Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:3401128-IMAGp.5                 7 END     1          33       14                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012802300 Xl3.1-IMAGE:6950177.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6950177.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCCGGAATTCCTCGGGGATTTCTGGGACTAGAAGAAACAACATGGCGACACAACAGGATCAGCATCTCCTTCGCTTACTAACTCCTGTCGCTAAACTTTATACAGGCAAACAGGCTCTTGCAGTTATATCAGAGGGTCTGGAATGCTTTGGTGGACAGGGATACATGGAGGACACAGGACTGCCTGCTATGCTCAGAGATGCTCAGGTTCTGACTATCTGGGAAGGGACAACAAACATCTTGTCTTTAGATGTACTGCGGTCGGTCATCAAGAGCAATGGGAAAGTGCTCAGTGCTTTCTTTTCAACTGCCCAGGAAAAACTGGATCGTGCATCGTGTGTCCCCAGCTTGTCGCAGGCAGCAAAGCACACTATGAAAGCTTTAAACAAACTTATGGCCTTCACGCAAGAAGCTGGACAGCTCGGGGGCAACTATATGGAACTTGCTGCACGAGACTTCGCTTACAGCCTGGCTAAAATCTATATTGGCACCCTTTTATTGGACCATGCAGCCTGGGAAGGAGCATCTGCCACAGACATCTACTCTGCTCAGAGGTGGAGTGACCAGGATCTCTGCCCCGTGGATAAAGCCAAGGCATCAGGCTGTTATGACTCTGAGTCAATGTCCCTAGACAGACAGTTAGTGTATGACAATAGCCCTCTTTTTAAAAGGAAAATTATAAAACATCCACAGCAAAAGTAACATTGATAATCTTCAGTCGTGCACAATATTTGTATCAGAAAATTATAGTATATAAAGAGAGGATAATGTATCACCTACCATAATTTATAAGGCTAAGTCTCCAAGGAGTTTCATGGCCATAGAAAAAACCAGGGGAATGGAACGCTGCGGTAACTTCTAGTTTTTTTTATTATAGAATTTGAGTATGATATAATTTATAATGTATTAGTACAAAAAAACTATTTTGAACTATAATTCTGCCCCATCTCCTTCTTCCCCCCCCCCAATAGTTTCTTATCAGCAGTTTATGAAGTAAATGAAAAACAATATATGGTGTTACCCAATTAATATGCAAACGGCTGCTAAATATCCAAAATAGGATCAAAAATTAAACTTAAAATCACCAAGGATATGATATAAGAACTTTCAGTTGAAAACTCCTATTCAAAACTTGATTAACTAAAAATGTGAAAAAAAGAAAATGCAACAAATTTGCATTCTATTATC
                                                  Xl3.1-CHK-1012713094                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATTCCTCGGGGATTTCTGGGACTAGAAGAAACAACATGGCGACACAACAGGATCAGCATCTCCTTCGCTTACTAACTCCTGTCGCTAAACTTTATACAGGCAAACAGGCTCTTGCAGTTATATCAGAGGGTCTGGAATGCTTTGGTGGACAGGGATACATGGAGGACACAGGACTGCCTGCTATGCTCAGAGATGCTCAGGTTCTGACTATCTGGGAAGGGACAACAAACATCTTGTCTTTAGATGTACTGCGGTCGGTCATCAAGAGCAATGGGAAAGTGCTCAGTGCTTTCTTTTCAACTGCCCAGGAAAAACTGGATCGTGCATCGTGTGTCCCCAGCTTGTCGCAGGCAGCAAAGCACACTATGAAAGCTTTAAACAAACTTATGGCCTTCACGCAAGAAGCTGGACAGCTCGGGGGCAACTATATGGAACTTGCTGCACGAGACTTCGCTTACAGCCTGGCTAAAATCTATATTGGCACCCTTTTATTGGACCATGCAGCCTGGGAAGGAGCATCTGCCACAGACATCTACTCTGCTCAGAGGTGGAGTGACCAGGATCTCTGCCCCGTGGATAAAGCCAAGGCATCAGGCTGTTATGACTCTGAGTCAATGTCCCTAGACAGACAGTTAGTGTATGACAATAGCCCTCTTTTTAAAAGGAAAATTATAAAACATCCACAGCAAAAGTAACATTGATAATCTTCAGTCGTGCACAATATTTGTATCAGAAAATTATAGTATATAAAGAGAGGATAATGTATCACCTACCATAATTTATAAGGCTAAGTCTCCAAGGAGTTTCATGGCCATAGAAAAAACCAGGGGAATGGAACGCTGCGGTAACTTCTAGTTTTTTTTATTATAGAATTTGAGTATGATATAATTTATAATGTATTAGTACAAAAAAACTATTTTGAACTATAATTCTGCCCCATCTCCTTCTTCCCCCCCCCCAATAGTTTCTTATCAGCAGTTTATGAAGTAAATGAAAAACAATATATGGTGTTACCCAATTAATATGCAAACGGCTGCTAAATATCCAAAATAGGATCAAAAATTAAACTTAAAATCACCAAGGATATGATATAAGAACTTTCAGTTGAAAACTCCTATTCAAAACTTGATTAACTAAAAATGTGAAAAAAAGAAAATGCAACAAATTTGCATTCTATTATCTAGACA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     2     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1
                                                                       ...PROTEIN --- Bt ---- 4e-007     NP_001071544.1 acyl-Coenzyme A dehydrogenase family, member 9 [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-007     NP_611409.1 CG7461-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 6e-008     NP_766266.3 very-long-chain acyl-CoA dehydrogenase VLCAD homolog [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 4e-009     XP_001921960.1 PREDICTED: similar to predicted protein [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 8e-027     XP_646730.1 hypothetical protein DDBDRAFT_0190990 [Dictyostelium discoideum AX4] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 2e-037     NP_001033379.1 Y45F3A.3b [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Sp ---- 1e-051     XP_001185668.1 PREDICTED: similar to LOC446287 protein, partial [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 5e-064     XP_415303.2 PREDICTED: similar to LOC446287 protein [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 6e-104     NP_001025577.1 MGC107841 protein [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xl ---- 2e-117     NP_001086464.1 hypothetical protein LOC446287 [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6950177.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------TAA---TGATAA------------------------------------TAG---------------TAA---------------------TAA---TAA------------------------------------------------------TAA------------------------------------------------------------------------------TAA---------------------------------------------------------------------------ATG------------TAA---------------TAA---------------------------------------------ATG---TAA------------------------------------TAA------ATGTGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   1       add Brn1      ?                     IMAGE:6950177.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCCGGAATTCCTCGGGGATTTCTGGGACTAGAAGAAACAACATGGCGACACAACAGGATCAGCATCTCCTTCGCTTACTAACTCCTGTCGCTAAACTTTATACAGGCAAACAGGCTCTTGCAGTTATATCAGAGGGTCTGGAATGCTTTGGTGGACAGGGATACATGGAGGACACAGGACTGCCTGCTATGCTCAGAGATGCTCAGGTTCTGACTATCTGGGAAGGGACAACAAACATCTTGTCTTTAGATGTACTGCGGTCGGTCATCAAGAGCAATGGGAAAGTGCTCAGTGCTTTCTTTTCAACTGCCCAGGAAAAACTGGATCGTGCATCGTGTGTCCCCAGCTTGTCGCAGGCAGCAAAGCACACTATGAAAGCTTTAAACAAACTTATGGCCTTCACGCAAGAAGCTGGACAGCTCGGGGGCAACTATATGGAACTTGCTGCACGAGACTTCGCTTACAGCCTGGCTAAAATCTATATTGGCACCCTTTTATTGGACCATGCAGCCTGGGAAGGAGCATCTGCCACAGACATCTACTCTGCTCAGAGGTGGAGTGACCAGGATCTCTGCCCCGTGGATAAAGCCAAGGCATCAGGCTGTTATGACTCTGAGTCAATGTCCCTAGACAGACAGTTAGTGTATGACAATAGCCCTCTTTTTAAAAGGAAAATTATAAAACATCCACAGCAAAAGTAACATTGATAATCTTCAGTCGTGCACAATATTTGTATCAGAAAATTATAGTATATAAAGAGAGGATAATGTATCACCTACCATAATTTATAAGGCTAAATTCTCCAAGGAGTTTCATGGCCATAAGAAAAACCAGGGGGAATGGAACCCCTGCGGTTAACCTTCTAGttttttttATTATAGAAATTTGAAGTTGGAAATAATTTTATAAAG
  3   1   2      seed Ov1  5g3  out                   IMAGE:5047578.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGTCAATGTCCCTAGACAGACAGTTAGTGTATGACAATAGCCCTCTTTTAAAAGGAAAATTATAAACATCCACAGCAAAAGTAACATTGATAATCTTCAGTCGTGCACAATATTTGTATCAGAAAATAATAGTATATAAAGAGAGGATAATGTATCACCTACCATAATTTATAAGGCTAAGTCTCCAAGGAGTTTCATGGCCATAGAAAAAACCAGGGGAATGGAACGCTGCGGTAACTTCTAGTTTTTTTTATTATAGAATTTGAGTATGATATAATTTATAATGTATTAGTACAAAAAAACTATTTTGAACTATAATTCTGCCCCATCTCCTTCTTCCCCCCCCCCAATAGTTTCTTATCAGCAGTTTATGAAGTAAATGAAAAACAATATATGGTGTTACCCAATTAATATGCAAACGGCTGCTAAATATCCAAAATAGGATCAAAAATTAAACTTAAAATCACCAAGGATATGATATAAGAACTTTCAGTTGAAAACTCCTATTCAAAACTTGATTAACT
  3   1   2       bld Emb1                            IMAGE:3401128.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGGTGTTACCCAATTAATATGCAAACGGCTGCTAAATATCCAAAATAGGATCAAAAATTAAACTTAAAATCACCAAGGATATGATATAAGAACTTTCAGTTGAAAACTCCTATTCAAAACTTGATTAACTAAAAATGTGAAAAAAAGAAAATGCAACAAATTTGCATTCTATTATCTAGACAAACGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)