Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6948544.3                       2 END     1          33       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6948544.3                       2 PI      82       1350     1572                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012802330 Xl3.1-IMAGE:8331149.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8331149.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAACAGACACAAGTCCAGAGCATAATGTCACAGAGAATGTTGCAAAAGATATTAAGGAAATATGCGAAAAAGTGGATTCTGGCCATTGTGCTAGCAGGCATGAAGGAAGGCCAAAGTCATTAAATATTCCCTCTGCCTCAAAGCCTGCCACTGAACTGCAAAGGGGCTATAAGGCAAAAGCTAGGACTCCAGAAGAAAGACAGAAGTGGGCGCCAGAACAGGTGTGTAACAGTGTGGAGCAACCAAGGAAACAGCAACGTTCTGACCTCAATGGACCTGTTGACAATAACAATGTTCAGGAGCAGACAAAGAAGGTGACTTCATTCCCAAGTTTTGTGGATGTTCCTGGCCCTTGTGAACCTGAAGACCTAATTGATGGAATTATCTTTGCTGCCAATTTCTTGGGATCCACACAGCTGCTGTCAGAACGCAACCCATCCAAAAACATCAGAATGATGCAGGCCCAAGAAGCTGTCAGCCGCGTCAAGAACTCTGAGGGAGATTCACAAACATTAACAGAAGTCGATCTTTTCATATCAACACAGAGGATTAAAGTATTAAATGCCGATACCCAGGAAACAATGATGGACCATGCACTACGGACAATCTCTTACATTGCAGACATTGGCAACATTGTTGTTTTAATGGCCCGGCGTCGCATGCCTAGATCAGCCTCCCAGGACTGTATAGAAACAACACCAGGAGCCCAGGAGGGAAAGAAACAGTATAAGATGATATGTCATGTATTTGAATCTGAGGATGCACAGCTTATTGCTCAGTCCATTGGCCAGGCATTTAGTGTAGCCTATCAGGAATTTTTACGAGCAAATGGCATTAATCCAGAAGACCTCAGTCAAAAAGAATACAGTGACATCATCAATACCCAAGAAATGTACAATGATGACCTCATTCACTTTTCAAATTCTGCCAACTGTAAAGAGCTGCAAGTGGAAAAGCTCAAAGGTGAAATCTTAGGCGTGGTAATAGTGGAGTCTGGCTGGGGATCTATTCTACCTACTGTCATTCTGGCAAATATGATGAATGGAGGCCCAGCAGCACGTTCTGGAAAGCTCAGTATTGGCGATCAAATTATGTCCATCAATGGGACGAGTTTAGTTGGTCTTCCTCTGGCAACTTGTCAAGGCATTATAAAGGGCCTAAAGAATCAAACACAACTAAAACTGAACATAGTGAGTTGTCCACCTGTCACTACTGTCCTCATTAAACGACCTGACCTTAAATACCAGCTGGGATTCAGTGTACAGAATGGAATAATCTGCAGCCTTATGAGGGGTGGAATAGCTGAGAGAGGNGGAGTCAGGGTTGGACACCGAATCATTGAGATCAATGGACAAAGTGTTGTTGCTACAGCCCATGAAAAAATTGTCCAAGCACTATCCAATTCCGTAGAGAGATTCACATGAAGACTATGCCAGCAGCAATGTTTAGACTTCTTACTGGACAGGAAACTCCACTCTACATATAAAA------------TGCCATCCATAACACATTTGCAGGCAAGATCAATAAATCTGCACCTCAAAAAGACACCGTGCATATGTATAT------------TTTTTTTNCATT
                                                  Xl3.1-CHK-1012713258                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACACAAGTCCAGAGCATAATGTCACAGAGAATGTTGCAAAAGATATTAAGGAAATATGCGAAAAAGTGGATTCTGGCCATTGTGCTAGCAGGCATGAAGGAAGGCCAAAGTCATTAAATATTCCCTCTGCCTCAAAGCCTGCCACTGAACTGCAAAGGGGCTATAAGGCAAAAGCTAGGACTCCAGAAGAAAGACAGAAGTGGGCGCCAGAACAGGTGTGTAACAGTGTGGAGCAACCAAGGAAACAGCAACGTTCTGACCTCAATGGACCTGTTGACAATAACAATGTTCAGGAGCAGACAAAGAAGGTGACTTCATTCCCAAGTTTTGTGGATGTTCCTGGCCCTTGTGAACCTGAAGACCTAATTGATGGAATTATCTTTGCTGCCAATTTCTTGGGATCCACACAGCTGCTGTCAGAACGCAACCCATCCAAAAACATCAGAATGATGCAGGCCCAAGAAGCTGTCAGCCGTGTCAAGAACTCTGAGGGAGATTCACAAACATTAACAGAAGTCGATCTTTTCATATCAACACAGAGGATTAAAGTATTAAATGCCGATACCCAGGAAACAATGATGGACCATGCACTACGGACAATCTCTTACATTGCAGACATTGGCAACATTGTTGTTTTAATGGCCCGGCGTCGCATGCCTAGATCAGCCTCCCAGGACTGTATAGAAACAACACCAGGAGCCCAGGAGGGAAAGAAACAGTATAAGATGATATGTCATGTATTTGAATCTGAGGATGCACAGCTTATTGCTCAGTCCATTGGCCAGGCATTTAGTGTAGCCTATCAGGAATTTTTACGAGCAAATGGCATTAATCCAGAAGACCTCAGTCAAAAAGAATACAGTGACATCATCAATACCCAAGAAATGTACAATGATGACCTCATTCACTTTTCAAATTCTGCCAACTGTAAAGAGCTGCAAGTGGAAAAGCTCAAAGGTGAAATCTTAGGCGTGGTAATAGTGGAGTCTGGCTGGGGATCTATTCTACCTACTGTCATTCTGGCAAATATGATGAATGGAGGCCCAGCAGCACGTTCTGGAAAGCTCAGTATTGGCGATCAAATTATGTCCATCAATGGGACGAGTTTAGTTGGTCTTCCTCTGGCAACTTGTCAAGGCATTATAAAGGGCCTAAAGAATCAAACACAACTAAAACTGAACATAGTGAGTTGTCCACCTGTCACTACTGTCCTCATTAAACGACCTGACCTTAAATACCAGCTGGGATTCAGTGTACAGAATGGAATAATCTGCAGCCTTATGAGGGGTGGAATAGCTGAGAGAGGNGGAGTCAGGGTTGGACACCGAATCATTGAGATCAATGGACAAAGTGTTGTTGCTACAGCCCATGAAAAAATTGTCCAAGCACTATCCAATTCCGTAGAGAGATTCACATGAAGACTATGCCAGCAGCAATGTTTAGACTTCTTACTGGACAGGAAACTCCACTCTACAT------------AGNCATTGCCATCCATAACACATTTGCAGGCAAGATCAATAAATCTGCACCTCAAAAAGACACCGTGCATATGTATATACAGNA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     0     1     1     1     1     1     1     1     1     1     1     1     1     1     0     1     1     1
                                                                       ...PROTEIN --- Ce ---- 3e-120     NP_001020996.1 abnormal cell LINeage family member (lin-10) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 6e-125     XP_310643.4 AGAP000449-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 5e-127     NP_573224.2 CG5675-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 1e-135     XP_001184612.1 PREDICTED: similar to adaptor protein X11alpha [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                   PREDICTED - Bt ---- 0          XP_593610.3 PREDICTED: similar to adaptor protein X11alpha [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                       PREDICTED - Dr ---- 0          XP_001924030.1 PREDICTED: similar to amyloid beta A4 precursor protein-binding, family A, member 2 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Hs ---- 0          NP_005494.2 amyloid beta A4 precursor protein-binding, family A, member 2; neuronalmunc18-1-interacting protein 2; X11-like protein;phosphotyrosine-binding/-interacting domain (PTB)-bearing protein;neuron-specific X11L protein; adapter protein X11beta [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Mm ---- 0          NP_031487.1 amyloid beta (A4) precursor protein-binding, family  A, member 2 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                               PREDICTED - Cf ---- 0          XP_545817.2 PREDICTED: similar to amyloid beta (A4) precursor protein-binding, family A, member 2 isoform 2 [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PREDICTED - Gg ---- 0          XP_413771.2 PREDICTED: similar to Mint2; neuronal munc18-1 binding protein [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Xl ---- 0          NP_001087166.1 MGC83599 protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8331149.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGATG---------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------ATG------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   1       add Egg1                               PBX0114C05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAACAGACACAAGTCCAGAGCATAATGTCACAGAGAATGTTGCAAAAGATATTAAGGAAATATGCGAAAAAGTGGATTCTGGCCATTGTGCTAGCAGGCATGAAGGAAGGCCAAAGTCATTAAATATTCCCTCTGCCTCAAAGCCTGCCACTGAACTGCAAAGGGGCTATAAGGCAAAAGCTAGGACTCCAGAAGAAAGACAGAAGTGGGCGCCAGAACAGGTGTGTAACAGTGTGGAGCAACCAAGGAAACAGCAACGTTCTGACCTCAATGGACCTGTTGACAATAACAATGTTCAGGAGCAGACAAAGAAGGTGACTTCATTCCCAAGTTTTGTGGATGTTCCTGGCCCTTGTGAACCTGAAGACCTAATTGATGGAATTATCTTTGCTGCCAATTTCTTGGGATCCACACAGCTGCTGTCAGAACGCAACCCATCCAAAAACATCAGAATGATGCAGGCCCAAGAAGCTGTCAGCCGTGTCAAGAACTCTGAGGGAGATTCACAAACATTAACAGAAGTGGATCTTTTCATATCAACA
  5   1   2       bld Ov1                             IMAGE:8331149.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACAGCTGCTGTCAGAACGCAACCCATCCAAAAACATCAGGATGATGCAGGCCCAAGAAGCTGTCAGCCGCGTCAAGAACTCTGAGGGAGATTCACAAACATTAACAGAAGTCGATCTTTTCATATCAACACAGAGGATTAAAGTATTAAATGCCGATACCCAGGAAACAATGATGGACCATGCACTACGGACAATCTCTTACATTGCAGACATTGGCAACATTGTTGTTTTAATGGCCCGGCGTCGCATGCCTAGATCAGCCTCCCAGGACTGTATAGAAACAACACCAGGAGCCCAGGAGGGAAAGAAACAGTATAAGATGATATGTCATGTATTTGAATCTGAGGATGCACAGCTTATTGCTCAGTCCATTGGCCAGGCATTTAGTGTAGCCTATCAGGAATTTTTACGAGCAAATGGCATTAATCCAGAAGACCTCAGTCAAAAAGAATACAGTGACATCATCAATACCCAAGAAATGTACAATGATGACCTCATTCACTTTTCAAATTCTGCCAACTGTAAAGAGCTGCAAGTGGAAAAGCTCAAAGGTGAAATCTTAGGCGTGGTAATAGTGGAGTCTGGCTGGGGATCTATTCTACCTACTGTCATTCTGGCAAATATGATGAATGGAGGCCCAGCAGCACGTTCTGGAAAGCTCAGTATTGGCGATC
  5   1   2      seed Ga18      out                      xlk61m18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCAATACCCAAGAAANGTACNATGATGACCTCATTCACTTTTCAAATTCTGCCAACTGTAAAGAGCTGCAAGTGGAAAAGCTCAAAGGTGAAATCTTAGGCGTGGTAATAGTGGAGTCTGGCTGGGGATCTATTCTACCTACTGTCATTCTGGCAAATATGATGAATGGAGGCCCAGCAGCACGTTCTGGAAAGCTCAGTATTGGCGATCAAATTATGTCCATCAATGGGACGAGTTTAGTTGGTCTTCCTCTGGCAACTTGTCAAGGCATTATAAAGGGCCTAAAGAATCAAACACAACTAAAACTGAACATAGTGAGTTGTCCACCTGTCACTACTGTCCTCATTAAACGACCTGACCTTAAATACCAGCTGGGATTCAGTGTACAGAATGGAATAATCTGCAGCCTTATGAGGGGTGGAATAGCTGAGAGAGGNGGAGTCAGGGTTGGACACCGAATCATTGAGATCAATGGACAAAGTGTTGTTGCTACAGCCCATGAAAAAATTGTCCAAGCACTATCCAATTCCGTAGAGAGATTCACATGAAGACTATGCCAGCAGCAATGTTTAGACTTCTTACTGGACAGGAAACTCCACTCTACATATAAAAAGAGNNAGNCATTGCCATCCATAACACATTTGCAGGCAAGATCAATAAATCTGCACCTCAAAAAGACACCGTGCATATGTATATACAGNATNNAtttttttttNCATTTCAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)