------TGAATGTGA------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ...
  5   1   2      seed Tbd7      in                         XL073a16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGAAGATTTAACAgtctccttctctatctctccttctgtagctatctctcctctGCCTGGATCTCTCTCCCCTAACCAGTCTCTACTACTCAAATCTCAAAAGCCTGGAGGATATTACTTTGAGGCTGATCCATTTGTTTGCCCGCAGCTAAGTGCAGTTCAGGAAGACACTGTCAGCACAAGGGATGTTTCTAGACAAATGTGAAGGAGATTTGTGTGACTTGAGGGAAGACGGCAGCACACCAACGCGTGGCACTCCTGAGGAGGATAATGAGATACCTAAAAAGAAACACCGCAGGAATCGAACAACATTCACAACCTACCAGCTTCATGAATTAGAGCGTGCCTTTGAGCGTTCACACTATCCTGATGTATACAGTCGAGAAGAGCTAGCTATGAAGGTCAGCCTGCCAGAGGTTCGAGTTCAGGTTTGGTTCCAGAATAGACGAGCAAAATGGAGGCGGCAAGAGAAACTGGAGTCTTCCTCTAGCACACTACATGATTCCCCACTACTATCTTTCTCAAGATCCCCAAGAGCTACAACTATGGGGCCTCTGAGCAATACTCTTCCTCTGGAATCCTGGCTCACTTCACCAATCTCAGGGACTACCACCATCCACAGTATGCCAGCATTCATGGCTC
  3   1   2       bld Tbd7      in                         XL073a16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTAGCACACTACATGATTCCCCACTACTATCTTTCTCAAGATCCCCAAGAGCTACAACTATGGGGCCTCTGAGCAATACTCTTCCTCTGGAATCCTGGCTCACTTCACCAATCTCAGGGACTACCACCATCCACAGTATGCCAGCATTCATGGCTCCTTCCCAGGCCCTTCAGCCAACTTACCCAAGTCACACATTTTTGAACAGTGGCCCTGCAATGACCCCTATCCAACCTCTCAGCAGTGCTCCTTATCATCAGTGTATGGGGGGATTTGCGGACAAATTTCCCTTAGAGGAAATGGATCAAAGAAGTTCAAGCATTGCTGCACTGAGAATGAAGGCAAAGGAGCACATCCAGACGATAGATAAAACATGGCAGCCAATCTGATCAAAATAGCTTTTACGAAACGCTATACCTCAACTTTTGACTTCAAAATCGCAATGTTCTGTTTTGAAGTCTAGCATTCTTAGACCTGGGTGTATTCAAGCCAAAGCAGACTTTTGACAGAATTATGGAGTATGCTATAGAGCTTACATAAGATGACCTGTTTATTTGTAGGTGGTCTTAAGCTGAATGTGACTTTTAAATTGGTGTCAGCACGGTTAAGAAAAAGAGACTTGTTTGTTAGAAGCTGATGTCCGTGTTGTAGTTTTACTTCATTGGGTCGGTAAATCAGTATTTAAGAAGAAAAACAATAAACCNAACT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)