Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl255j18.3                           22 END     3           0       13                (no blast hit)
     20.67000000000000004    0Xl3.1-xl260e01.3                            9 END     3           0       33                ornithine decarboxylase 1 [Xenopus laevis]
     3   2.0    0Xl3.1-XL482b20ex.3                          3 END     3           0      100                ornithine decarboxylase 1 [Xenopus laevis]
     4   1.5    0Xl3.1-rxl242k08.3                           3 END     2           0       66                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     5   0.0    0Xl3.1-IMAGE:6633064.5                     212 PI      71        585     1532                (no blast hit)
     6   0.0    0Xl3.1-xl260e01.3                            9 PI      90       1663     1939                ornithine decarboxylase 1 [Xenopus laevis]
     7   0.0    0Xl3.1-XL482b20ex.3                          3 PI      88       1633     1944                ornithine decarboxylase 1 [Xenopus laevis]

 This cluster: approximate FL confidence score = 99%

 1012837201 Xl3.1-IMAGE:6859260.5.5 - 838 ESTs
                                                                       ......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6859260.5.5                                                                                                                                                             CTCATTCACAGTCCGCTCTCTGCTTTGCTGGTTCTAAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAGGAGCTTAATGTGGATATAATTGGTGTGAGTTTCCATGTTGGCAGTGGCTGCACTGATCCACAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGCTTTAACATGCATCTACTTGATATTGGTGGTGGATTCCCTGGTTCAGAGGATGTGAAACTGAAGTTTGAAGAGATCACATCTGTGATAAACCCAGCCCTGGATAAATACTTCCCAGCAGATTCTGGCGTTAAAATCATTGCAGAGCCTGGGAGATACTATGTTGCCTCATCTTTCACCCTGGCAGTTAATATCATTGCCAAGAAAGTTATGGTGAATGAGCAAAGTGGATCTGATGATGAAGAAGATGCTGCCAATGACAAAACTCTGATGTACTACGTCAATGATGGAGTGTATGGATCTTTCAACTGCATCTTGTTTGATCATGCACATGTCAAGCCAGTTCTAACAAAGAAACCCAAACCAGATGAGAAGTTCTACTCGAGCAGCATTTGGGGACCAACGTGTGATGGGCTGGATCGTATCGTAGAAAGGTTTGAGCTGCCGGAGCTGCAAGTTGGAGACTGGATGTTGTTTGAAAACATGGGTGCCTACACTGTTGCTGCAGCCTCGACATTCAATGGATTTCAGAGACCAACCCTTTATTATGTTATGTCAAGACCACACTGGCAACTGATGCATGATATTAAAGAACATGGCATTCTCCCTGAAGTACCAGATCTGAGTGCACTCCATGTATCCTGTGCTCAGGAGAGCGGAATGGAACTTGCACCTGCTGTCTGTACTGCTGCCAGCATCAATGTATAGGCTTATTAACAAAACTCTGTAGTTAAACTGCAACTTTAGCCTTGGGACCATTATTTAAAATTTAACTATTTTCATTTATTTTCCTAGCCTGTATTTGTCAGCATTAATGCAAAAAAATGGATGACTGCGAGATGGGGTCACATATCTGTGTTCCTATGGAAACTTTTTTTTTTTTTTCTAATGGTTTTTGAAGTATATTGAAGATGCTAATTATTTACTCAAGCATTTGTAGCTTTCTTCATTGACCAGTTTTACAAATAAAGAGTTAAAAACAAATAAAAGTAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012723234                                                                                                                                                                   CACAGTCCGCTCxxxxxTTxxxxGxTxxxxAAGTGTxAxxxxxGxxxxGCTGCTGTCCGAGGAGGTCTTTTTxTTTxTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAGGAGCTTAATGTGGATATAATTGGTGTGAGTTTCCATGTTGGCAGTGGCTGCACTGATCCACAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGCTTTAACATGCATCTACTTGATATTGGTGGTGGATTCCCTGGTTCAGAGGATGTGAAACTGAAGTTTGAAGAGATCACATCTGTGATAAACCCAGCCCTGGATAAATACTTCCCAGCAGATTCTGGCGTTAAAATCATTGCAGAGCCTGGGAGATACTATGTTGCCTCATCTTTCACCCTGGCAGTTAATATCATTGCCAAGAAAGTTATGGTGAATGAGCAAAGTGGATCTGATGATGAAGAAGATGCTGCCAATGACAAAACTCTGATGTACTACGTCAATGATGGAGTGTATGGATCTTTCAACTGCATCTTGTTTGATCATGCACATGTCAAGCCAGTTCTAACAAAGAAACCCAAACCAGATGAGAAGTTCTACTCGAGCAGCATTTGGGGACCAACGTGTGATGGGCTGGATCGTATCGTAGAAAGGTTTGAGCTGCCGGAGCTGCAAGTTGGAGACTGGATGTTGTTTGAAAACATGGGTGCCTACACTGTTGCTGCAGCCTCGACATTCAATGGATTTCAGAGACCAACCCTTTATTATGTTATGTCAAGACCACACTGGCAACTGATGCATGATATTAAAGAACATGGCATTCTCCCTGAAGTACCAGATCTGAGTGCACTCCATGTATCCTGTGCTCAGGAGAGCGGAATGGAxCTTxCxCCTGCTGTCTGTACTGCTGCCAGCATCAATGTATAGGCTTATTAACAAAACTCTGTAGTTAAACTGCAACTTTAGCCTTGGGACCATTATTTAAAATTTAACTATTTTCATTTATTTTCCTAGCCTGTATTTGTCAGCATTAATGCAAAAAAATGGATGACTGCGAGATGGGGTCACATATCTGTGTTCCTATGGAAACTTTTTTTTTTTTTTCTAATGGTTTTTGAAGTATATTGAAGATGCTAATTATTTACTCAAGCATTTGTAGCTTxxxTxxTTGACCAGTTTTACAAATAAAGAGxxxxxxACAAATAAAAGTxxAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                  4    27    13    67    52   183    74   291    96   333   155   348   175   357   201   363   207   369   214   373   223   380   227   381   227   382   216   380   221   384   228   385   236   386   237   386   229   387   229   389   234   389   225   391   245   391   244   392   245   393   362   393   357   393   362   391   352   390   382   392   376   393   371   391   306   385   350   385   364   388   369   388   356   387   370   389   368   390   368   392   357   393   341   394   362   395   354   388   335   386   315   384   332   377   332   376   310   369   317   367   312   363   306   356   293   349   290   347   290   346   279   340   258   330   237   318   228   296   182   274   177   265   124   251   135   222   127   210   117   203   117   191   111   183   105   176    97   172    77   171    68   166    58   160    62   156    62   148    60   139    49   132    53   120    54   113    51   106    53    95    54    91    43    89    56    91    55    93    57    92    63    96    53    95    64    96    67    95    66    98    74   100    68   107    70   117    74   123    76   125    59   126    78   126    72   130    86   140   101   148   107   153   113   157   122   161   120   169   120   172   117   175   119   184   164   202   162   213   169   224   192   243   197   248   202   257   187   264   201   266   224   273   239   290   251   298   254   304   276   307   226   309   277   312   279   314   260   319   258   324   237   322   259   330   270   332   272   334   285   336   249   335   268   335   324   338   271   339   303   340   256   340   299   343   285   340   318   340   160   340   287   340   283   339   298   331   181   336   174   335   177   338   150   338   179   338   141   338   104   337   126   337   139   334   120   330   124   327    97   325   123   322   168   319    56   319    60   316    57   308    55   280    46   222    26   160    24   124    24   113    17    75    19    32     3     6
  5   1   2       e50                            Xl3.1-IMAGE:6859260.5                                                                                                                                                             CTCATTCACAGTCCGCTCTCTGCTTTGCTGGTTCTAAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAGGAGCTTAATGTGGATATAATTGGTGTGAGTTTCCATGTTGGCAGTGGCTGCACTGATCCACAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGCTTTAACATGCATCTACTTGATATTGGTGGTGGATTCCCTGGTTCAGAGGATGTGAAACTGAAGTTTGAAGAGATCACATCTGTGATAAACCCAGCCCTGGATAAATACTTCCCAGCAGATTCTGGCGTTAAAATCATTGCAGAGCCTGGGAGATACTATGTTGCCTCATCTTTCACCCTGGCAGTTAATATCATTGCCAAGAAAGTTATGGTGAATGAGCAAAGTGGATCTGATGATGAAGAAGATGCTGCCAATGACAAAACTCTGATGTACTACGTCAATGATGGAGTGTATGGATCTTTCAACTGCATCTTGTTTGATCATGCACATGTCAAGCCAGTTCTAACAAAGAAACCCAAACCAGATGAGAAGTTCTACTCGAGCAGCATTTGGGGACCAACGTGTGATGGGCTGGATCGTATCGTAGAAAGGTTTGAGCTGCCGGAGCTGCAAGTTGGAGACTGGATGTTGTTTGAAAACATGGGTGCCTACACTGTTGCTGCAGCCTCGACATTCAATGGATTTCAGAGACCAACCCTTTATTATGTTATGTCAAGACCACACTGGCAACTGATGCATGATATTAAAGAACATGGCATTCTCCCTGAAGTACCAGATCTGAGTGCACTCCATGTATCCTGTGCTCAGGAGAGCGGAATGGAACTTGCACCTGCTGTCTGTACTGCTGCCAGCATCAATGTATAGGCTTATTAACAAAACTCTGTAGTTAAACTGCAACTTTAGCCTTGGGACCATTATTTAAAATTTAACTATTTTCATTTATTTTCCTAGCCTGTATTTGTCAGCATTAATGCAAAAAAATGGATGACTGCGAGATGGGGTCACATATCTGTGTTCCTATGGAAACTTTTTTTTTTTTTTCTAATGGTTTTTGAAGTATATTGAAGATGCTAATTATTTACTCAAGCATTTGTAGCTTTCTTCATTGACCAGTTTTACAAATAAAGAGTTAAAAACAAATAAAAGTAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2      en>5                                 Xl3.1-xl242l07.5                                                                                                                                                                                        TGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCTTTTTTTTTTTCNCCGGGTTATTTGN------------TACAGATTTCGTAAANGCTTTTTAANAATACAAACAGCAAAACAGCGCAAAGNGGCTCCATTGAAAGCGTAGGACTTGNCCTCTACTTACCAGGCTTCTATTTCACCGGCNAGCCTCCTTGGGAGTGANACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCNGGAGGAAGGCTTCNCTGCCAGGGATATTGNGGAGCAAAANATCA------------TATCTGACNACAAANATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCANGNGCGTTGGTTTAAAGCGCTCCCCCGNGTCACTCCGTTTTATGCCGNAAAANGCAACGATG
  5   1   2       e50                                 Xl3.1-xl246d04.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGATGCTGCCAATGACAAAACTNTGATGTACTACGTCAATGATGGAGNGTATGGATCTTTCAACTGCATCTTGTTTGATCATGCACATGTCAAGCCAGTTNTAACAAAGAAACCCAAACCAGATGAGAAGTTCTACTCGAGCAGCATTTGGGGACCAACGTGTGATGGGCTGGATCGTATCGTAGAAAGGTTTGAGCTGCCGGAGCTGCAAGTTGGAGACTGGATGTTGTTTGAAAACNTGGGNGCCTACACTGTTGNTGCAGCCTCGACATTCAATGGATTTCAGAGACCAACCCTTTATTATGTTATGT------------GGCAACTGATGCNTGATATTAAAG------------TCCCTGAAGTACCAGATNTGAGTGCNCTCCATGTATCCTGTGCTCAGGAGAGCGGAATGGAACTTGCNCCTGCTGTCTGTACTGCTGCCAGCATCAATGTATAGGCTTATTAACAAAACTCTGTAGTTCAACTGCAACTTTAGCCTTGGGACCNTTATTTAAAATTTAACTATTTTCATTTATTTTCCTAGCCNGTATTTGTCAGCNTTAATGCAAAAAAATGGATGACTGCGAGATGGGGTCACANATCTGNGTTCCTATGGAAACTTTTTTTTTTTTCTAATGGTTTTTGAAGTATATTGAAGATGCTAATTATTTACTCAAGCATTTGTAGCT
                                                                   VAR                                                                                                                                                                                     TGCTGGTTCTAGTTACGGATAGCT
                                                                   VAR                                                                                                                                                                                                             TGTTAGGAGCTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTACTCCTACCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTTCAACTGCAACTCTAGTGTTGGGACCATTATTTAAATGTAACTATTTTTTTCTACAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACTTTGCCAACATTAATGCAACAAAATGGATGACTGTGAGATGGGGTCACATTATCTGTGTTCCTATGGAAACTTTTTTTTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTGTTTTTGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTATTGAAGATGCAAATTACTCACTCAAGCATTTGTAGCTTGTGTATTGCCAGTCTGCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGTTTTGCCAGTCAGCATCTTCATTGACCAGTTTT
                                                                   SNP                                                                                                                                                                                                                         -C-------A--
                                                                   SNP                                                                                                                                                                                                                                                 ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                     ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -T------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -CT---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -C---------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----C----A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -T---------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----T----T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------T--C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----G-----A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CA----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -C------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----A-----C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------G--G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----A-----C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------T--G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -A--------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -C------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -G------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -C---------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -A-----C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -T--------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----A------
                                               BLH ATG     326    3301                                                                                                                                                             
                                               BLH MIN     326     329                                                                                                                                                             
                                               BLH MPR     185     329                                                                                                                                                             
                                               BLH OVR     326    1490                                                                                                                                                             
                                               CDS MIN     326     329                                                                                                                                                             
                                               EST CLI      18      68                                                                                                                                                             
                                               ORF LNG     326     158                                                                                                                                                             
  5   1   2       e50                            Xl3.1-IMAGE:6859260.5                                                                                                                                                             CTCATTCACAGTCCGCTCTCTGCTTTGCTGGTTCTAAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAGGAGCTTAATGTGGATATAATTGGTGTGAGTTTCCATGTTGGCAGTGGCTGCACTGATCCACAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGCTTTAACATGCATCTACTTGATATTGGTGGTGGATTCCCTGGTTCAGAGGATGTGAAACTGAAGTTTGAAGAGATCACATCTGTGATAAACCCAGCCCTGGATAAATACTTCCCAGCAGATTCTGGCGTTAAAATCATTGCAGAGCCTGGGAGATACTATGTTGCCTCATCTTTCACCCTGGCAGTTAATATCATTGCCAAGAAAGTTATGGTGAATGAGCAAAGTGGATCTGATGATGAAGAAGATGCTGCCAATGACAAAACTCTGATGTACTACGTCAATGATGGAGTGTATGGATCTTTCAACTGCATCTTGTTTGATCATGCACATGTCAAGCCAGTTCTAACAAAGAAACCCAAACCAGATGAGAAGTTCTACTCGAGCAGCATTTGGGGACCAACGTGTGATGGGCTGGATCGTATCGTAGAAAGGTTTGAGCTGCCGGAGCTGCAAGTTGGAGACTGGATGTTGTTTGAAAACATGGGTGCCTACACTGTTGCTGCAGCCTCGACATTCAATGGATTTCAGAGACCAACCCTTTATTATGTTATGTCAAGACCACACTGGCAACTGATGCATGATATTAAAGAACATGGCATTCTCCCTGAAGTACCAGATCTGAGTGCACTCCATGTATCCTGTGCTCAGGAGAGCGGAATGGAACTTGCACCTGCTGTCTGTACTGCTGCCAGCATCAATGTATAGGCTTATTAACAAAACTCTGTAGTTAAACTGCAACTTTAGCCTTGGGACCATTATTTAAAATTTAACTATTTTCATTTATTTTCCTAGCCTGTATTTGTCAGCATTAATGCAAAAAAATGGATGACTGCGAGATGGGGTCACATATCTGTGTTCCTATGGAAACTTTTTTTTTTTTTTCTAATGGTTTTTGAAGTATATTGAAGATGCTAATTATTTACTCAAGCATTTGTAGCTTTCTTCATTGACCAGTTTTACAAATAAAGAGTTAAAAACAAATAAAAGTAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012684939                                                                                                                                                                   CACAGTCCGCTCxxxxxxTxxxxGxTxxxxAAGTGTxAxxxxxGxxxxGCTGCTGTCCGAGGAGGTCTTTTTxTTTxTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAGGAGCTTAATGTGGATATAATTGGTGTGAGTTTCCATGTTGGCAGTGGCTGCACTGATCCACAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGCTTTAACATGCATCTACTTGATATTGGTGGTGGATTCCCTGGTTCAGAGGATGTGAAACTGAAGTTTGAAGAGATCACATCTGTGATAAACCCAGCCCTGGATAAATACTTCCCAGCAGATTCTGGCGTTAAAATCATTGCAGAGCCTGGGAGATACTATGTTGCCTCATCTTTCACCCTGGCAGTTAATATCATTGCCAAGAAAGTTATGGTGAATGAGCAAAGTGGATCTGATGATGAAGAAGATGCTGCCAATGACAAAACTCTGATGTACTACGTCAATGATGGAGTGTATGGATCTTTCAACTGCATCTTGTTTGATCATGCACATGTCAAGCCAGTTCTAACAAAGAAACCCAAACCAGATGAGAAGTTCTACTCGAGCAGCATTTGGGGACCAACGTGTGATGGGCTGGATCGTATCGTAGAAAGGTTTGAGCTGCCGGAGCTGCAAGTTGGAGACTGGATGTTGTTTGAAAACATGGGTGCCTACACTGTTGCTGCAGCCTCGACATTCAATGGATTTCAGAGACCAACCCTTTATTATGTTATGTCAAGACCACACTGGCAACTGATGCATGATATTAAAGAACATGGCATTCTCCCTGAAGTACCAGATCTGAGTGCACTCCATGTATCCTGTGCTCAGGAGAGCGGAATGGAxCTTxCxCCTGCTGTCTGTACTGCTGCCAGCATCAATGTATAGGCTTATTAACAAAACTCTGTAGTTAAACTGCAACTTTAGCCTTGGGACCATTATTTAAAATTTAACTATTTTCATTTATTTTCCTAGCCTGTATTTGTCAGCATTAATGCAAAAAAATGGATGACTGCGAGATGGGGTCACATATCTGTGTTCCTATGGAAACTTTTTTTTTTTTTTCTAATGGTTTTTGAAGTATATTGAAGATGCTAATTATTTACTCAAGCATTTGTAGCTTxxxTxxTTGACCAGTTTTACAAATAAAGAGxxxxxxACAAATAAAAGTxxAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Oo1  5g                         IMAGE:6641215.5p AAAGGGACCGTAGACGCTCGGCACGCGGGAAGCCCTGTGTAAGAAGGAGGGGACTGTGGCAGCCCCGGAGCAAACTGATCAGGGCTGGTTTGAGCTGGCGCGTCTCCATGGCGACGAGGGCGGCACTATAAATGAGAGCGAATAGCGGCGCACCTTCTCATTCACAGTCCGCTCTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCCACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTTAACAAGTTTCCCAGATCAAATACGCAGCTAACTGGGGGGGTGGAGAAGATGACCTTTTGAATAGTGAAGTTTGAATTGATGAAAATTGGGCAAGGAAATCACCCCAAN
  5   1   2       bld Te2  5g                         IMAGE:7392127.5p                         GCGGGAAGCCCTGTGTAAGAAGGAGGGGACTGTGGTAGCCCCGGAGCAAACTGATCAGGGCTGGTTTGAGCTGGCGCGTCTCCATGGCGACGAGGGCGGCACTATAAATGAGAGCGAATAGCGGCGCACCTTCTCATTCACAGTCCGCTCTCTGCTCTGCTGGTTCTAGTTACGGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTGGGTGCGGCTTNGACTGTGNNCAGTAGACTGAATCCACTAGTACAGAGTATG
  5   1   2       chi Emb4                            IMAGE:5515116.5p                                              CTGATAGTTGTTAGCAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGTAAGTGAACTCCCGGACCGTAACGAGCCTTTTTCCCGTATCCATATGGAGCGTACAGCTGCCTGAGAGGATGACGTGGTTCACGCCCACGTGCTGACGTCACTACACGCAGAGGATGTTGCCTGTCCAATGTCTGCGTAGGGTTTTAGACGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCNGCTTTGACTGTGCCAGTAAGACTGAAAATCCACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCGTGTAACA
  5   1   2       chi Emb4                            IMAGE:5516022.5p                                                    TTGTTAGGAGCTTCCGTCTGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGTAAGTGAACTCCCGGACCGTAACGAGCCTTTTTCCCGTATCCATATGGAGCGTACAGCTGCCTGAGAGGATGACGTGGTTCACGCCCACGTGCTGACGTCACTACACGCAGAGGATGTTGCCTGTCCAATGTCTGCGTAGGGTTTTAGACGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTANAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCCAGTAGAACTGAATCCNACTAGTACAGAGTATTGGAGTTCCNNCCGAGCGATATCTATGCAANCCGTGTAAACAGTTT
  5   1   2       bld Ooc2 5g3  in                    IMAGE:3745111.5p                                                                                          GGGCTGGTTTGAGCTGGAGCGTCTCCATGGTGACGAGGGCGGCACTATAAATTGGAGCGTCTAGAGGTTTCCCCTCATTCATTCAGGCAGTCGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAGAGATGCTGTGTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATGTTATGCTGTATAATGCAATGACAGCAGAGCCGTTGTGAAGACTCTCTGCATTCTTGATGCC
  5   1   2       bld Ooc2 5g3  in                    IMAGE:3745207.5p                                                                                          GGGCTGGTTTGAGCTGGAGCGTCTCCATGGTGACGAGGGCGGCACTATAAATTGGAGCGTCTAGAGGTTTCCCCTCATTCATTCAGGCAGTCGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTNTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAAGGACAGCCAAACC
  5   1   2       bld Oo1  5g                         IMAGE:6640704.5p                                                                                                                                            GGCTGGTAACCGGTCCGGAATTCCTGCGATGCTCTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCANTGTGAAATTTGGTGCCACCTTTAAAACAGCAGGCTGCTTCTGGAGCGGGCAAGGGAGCTTAGGNGGGATATATTGGGGGTGAGTTTCCCTGTTTGCCAGTGGCTGCACTGATCCACAGACTTATGTAACAGCTGTCTCCAAAGCACCA
  5   1   2       chi Oo1                             IMAGE:5078679.5p                                                                                                                                             CCCATATAATCTTGTGTTGTGGGCTGCATTTATTTAACTATATGAACACTAGCTGGGATGTGATCAGCAATAGCTTTAGCTCTGCTATTCCACCTGTTGTGGAGCTTTATCCTACTGGTTATTCCCTGGGAATATTAAACCGCTTTTTGTGTAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACCGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCCGTAAGACTGAAATCCAATTAGTACAGAGTATTGGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAAATCAAATATGCAAGCTAGCTGTGGGGTGGGAAAGAAGACTTTTTGATAATGAAGGCTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCTTAGCAACCTGATGACTCCAAAAGAAGTCTGCCGGCCTCCAGGGGGAAAATTTGGGGGccccccccTAAAACAAAGCGGGGTTTCTTTCTTGGAAGG
  5   1   2       bld Egg6 5g3  in                    IMAGE:4435416.5p                                                                                                                                              TGACACTATAGAACCAGCTTCACAGTCCGCTCTCTGCTCTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTG
  5   1   2       bld Ov1  5g                IMAGE:6316044-IMAGp.IMAGp                                                                                                                                                 CCCCGGGGTCCCGGGGAATTCCCCGGGATATCGTCCGACCCACGCGGTCCGACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAACCCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGT
  5   1   2       bld Ooc1 5g3  in                     Ooc1-db29b10.y1                                                                                                                                                       gggtcgacccacgcgtccgcccacgcgtccggtCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGA
  5   1   2       bld Tail 5g                         IMAGE:8544593.5p                                                                                                                                                       AAAAANNNNCCAAAGTNCNNNGNGAGTCATAAATGTATTCGTCCCCGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCttttttttCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAAACTGATGAAGTGGCAAGGAATCACCCGAATGCAA
  5   1   2       bld Tbd3 5g3  in                    IMAGE:3549633.5p                                                                                                                                                        GAAAAACTCGCTACGGGGGGCTCTAAAAACCGCTGGTTCTAGTTACTGATAGTTTTGAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAG
  5   1   2       bld Egg3 5g                         IMAGE:6327311.5p                                                                                                                                                        GGATCGATTCCCGGGGTCCGCTCTCTGCTTTCCTGGTTCTAGTTACTGATAGTTGTTAGGCGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCANAAGCAGTCTGCCGCCTCAGTGGTGAAATTTGGGTGCCACCCTTAAAAACAAGCAGGCTGCTTTCTGGAGGCGGGCAAAAGGNAGCTTAATGTGGGGATATAATTTGGNTGTGAAGA
  5   1   2       bld Ov1  5g3  in                    IMAGE:5074536.5p                                                                                                                                                          GACCCCGCGTCCGCGGACGCGTGGGGTCGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAAGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAA
  5   1   2       bld Egg3 5g                         IMAGE:6326420.5p                                                                                                                                                          ATCGATTCCCGGGCCCGGGGCTCTGTTTTGCTGGTTCTAGTTACTGATAGCTGTTACGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCCTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGGCTTCTGGAGCGGGGCAAAAGGGAGCTTAATGTGGGATATAAATTGGGA
  5   1   2       bld Oo1  5g                         IMAGE:6857004.5p                                                                                                                                                          GCTGGACCGGTCCGGAATTCCTTTCATCGACGCTTGTGCAAGTGTTAGTCTGGCATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAAGACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCCAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGGAAGTGGCAAGGAATCACCCCAATGCAAAAGCTTGTTCTGCGCATAACAACTGATGACTTCAAAAGCAGCCTGCCCGCCCTCATGTGGAAAATTTGGGGccccccccTAAAACAAGCCGGGCTACTTCCTGGAAGCGAACCAAAAAAACCTTAATG
  5   1   2       bld Te1  5g                         IMAGE:6929468.5p                                                                                                                                                          GGGCTCATTCACAGTCCGCTCTCTGCTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCCTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGGCAAAGCCATTTGTGAAAACTCTCTCCATTTCTTGGTGGCCGGGCTTTGAACTTGTGCCCAGTAAAAACTGAAAATTCCAAACTAGGTACAAGAGGTATTTGGGATTTTTCCCCCCGAAGCCGGATTATTCTTATGCCAAAACCCGGTGGTaaaaaaaaaTTTTCCCCACAAATCAAAAATACCCCCACCCTAAGccttttggggtgttggaaaaaaagaatgaaacctttttggtaaaaagtggaaaaattttgGAAAACCTTGAAATA
  5   1   2       bld Ov1  5x3  out                   IMAGE:5074392.5p                                                                                                                                                           GATATCGTCGACCCACGCGTCCGGCTTTGCTGGTTCTAGTTACTGATAGAGGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCC
  5   1   2       bld Oo1  5g                         IMAGE:5085437.5p                                                                                                                                                           CACGCGTCCGCAGTCCGCTCTCTGCTTTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAAATTTGGTGGCACCCCTTAAAAACAAGCAGGGCTGCTTTCTTGGGAACGGGGCCA
  5   1   2       chi Te1                             IMAGE:6928068.5p                                                                                                                                                           GGGTCATTCACAGTCCGCTCTCTGCTTTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCACCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAACTTCAGCAATGACTACTTTGACCTCAGCTCTCCTGGAGGAAGGCTTCTCTGCCAGGGGATATCGTGGAGCAAAAGATCAATTGAAGTGGTCCCTTACCTGACCACCCAAGATTGCCTTCTTAATGTTGCCTGATCCTTAACGACCATTGTTTAAAAATACCTGGCTGCCGTTGTGTTTTAAAGCGCTTCCCCTCTGTGTATATCCCCCGCCTTTTATTGCCCCCAAAAAAGTTAACTTTTGCGCCCAATCCCCAATTGGCTAAAGAACTTCGTCTCTCTAATCTTTTTGGGGGCCTAGTCGCTTCAAACCTTGTTACCCTCCCATAAAATCTGAAAATACTATACTTTAGCCCTTTGTTTAATCTATGTAAATCTTccccccccccTAAGCTCTGTATATTCCCCTATTTATTCAAACACCGCCCGGAGATAAAATAAGATTTTGTTGGTAAGGAAGCGTAATATATGCCGCAAAGCTTAGCGCCTATTCGCGCTTTTTCTTAAAAAAACAGTTTCGCCCTTATGCTCAGGA
  5   1   2       bld Emb9 5g3  in                    IMAGE:7975006.5p                                                                                                                                                           TCGGTCCGGATTCCCGGGATCTGCTCTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTCGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGATGTTCCCCCGAGCGGATTATCTATGCAAACCGTGTTAACCAGTTTCCCAGATCAAAACGCAGCTAGCTGTGGGTGGAGAGATGACTTTGATAGTGAATTGACTGATGAAAGTGCAAGGACA
  5   1   2       bld Oo1  5g                         IMAGE:6638575.5p                                                                                                                                                             CACGCGTCCGGTCCGCTCTCTGCTTTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTTCCCAGATCAAATAAGCAGCTAGCTGTGGGTGTGGGAGAAAATGACTTTTTGATAATGGAAGTTGAACTGGATGAAAAGGGGGCAAGGAATCCCCCCCAAATGCCAAAGCCTTGGTTCCTACGCCTTAGCAACTGAATGGACTTCCAAAAGCCGGTCCGGGCCGCCCTCAGGGGGGTGAGAAAATTTGGGGTGGcccccccccTTTAAAAAACAAAGGCC
  5   1   2       bld Oo1  5g                         IMAGE:5079381.5p                                                                                                                                                             TTTCGGGATGTCCGCTCTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCCGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCCGAGCGGATTATCTATGCCAACCCGTGTAAACAAGTTTCCCCGATCAAATACGCAGCTAGCTGTGGTGGGGAAAAGATGACTTTTGGTAGTGGACGTCGAATTCGCGGAAAGTGGCCAAGGAAACCCCCCGAAAGGCCAAAGCTTGGTCCTACCCCATACTCAACTGAATGGACTCCCAAAGCCACGTCCCGCCCCGCACCTCCAGTGGCGGGACACATTTTGGGGTGGCCCCACCCCCCTTTAAAAAAACCAAAGCCCAGGGGCGTGGCCCTATCACTTGGGCAAACGCGGGGAGACCATAAAAGGG
  5   1   2       bld Oo1  5g                         IMAGE:5084771.5p                                                                                                                                                             CTGGACCGGTCCGGAATTCTTGGGATGTCGCTTGTGCAGCATTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCCACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGGGAAATTTGGTGCCACCCCTTAAACAAGCCCGGCTACTTCTGGGAGCGAGCAAAGAGCTTAAGTGGGATATAA
  5   1   2       bld Egg3 5g                         IMAGE:6868588.5p                                                                                                                                                             GATTCCCGGGGTCCGCTCTCTGCTCTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTTGACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAAACAGGCAGCTGGCTTCTGGAGCGGGGCAAAGAAGCTTAATGGGGGAATATATTTGGTGTGAGTTTTCATGTTGGGCAGTGGCCTGCCCCTGATCCACCGACTTAT
  5   1   2       bld Te1  5g                         IMAGE:6927884.5p                                                                                                                                                             GGGATTCACAGTCCGCTCTCTGCTCTGCTGGTTCTAGTTACGGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGGAGAAGATGACTTTTTGATAGTGGAAGTTGAACT
  5   1   2       chi Tad1      in                    IMAGE:6879561.5p                                                                                                                                                              GGGCCAGCAAAACTCGGCTTGGTCTTTCTGCCTGGAGTACTGCGCCAACTATGTTTTAAGTAATTTCTTAAGCTGAACAGGACCGAAGTACAAATTGAAGTTACTCCCTGCTTCTTTCTTCCTGGTTCTTGCAAGAATACAAACAGCAGAACAGCGCAGAAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAAGTATTGGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTTAGCTGTGGGTGGTGGAAAAAGATGACTTTTTTGATAATGAAGTTTGAACTGNATGAAAGTGGGCAAGGAAATCACCCCAAAT
  5   1   2       bld Emb9 5g                         IMAGE:7975113.5p                                                                                                                                                              TCGGTCCGGATTCCCGGGATCTCTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGGAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAAGCGATTATCTATGCAAACCCGTGTAAACAATTTTCCCAGATCAATACTGAACCAGCTGTGGTGTGAAAAGAAGACTTTGATATTGAATTAACTGATAAAGTGGCAGGAATCCCCCAAA
  5   1   2       bld Ov1  5g3  in                    IMAGE:5074352.5p                                                                                                                                                                TCGACCCACGCGTCCGCTGCTTTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAG
  5   1   2       bld Oo1  5g                         IMAGE:6637841.5p                                                                                                                                                                 TGCATGACCGCTCTCTGCTTTGCTGGTTCTACTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAGACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGGTGTGGAGAAGATGACTTTTGATAGTGAAAGTGAATTGATGAAAGTGGCAGGAATCACCCGAAGGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGGTGAAATTTGGTGCCACCCCTTAAAACAAGCAGGCTGCTTTCTGGAGCGGGCAAAAGGAGCTTTATGGTGGAAATAAATGTGGNGGTGAAGTTTTCCATGTTTGGGCAATAGGCCTGCA
  5   1   2       bld Ov1  5g3  in                    IMAGE:5048830.5p                                                                                                                                                                  ACCCACGCGTCCGGGCTGTCGTCGCTTGTGCAAGTGTTATTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAG
  5   1   2       bld Neu2 5g                         IMAGE:2942379.5p                                                                                                                                                                    GGGTCCGCTCTCTGCTCTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTTTCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACTGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACTAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTGATGCCGTAGAATGCAACGATGGCAAAGCCATTGTGA
  5   1   2       bld Oo1  5g                         IMAGE:5084775.5p                                                                                                                                                                    AGTCCGCTCTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGGNTGAAATTTGGTGCCACCCCTTAAA
  5   1   2       bld Egg3 5g                         IMAGE:6867958.5p                                                                                                                                                                    GATTCCCGGGCTCTGCTTTGCTGGCTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGGTGAAATTTGGGTGCCACCNCTTAAAACAAGCAGGCTGGCTTCTGGGAGCGGGGCAAGGGAGCTTTAATGGTGGATTATAATTGGGTGGGGAAGGTTTCCAATGTTTGGGCT
  5   1   2       bld Tbd2 5g3  in                    IMAGE:3201081.5p                                                                                                                                                                      TCCGCTCTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCGTGTCACTCC
  5   1   2       bld Emb1                            IMAGE:6632785.5p                                                                                                                                                                      CCACGCGTCCGTGCTTTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGGAGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCCATGAAAGTGTCCTTATCTGACGACAAAGATGCTTTTATGTTGCTGATCTTGGCGAACATGNGAAAAAAGCATGTGGCGTTGGTTAAAAGCGCTCCCCCCGTGTTCCCTCCCGTTTTATGCCCCGAAAAATGGCACCGAAGGGCAAAGCCCATTTGGGAAAAAAATCTCCTCCCTTTCTTTGGGGGGCCGGGTTTTTGACCTGGGGCCCCGTTAAAAACCTGGAATTCCCCCCCTTTTCACCCAAGAGTATTGGGGGAATTTTTccccccccgcacggggggttttttctttttggccaaaccccccgggtggaaaaaaacaaattttccccgccaaaataaaaaaataccccccgcccttttctccttgttggggggggggggggggaaaaaaaaaaaGAACACCTTTTTTTGAAAAA
  5   1   2       bld Oo1  5g                         IMAGE:6643672.5p                                                                                                                                                                      GCTGGTACCGGTCCGGATTCCTGGCAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGGAAGACTCTCTCCATTTCTTGGTGCCGGGCTTTGACTGTGCCCAGTTAAGACTGAAAATCCAACTTAGACCAGAGTATTGGGAAGTTTCCCCCCCAACCGGGATTATCCTATTGCAAACCCCGGGGGTAAAACAAATTTTTCCCCCAAATCCAAATAACCCCACCCTAACTTTGGGGGTGGGGGaaaaaaaaaagacctttttttgaaaaaggggaaaagttgtgaatttgatattgaaaaaagggggcaaagggggaaaatcccccccccAAAAATGGTCAAAAAACTTTTTTGGGTTCTCAACAC
  5   1   2       bld Egg3 5g                         IMAGE:6325451.5p                                                                                                                                                                      GATTCCCGGGCTGCTTTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCANAAGCAGTCTGCCGCCTCAGTGGTGAATTTGGTGCCACCCTTAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAGGAGCTTAATGTGGGATATAAATTGGTGGTGAGTTTTN
  5   1   2       bld Oo1  5g                         IMAGE:6860357.5p                                                                                                                                                                      TCCGCTCTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGGAATCACCCCGAATGCAAAGCTTTGTTCTACGCATAGCAACCTGATGGACTCAAAAGCAGTCCTGGCCCGCCTCAGTTGTGAAAAATTTGGGTCGCCAACCCCTTTAAAAACAAGCCAGGGCTGTCTTCCTGGGGAGCGGGGGCAAAAAGC
  5   1   2       bld Ga15 5g                            XL506i11ex.5p                                                                                                                                                                      TCCGCTCTCTGCTTTGCTGGTTCTANTTACGGATAGCTGCTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCNATGGGTACAGATTTCGTANATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGNCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTANAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGNGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAA
  5   1   2       bld Tbd2 5g3  in                    IMAGE:3201352.5p                                                                                                                                                                       CCACGCGTCCGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTANAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTG
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073638.5p                                                                                                                                                                       CCACGCGTCCGGCTTTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCCTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTA
  5   1   2       bld Oo1  5g                         IMAGE:6643910.5p                                                                                                                                                                       TCCGCTCTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTANAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGAATGAAGTGGCAAGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGGCACCCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAGGAGCTTAATGTGGAATATAATTGGTGGGAGTTTCATG
  5   1   2       bld Ga15 5g3  in                       XL505i11ex.5p                                                                                                                                                                       TCCGCTCTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAA
  5   1   2       bld FaBN 5g                         IMAGE:8078674.5p                                                                                                                                                                       TCCGCTCTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGATTTGATGAAAGTGGCAAGGAATCA
  5   1   2       bld Ga18 5g3  in                      xlk124k11ex.5p                                                                                                                                                                       TCCGCTCTCTGCTNNNNNGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGNAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCANNNNNTTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGNACAGAGTATTGGAGNTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAANNNGTTTCCCAGATCAAATACGCAGCTAGCTGTGGNGTGGNNNNATGACTTTTGATAGTGAANNGNANTNGATGNAA
  5   1   2       bld DMZ  5g   ?                          xl264e04.5p                                                                                                                                                                       GTCCGCTCTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttCNCCNGGTTATTTGNGGCCNCGATGGGTACAGATTTCGTAAATGCTTTTTAANAATACAAACAGCANAACAGCGCAAAGNGGCTCCATTGANAGCGTAGGACTTGTCCNCTACTTACCAGGCTTCTATTTCACCGGCNAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACNACTTTGACTTCAGCTTCCNGGAGGAAGGCTTCNCTGCCAGGGATATTGNGGAGCAAAANATCAATGAAGTGTCCTTATCTGACGACAAANATGCCTTTTATGTTGCTGATCTTGGCGACNTTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGNGTCACTCCGTTTTATGCCGNAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCA
  5   1   2       bld Egg4 5g3  in                    IMAGE:3744830.5p                                                                                                                                                                        GGAATTCCCTGCTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTANAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTTAATGAGTTTCCCCCGAGCGG
  5   1   2       bld Gas4 5g                         IMAGE:3421201.5p                                                                                                                                                                        GATTCCCCGGGGTCGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTAT
  5   1   2       bld Emb1 5g                         IMAGE:6633805.5p                                                                                                                                                                        CCGCTCTCTGCTTTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCtttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTANAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGGTGTGGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAGGNAATCACCCGAATGCAAAGCTTGGTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCCTCAGTGTGAAAATTTTGGTGCCCACCCCTTAAAAACAAGCAGGC
  5   1   2       bld Oo1  5g                         IMAGE:6640367.5p                                                                                                                                                                        CGGCTGGACCGGTCCGGATTCTCGGGATCGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAAATTGATGAAAGTGGGCAGGGAATCACCCGAATGGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCCTCAGGGGGAAAATTTGGTGGCCACCCTTAAAACAAAGCAGGGCTGCTTTCTGA
  5   1   2       bld Oo1  5g                         IMAGE:5085127.5p                                                                                                                                                                        TCCGCTCTCTGCTTTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTCTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTTGAAATTTGGTGGCACCCTTTAAACAAGCAGGCTGGCTTCTGGAGCG
  5   1   2       bld Egg3 5g                         IMAGE:6325018.5p                                                                                                                                                                        GTCGATTCCCGGGCGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTANAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGANATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTANACAAGTTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGGAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGGTGAAATTTGGGTGCCACCCTTTAAACAAGNCCGGCTACTTTCTGGAGCGAGCAAAAGAAGCTTAATGTGGGATATTAATTTGGTGGTAAGTTTTCCATGG
  5   1   2       bld Egg3 5g                         IMAGE:6870797.5p                                                                                                                                                                        GATTCCCGGGGCTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCCTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCTGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCCTCAGTGTGGAAATTGGGTGCCCACCCCTTAAAAACAAGCAAGGCTTGCTTTCTGGAGCGGGGCCAAN
  5   1   2       bld Ga15 5g                            XL438c12ex.5p                                                                                                                                                                        CCGCTCTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGNG
  5   1   2       bld Ga15 5g                            XL477g16ex.5p                                                                                                                                                                        CCGCTCTCTGCTCTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACCAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAAGTTGAACTGATGAAAGTGGCAAGGAATCNCCCG
  5   1   2       bld DMZ  5g                              xl299b09.5p                                                                                                                                                                        GTCCGCTCTCTGCTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCTTTTTTTCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTG
  5   1   2       bld Emb1 5g3  in                    IMAGE:3401815.5p                                                                                                                                                                         CCGCTCTCTGCTTTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTNTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTANAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTTGTGCCNGCTTTGACTGTGCCAGTAAGACTGAAATCCCACTAGTACAGAGTATTGAGTTTCCCCCGAGCGATTATCTATGCAAACCCTGT
  5   1   2       bld Oo1  5g                         IMAGE:6638540.5p                                                                                                                                                                         CACGCGTCCGGTCTTCCCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTANAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGANATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGGTGTGGAAAGATGACTTTTGATAGTGAAGNNTGAACTAATGAAAGGTGGCAAAGGAATCACCCCCAAATGCAAAGGCTTTGTTCCTGCCGCATAGGCAACTGGATGACCTCAAAAAGCAGGTCTGGCCGGCCTCAGTGGGGGAAAATTTGGGGTGCCAACCCCCTTAAAAACCAAGGCCGGGCTTAACTTCCTGGGAGAGCGGAGCCCAAAAAGAAGCCTTTAATtgggggggaatattaaaatttggggggggAAAAGAGTTTTTCCCCATGGG
  5   1   2       bld Egg3 5g                         IMAGE:6325207.5p                                                                                                                                                                         TTCCCGGGCAGTCGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGGTGGAAAAAGATGACTTTTGATAGTGGAAGTGAACTAATGAAAGTGGGAAGGGATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGGATGACTCAAAAGCAGTCGGCCGCCCTCAGGGGGAAATTTGGGGGCCCCCCTaaaaaaaagccgggtaatttttgggagggggcaaagaaagcttaagtggggaaataaatgggggggaaaaGTTCC
  5   1   2       bld Egg3 5g                         IMAGE:6325538.5p                                                                                                                                                                         GATTCCCCGGGGTCGTCGCTTGTGCTAGCGTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGGGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTTGGAGTTTCCCCCCCGAGGCGGATTATCTATGCCAAACCCCATGTAAACAAAGTTTTCCCAGAACAAAATATTGCAGCCTAGCTTGGGGGTGGTGGAAAAAAGAATGACTTTTTGGAATAAGGGAAAGTTTGAAACCTAATGAAAAGGGGGCAAAGGGAACTCCCCCCCAAATGGCAAAAGTTTGGGTTCCTGGGCCCTTTGCCCACCTGGATGGAACTCCAAAAAAGCAGGCCTGGCCCCGCCCTCCAgggggggaaaatttggggggCCCACCCCCCTTTAAAAACAAGACCCGGGGGTAATT
  5   1   2       bld Egg3 5g                         IMAGE:6866928.5p                                                                                                                                                                         TCCCGGGCTGCTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGGATCACCCGAATGCAAAGCTTGGTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGGAAATTGGGTGCCACCCTTAAAACAAGCAGGGCTGGCTCTGGGAGCGGGGCCAAAGGGAGCCTTAATGGTGGGAA
  5   1   2       bld Ga18 5g3  in                      xlk133b22ex.5p                                                                                                                                                                         TCCGCTCTCTGCTCNNNNGTTCTAGTTACGGATAGCTGTTAGGAGCTNNNNNGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGANTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCNAAAATGAACAGCTTCANNAATGACGACTTTGACTTCAGCTTCCTGGAGGAANGCTTCTCTGCCAGGGANATCGTGGAGCAAAAGATCAATGAAGNGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGNGACATTGTGAAAAAGCATGT
  5   1   2       bld Ga18      in                       xlk56p12ex.5p                                                                                                                                                                         TCCGCTCTCTGCTCNNNNGTTCTAGTTACGGATAGCTGTTAGGAGCTTNNNNGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGNAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCATTGTGAAGACTCTCTCCATTCTTGGNNCCGGCTTTGACTGTGCCAGTNAGACTGAAATCCAACTAGNACAGAGNATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAANCAAGNTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGANGACTTTTGATA
  5   1   2       bld Ga18 5g                             xlk1a04ex.5p                                                                                                                                                                         TCCGCTCTCTGCNNNNNNGTTCTAGTTACGGATAGCTGTTAGGAGCTTNNNCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGNAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGNNGACTTTTGATAGTGAAGTTGAACTGATGAAAGNGGNAANGNATCACCCGNNGC
  5   1   2       bld Ga18 5g                            xlk74b22ex.5p                                                                                                                                                                         TCCGCTCTCTGCTNNNNNGTTCTAGTTACGGATAGCTGTTAGGAGCTTNNNNGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTNCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGNAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCATTGTGAAGACTCTCTCCATTCTTGGNNCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGNATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAANANGTTTCCCAGATCAAATACNCAGCTAGCTGTGGTGNGGAGAAGANGACTTTTGATAGTGAAGTTGAACTGATGAAAG
  5   1   2       bld Emb1 5x                         IMAGE:6637031.5p                                                                                                                                                                          CCACGCGTCCGCGTCGCTTGTGCAAGCATTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGGAAATTTGGTGCCACCTTTAAACCAGCCGGCTACTTCTGGAGCGAGCAAAAGAGCTTATGGGGGATATAATGGGTGTAAGTTTCCATGGTGGCAGTGGCTGC
  5   1   0       chi Emb1                            IMAGE:6865528.5p                                                                                                                                                                          CGCTCTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGGTAAGTGCTGCCTTTGTGTTTCACGCGTTACGGTTTATGGCGGGTGAGCGACCCACTGTCTTGTGACCCTCCGGCAACCCTCCCCCATTATACTGCCTCTCCTGGGAGTGAGAAAGCTGTAGTTCAGTGTGTTACTCGGCTCATACTAATAATGTGGGACTGTTAAATTGTGACTGGATTATCGGCCTCCGTTGCCGATTGGTAGTTTATAAGTAATCAATAATTATTATAGTAATATGTTCCAGTAAGTGAACTCCCGGACCGTAACGAGCCTTTTTCCCGTATCCATATGGAGCGTACAGCTGCCTGAGAGGATGACGTGGTTCACGCCCACGTGCTGACGTCACTACACGCAGAGGATGTTGCCTGTCCAATGTCTGCGTAGGGTTTTAGACGGTGCGTTGTTGGATTGGCTATATTTATTATGGGGTGGGGCTTCTTGCTTCCTGCCGGCTTTTTGACACGCGGCAGGCGCTGACTTGGGGGAAGAGGAGCTGCGCTTGGAGGTCAGTCTTGACACTTCATACTGACTCTCTCTCCTGGCCGCCGGTGTGTAGGATTGAGCTCGGCCTCTAGAGGCGGGGCAGCAGCTGATTGGCATCCGCAGTGGGGCTTGTCTTGTAATAGTGAGGCCTTTTCAGCTGCTGCCATCTTAGCCCTGGACAAATTAAGGGGNAAACAACGCTCAACCCTTTTTACGGGACTAGGGGAAGCTGCCTTTTTAATTGGTCCCG
  5   1   2       bld Egg3 5g                         IMAGE:6327378.5p                                                                                                                                                                          GATTCCCGGGGTCGTCGCTTGTGTCGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCAGTCTGCCGCCCTCAGTGGTGAAATTTGGGTGCCACCCCTTAAAACAAGCCGGGGTACNTTCTGGNNAGCGAGC
  5   1   2       bld Te2N 5g                         IMAGE:7767665.5p                                                                                                                                                                          CGCTCTCTGCTCTGCTGGTTCTAGTTACGGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAA
  5   1   2       bld Ga18 5g3  in                      xlk157a12ex.5p                                                                                                                                                                          CCGNTCTCTGCTCTNNNGTTCTAGTTACGGATAGCTGTTAGGAGCTTNNNNGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGNAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTNAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAANNTTGNTCTACGCATAGNAACTGATGACTCAAAAGCAGTCTNNCGCCTCAGTGTGAAANTTGGNGCCACCCTNAAANCAAGCAGNNTGNTTCTGNAGCGGGNAA
  5   1   2       bld Neu4 5x                         IMAGE:3556621.5p                                                                                                                                                                           CCCGGGGCTCTGCTGGTTCTAGTTACAGATAGCTGTCAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTGGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGGTATCCCCATCTCTTACTTGTCCATTGTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTC
  5   1   2       bld Ov1  5g3  in                    IMAGE:5074096.5p                                                                                                                                                                           ACCCACGCGTCCGCGCTTGTGCAAGCGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTCTCACTATAGTCTTTCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAACAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGA
  5   1   2       bld Ov1  5g3  in                    IMAGE:5074513.5p                                                                                                                                                                           CCACGCGTCCGGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGAC
  5   1   2       bld Emb1 5g                         IMAGE:6636935.5p                                                                                                                                                                           GCTCTCTGCTTTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAAATCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACCAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGGAGAAGATGACTTTTGATAGTGAAATTGAACTGATGAAAGTGGCAAGGAATCCCCCAAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAAGAGTCTGCCCGCCTCCGGGTGAAAATTTGGTGCCACCCCTTAAAACAGCAGGGTGCCTCCTGGAAGGGGCAAAAGAAGCTTATGGTGGGAAAAAATggggggggAGTTTTCCATGTTGGGCATGGGCTGCCCTGATCCC
  5   1   2       bld Emb1 5g                         IMAGE:5156345.5p                                                                                                                                                                           GCTCTCTGCTTTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAGAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAATATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCTCCGAGCGGATTATCTATGCCAACCCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGGACAAGATGACTTTTGATAGTGCAGTTGGAACTGATGAAAGTGGGAAGGAAATCCCCCGAATGCAAAGCTTGGTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCANTGGGAAAATTTGGTGCACCCCTAAAAACAGGCAGGCTGCTTTCTGGAGCGGGGGAAAAGAAGCTTAATGGGGATATTATTGGCGGCTGAACTTCCCATGTTGGGGCAAGGGTTGCCCCTGGATCCCCCGAACTTTATGGTACA
  5   1   2       bld Egg3 5g                         IMAGE:6322528.5p                                                                                                                                                                           TCCCGGGGCTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCCTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACNTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCANAAGCAGTCTGCCCGCCTCAGTGGTGAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGNATATAAATTTGGTGGTG
  5   1   2       bld Egg3 5g                         IMAGE:6327196.5p                                                                                                                                                                           GTCGATTCCCGGGCGCTTGTGCAAGTGTTCGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGAGGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGGTGTGAAATTTGGTGCCACCCTTAAAACAAGCCGGGGTACTTCTGGAGCGAGCCAAAGAGCTTAATGTGGATATAAATTGGGTGTAAGTTTCCCATGTTTGGCCAGTGGGCTGCACTGC
  5   1   2       bld Gas9 5g                              BG409596.5p                                                                                                                                                                            CTCTCTGCTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAAGCATGTGCCGTTNGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCATTCTTGGTGCCGGCTTTGACTGNGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCCAACCCC
  5   1   2       bld Neu4 5g3  in                    IMAGE:4085101.5p                                                                                                                                                                             CTCTGCTCTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCC
  5   1   2       bld Oo1  5g                         IMAGE:5084690.5p                                                                                                                                                                             TCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGGAAGACTCTCTCCATTCTTGGGTGCCGGGCTTTGAACTGGTGCCCAGTAAGACTGAAAATCCCAACTAAGTACCGAGGTATTGGGAGTTTTCCCCCCCAAGCGGGAATTATCCTAATGCAAAACCCCGTGGTAAACCCAAGTTTTTCCCCAGAATTCAAATTACCGCAGCTTAACCTGGTGGTGGTTGGAAAAAAGAATGGACTTTTTTGGAATAGTGGAAAGTTTGAAAATTGGATTGGAAAAGGGGGGCCAAGGGAAATTCCCC
  5   1   2       bld Oo1  5g                         IMAGE:5078992.5p                                                                                                                                                                             TCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGGCGCCTCAGGGTGAAATTTGGTGCCACCCTTTAAAACAACAGGCTGCTTTCTGGAGCGGGCAAAGGAGCTAAAGGGGAAATAAATTGCGGTGAATTTCCATGGTGGGCAAGGGCTGGCCTGG
  5   1   2       bld Egg3 5g                         IMAGE:6325189.5p                                                                                                                                                                             GATTCCCGGGGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCCTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCTGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGGTGAAATTTNGGTGCCCACCCTTAAAACAAGCANGGCTGGCTTCTGGGGAGCGGGCAAAGGGAGCT
  5   1   2       bld Ga15 5g                            XL469l06ex.5p                                                                                                                                                                             CTCTGCTCTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTT
  5   1   2       bld Ga15 5g3  out                      XL482b20ex.5p                                                                                                                                                                             CTCTGCTCTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAA
  5   1   2       bld Ga15 5g                            XL484i22ex.5p                                                                                                                                                                             CTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGAC
  5   1   2       bld Ga15 5g                            XL517i07ex.5p                                                                                                                                                                             CTCTGCTCTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCA
  5   1   2       bld Emb9 5g                         IMAGE:7976876.5p                                                                                                                                                                             CTCTGCTCTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCA
  5   1   2       bld Spl  5g                         IMAGE:8462152.5p                                                                                                                                                                             CTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGATTGATNGAAGTGGCAGGGAATCACCGATGCAAGCTTGTCTACGCTAGCACTGATGATCAAAGCATCTG
  5   1   2       bld Ga18      in                      xlk120e22ex.5p                                                                                                                                                                             CTCTCTGCTTNNNNGTTCTAGTTACGGATAGCTGTTAGGAGCTTNNNNGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTNNNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGNTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGANTGTGCCAGTNAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCNAACCCGTGTAAACAAGTTTCCCAGATCAANNACGCAGCTAGCTGTNGTGNGNAGAAGNNGANTTTTNATAGTGAAGNTGAANTGATGAAAG
  5   1   2       bld Ga18 5g3  in                       xlk58b22ex.5p                                                                                                                                                                             CTCTCTGCTCNNNNGTTCTAGTTACGGATAGCTGTTAGGAGCTNNNNNGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGNAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGNTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGANTGAAATCCAACTAGTACAGAGNATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGNGTGGAGAAGANGACTTTTGATAGTNAAGNTGAACTGATGAAAG
  5   1   2       bld Ga18 5g3  in                      xlk103f04ex.5p                                                                                                                                                                             CTCTCTGCTNNNNNGTTCTAGTTACGGATAGCTGTTAGGAGCTTNNNNGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGNAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGNTTTTATGCCGTAAAATGCAATGATGGCAAAGCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGNATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAANNNAGTTTCCCAGATCAAATACGCAGCTAGNTGTNGTGTGGAGAAGANGACTTTTNATAGTGAANNGAATTGATGAAAGNGNNAAGGAATCACCCGAAT
  5   1   2       bld DMZ  5g3  in                         xl256b18.5p                                                                                                                                                                             CTCTGCTCTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGT
  5   1   2       bld DMZ  5g3  in                         xl243m08.5p                                                                                                                                                                             CTCTGCTCTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCA
  5   1   2       bld DMZ  5g3  in                         xl320g13.5p                                                                                                                                                                             CTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTA
  5   1   2       bld DMZ  5g3  in                         xl286j16.5p                                                                                                                                                                             CTCTGCTCTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCA
  5   1   2       bld DMZ       in                         xl257b18.5p                                                                                                                                                                             CTCTGCTCTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCNTTGAGAGCGTANGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAANTTGCATTTTGAAACCGAANAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCANAAGATCAATGAAGTGNCCTTATCTGACGACNAAGATGCCTTTTATGTTGCTGATCTTGGCGACNTTGTGAAAAAGCATGNGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTANA
  5   1   2       bld DMZ  5g                              xl289h10.5p                                                                                                                                                                             CTCTGCTCTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCANAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACNTTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGNAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACNAGTTTCCCAGATC
  5   1   2       bld DMZ  5g3  in                         xl240b06.5p                                                                                                                                                                             CTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGA
  5   1   2       bld Egg3 5g                         IMAGE:6326513.5p                                                                                                                                                                              GACGATTCCCGGGGGTTCTAGTTCTTCAAGACTGGAGGAGCTTTGTCAGAGGTTCTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCCTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCAGGCCTGCTTCTGGAGCGGGCAAAGGAGCTTAATGTGGGATATAAATTGGGTGTGAAGA
  5   1   2       bld Ga18 5x                           xlk159i18ex.5p                                                                                                                                                                              CTCTCTGCTCNNNNGTTCTAGTTACGGATAGCTGTTAGGAGCTTNNNNGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAANNATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAANCAAGNTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGNAAGGAATCACCCGAATGCANNNNNNGTNCTACGCATAGNAACTGATGACTCAAAAGCAGNCTGNCGCCTCAGNGTGAAANTTGGNGCCACCCTTAAANNAGCAGGCTGNTTCTGGNGNGGGNAAAGGNGCT
  5   1   2       bld Ga18 5g                           xlk136p09ex.5p                                                                                                                                                                              TGCTTNNNNGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGNAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTNCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGNAAAGCATTTGTGAAGANTCTNNTCCATTCTTGGNNCCGNNTTTGNANTNNTGCCAGNANGACTGAAATCCNAC
  5   1   2       bld DMZ  5x3  out                        xl251l10.5p                                                                                                                                                                              CTCTGCTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTG
  5   1   2       bld DMZ  5g3  in                         xl236o10.5p                                                                                                                                                                              CTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttCNCCNGGTTATTTGNGGCCNCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCANAACAGCGCAAAGNGGCTCCNTTGANAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGNGGAGCAAAAGATCAATGAAGNGTCCTTATCTGACGACAAANATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCANGTGCGTTGGTTTAAAGCGCTCCCCCGNGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAANACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAANACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGT
  5   1   2       bld DMZ  5g   ?                          xl319c06.5p                                                                                                                                                                              CTCTGCTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAG
  5   1   2       bld DMZ  5g3  in                         xl305p09.5p                                                                                                                                                                              CTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttCGCCGGGTTATTTGNGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAANAATACAAACAGCANAACAGCGCAAAGNGGCTCCNTTGANAGCGTAGGACTTGTCCNCTACTTACCAGGCTTCTATTTCACCGGCNAGCCTCCTTGGGAGTGANACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAANAATTGCAAAAATGAACAGCTTCAGCAATGACNACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGNGGAGCAAAANATCAATGAAGTGTCCTTATCTGACGACAAANATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCANGTGCGTTGGTTTAAAGCGCTCCCCCGNGTCACTCCGTTTTATGCCGNAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACA
  5   1   2       bld DMZ       out                        xl291h12.5p                                                                                                                                                                              CTCTGCTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTGCGGCAGCGGCTAAAGATGCTGGAGCGGGATTTGGATCTGGGAG
  5   1   2       bld DMZ  5g3  in                         xl299l09.5p                                                                                                                                                                              CTCTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttCNCCNGGTTATTTGNGGCCNCGATGGGTACAGATTTCGTAAATGCTTTTTAANAATACAAACAGCAAAACAGCGCAAAGNGGCTCCNTTGANAGCGTAGGACTTGTCCNCTACTTACCAGGCTTCTATTTCACCGGCNAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTNACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAANAATTGCAAAAATGAACAGCTTCAGCAATGACNACTTTGACTTCAGCTTCCNGGAGGAAGGCTTCNCTGCCAGGGATATTGNGGAGCAAAANATCAATGAAGNGTCCTTATCTGACGACAAANATGCCTTTTATGTTGCTGATCTNGGCGACATTGTGAAAAAGCANGNGCGTTGGTTTAAAGCGCTCCCCCGNGTCACTCCGTTTTATGCCGNAAAANGCAACGATGGCAAAGCCATTGNGAANACNCTCNCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCA
  5   1   2       chi Egg3      in                    IMAGE:3379438.5p                                                                                                                                                                               CCGGGTCGTCGCTTGTGCAAGTGTTAGTCATGTTTAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTACAATGCAATGACAGCGAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTGTGATTGTGCCAGTAAGACTGAAATCCATTAGTACAGAGTATTGGACGATCCCCGCGAGCGGATTATTTATGCGACACCATAGAGACGAGTGTTCCACGATACAATATGTCAGTCCGTTGGCGTGGCAGAGATAACGATTAGTGATGTGGAG
  5   1   2       bld Tbd3      in                    IMAGE:3550196.5p                                                                                                                                                                               GAGCATCGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAATATTGGAGTA
  5   1   2       bld Ov1  5g                         IMAGE:6318570.5p                                                                                                                                                                               TCTGCTTTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGGTAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGGTGTGGAGAAGATGACTTTTTGATAGTGAAGTTGAACTGATGGAAAGTGGCAAGGGAATCCACCCGAATGGCAAAGCTTTGGTTCTTACCGCATAGCCAAACTGAATGGACTCCAAAAAGGCCAAGTCTTGccccccccTCCAAGGGGTGGGAAAAATTTTGGGGTGGGCCCACCCCCTTTATAAAAACCAAGGGCAAGGGCCTGGGCCTTTTCTGGGGGAGACGCGGGGCACAAAAGGGGAAGCCTT
  5   1   2       chi Oo1                             IMAGE:6638025.5p                                                                                                                                                                               TCCCGATGCTGGTTCTAGTTACGGATAGCTGCTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGGAGTTTTCCCGCGAGCGGGATTATCTATTGCAAACCCGGTGTAAAACAAGGTTTCCCCAAGATCAAAATACCGCAGCGTTACCCTggggggggTGGAAGAAACAATTGACTTTTTTGAATAGGTGGAAGCTTGGAAATTGGATAGAAAAGGGGGGCTCAGGGAAAATCACCCCCCAAAATGGCCAAAAGACTTTGGTTCCTCAACCGCCATTAACGAAACCCTGGATTAGACCTCCAAAAAAAGCCAAGGTTTTGGGCCGCGCCTCTCAAATGGGTGGaaaaaaaaTTTGGGGGGGCGCCCCACCACCTTTGTAAAAGACAAAAGACACGGGGGCGTGGATCTTACCCCGGGGAACACCGGGGGCCTAAACAGGAGGAGAGGCTTTCGAGAATGGGTGGGGGGAAA
  5   1   2      seed Oo1  5g                         IMAGE:6859260.5p                                                                                                                                                                               TCTGCTTTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCCTTCTGGAGCGGGCAAAGGAGCTTAATGGGGATATAATTGGGTGTGAGTTTC
  5   1   2       bld Egg3 5g                         IMAGE:6326741.5p                                                                                                                                                                               CCGGGTCGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCCTTAAAACAAGCCGGGCTACTTCTGGGAGCGAGCAAAAAGAGCTTAATGTGGGATATAAATTGGGTGTAAAC
  5   1   2       bld Egg3 5g                         IMAGE:6867128.5p                                                                                                                                                                               CCCCGGGCGTCGCTTGTGCTGCGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGGGCCACCCTTAAAACCAGCCGGGGTACTTCTGGAGCGAGCAAAAGAGCTTAATGGGGAATATAATTGGTGGTAAGGTTCCC
  5   1   2       bld Ga15 5g                            XL402m20ex.5p                                                                                                                                                                               CTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGGCAAGGNAATCACCCG
  5   1   2       bld Ga15 5g                            XL431b04ex.5p                                                                                                                                                                               CTGCTCTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCNAATGCAAAGCTTG
  5   1   2       bld Ga15 5g                            XL487o06ex.5p                                                                                                                                                                               CTGCTCTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGGAAGTTGAACTGATGAAAGTGGCAAGGAATCACC
  5   1   2       bld DMZ  5g3  in                         xl252e12.5p                                                                                                                                                                               GGCAGTCGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATC
  5   1   2       bld DMZ  5g3  in                         xl308i22.5p                                                                                                                                                                               GGCAGTCGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTCTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAACAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCCGCTAGCTGTGGTG
  5   1   2       bld DMZ  5g3  in                         xl303h13.5p                                                                                                                                                                               GGCAGTCGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTCTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAACAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCCGCT
  5   1   2       bld DMZ  5g3  in                         xl264j18.5p                                                                                                                                                                               CTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAG
  5   1   2       bld DMZ  5g3  in                         xl274f18.5p                                                                                                                                                                               CTGCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGT
  5   1   2       bld Oo1  5g                         IMAGE:6640150.5p                                                                                                                                                                                GCAGTCGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGGTGTGGAAAAGATGACTTTNTGATAGTGAAGTTGAACTAATGGAAGTGGCAAGGAATCACCCAAATGCNAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCAGTCTGCCGCCTCAGTGTGAAATTTTGGTGCCACCCTTAAAACAAGCCGGNCTACTTNCTGGAGGCGAGCAAAGAGCTTATGTGGGATNATAATTGGNTGTAAAGTTTCCATGTTTGGCAGTGGTCTGCACGGNATCCCC
  5   1   2       bld Egg3 5g                         IMAGE:6326156.5p                                                                                                                                                                                TCCCGGGGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCCTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCANAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGAAGCGGGCAAAGGAGCTTAATGTGGATATAATTGGGTGTGAGTTTCCC
  5   1   2       bld Egg3 5g                         IMAGE:6868788.5p                                                                                                                                                                                TCCCGGGGTCGCTTGTGCTGCTGTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAAGCCGCTACTTCTGGAGCGAGCAAAAGAGCTTAATGTGGATATAATTGGGTGTAAGTTTCCATGTTTGGCAGTGGGCTGCACTGNATCCTCAGACN
  5   1   2       add Emb1 5x                         IMAGE:6863765.5p                                                                                                                                                                                TGCTTTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCtttttttttGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGGTTTGACTGTGCCCGTAAGACTGAAATCCCACTAGTACAGAGTATTGGGAGTTTCCCCCCAGCGGATTATCTATGCCAACCCGGGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGGGGGGTGGAGAAAAAAACTTTTGATAGTGGAAATTGAACTTGTGAAAATGGGGAAGGAATCCCCCCCAATGCCAAGGCTTGGTCTACGCCCTAGCCAACTGGTGGACTCCAAAAGCAGGCTTGCCCGCCTCCaaggggggaaatttggggccccccctttaaaaaaagaagggctgggttctggggagcggggGCA
  5   1   2       bld Ga15 5g                            XL422l05ex.5p                                                                                                                                                                                GCAGTCGTCGCTTGTGCAAGCATTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCCANATCAAATATGCAGCTAGCTGTGGTGTGGAAAAAGATGACTTTTGATAGTGAAGTTG
  5   1   2       bld Emb9 5g                         IMAGE:7976841.5p                                                                                                                                                                                CTGCTTTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGGAATCACCCGAATGCAAAGCTTGTTCTACGCATA
  5   1   2       bld Emb9 5g                         IMAGE:7974162.5p                                                                                                                                                                                CTGCTCTGCTGGTTCTAGTTACGGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAATACGCAGCTAGCTGTGGTGTGAAGAGATGACTTTTGAAATGAAGTTAACTGATGAAGTTGCAAGGATCCCCCAATGCAAGCTTGTTCTCGCTTACAAA
  5   1   2       bld Lmb1 5g                         IMAGE:8533531.5p                                                                                                                                                                                CTGCTTTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCGAGCGGATTTCTATGCAACCCGTGTAANCAGTTTCCAGATCAATACGCACTAGCTGTGGTGTGAGAGATGACTTTGATATGAAGTGACTGATGAAGTGCAAGGATCACCGATGCAAGCTGTCTACCATACACTGAGACCAAGCAGCTGCGCTCTGGGATTTGTGCCCCTAACACAGCGCTCGGA
  5   1   2       bld Ga18      in                      xlk161h16ex.5p                                                                                                                                                                                TCTGCTNNNNNGTTCTAGTTACGGATAGCTGTTAGGAGCTNNNNNGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGNAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAANCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGNNGACTTTTGATAGTGAAGTTGAATTGATGAAANNG
  5   1   2       bld DMZ  5g                              xl335b06.5p                                                                                                                                                                                CTGCTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACNAGTTTCCCAGAT
  5   1   2       bld DMZ  5g   ?                          xl286d11.5p                                                                                                                                                                                CTGCTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGA
  5   1   2       bld DMZ  5g3  in                         xl288i19.5p                                                                                                                                                                                CTGCTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGAT
  5   1   2       bld DMZ  5g   ?                          xl307b07.5p                                                                                                                                                                                CTGCTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAG
  5   1   2       bld DMZ  5g3  in                         xl338j10.5p                                                                                                                                                                                CTGCTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAG
  5   1   2       bld Ooc1 5g3  in                     Ooc1-db23a09.y1                                                                                                                                                                                 GGGTCGACCCACGCGTCCGCGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGG
  5   1   2       bld Egg3 5g                         IMAGE:6868734.5p                                                                                                                                                                                 CCGGGCGTCGCTTGTGCTGCGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCCCCCTTAAAACAAGCCGGCTACTTCTGGAGCGAGCAAAAGAGCTTAATGTGGATATAATTGGGTGTAAGGTTTCCATGTTGGCAGTGGCTGCACC
  5   1   2       add Ga15 5g3  out                      XL468d14ex.5p                                                                                                                                                                                 GCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCCCCNGGTTATTTGNGGCCNCNATGGGNACANATTTCGNAAATGCTTTTTAAAAATACAAACAGCAAAACAGCGCAAAGGGGCTCCATTGAAAGCGNAGGACTTGNCCTCTACTTACCAGGCTTCTATTTCACCGGCNAGCCTCCTTGGGAGTGAAACTGAANCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAG
  5   1   2       bld Ooc3 5x3  out                   IMAGE:3436700.5p                                                                                                                                                                                  AGTCGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTGTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTNTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTCCCCCG
  5   1   2       bld Ga15 5g                            XL428p17ex.5p                                                                                                                                                                                  CTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCA
  5   1   2       bld Ga15 5g                            XL435i17ex.5p                                                                                                                                                                                  CTCTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCA
  5   1   2       bld Ga15 5g3  in                       XL458p17ex.5p                                                                                                                                                                                  CTTTGCTGGTTCTAGTTACNGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCA
  5   1   2       bld Ga15 5g                            XL470o19ex.5p                                                                                                                                                                                  CTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCCGAATGCAAAGCTTGTTCTACGC
  5   1   2       bld Spl  5g3  in                    IMAGE:8463781.5p                                                                                                                                                                                  CTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTG
  5   1   2       bld Ga18      in                      xlk142b04ex.5p                                                                                                                                                                                  GCAGTCGTCGCTTGTNCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCNNNNNNCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAANNCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGNGTGGAAAAGATGACTTTTNATAGTGAAGTTGAACTAATGAAAGNGGNAAGGAATCACCCAAATGCAANGNTNGTNCTGCGCATNNNNCTGATGACTCAAAAGCAGNCTNCC
  5   1   2       bld Ga18 5g                            xlk63k01ex.5p                                                                                                                                                                                  GCAGTCGTCGCTTGTNCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCANNNNNCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAANTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACNGCTNNNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATNNTGAAAAAGCACTTGCGTTGGNTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACANCAAANNCGTTGTGAAGACTCTCTCCATTCTTGGNNCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGNG
  5   1   2       bld DMZ  5g3  in                         xl246d04.5p                                                                                                                                                                                  GCTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttCNCCNGGTTATTTGNGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAANAATACAAACAGCANAACAGCGCAAAGNGGCTCCATTGANAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACNACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGNGGAGCAAAANATCAATGAAGTGTCCTTATCTGACGACAAANATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGNGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAANACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACG
  5   1   2       bld Tbd1 5g                              AW765400.5p                                                                                                                                                                                   GTCGTCGCTTGTGCAAGCGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTG
  5   1   2       bld Tbd5 5g3  in                    IMAGE:3580530.5p                                                                                                                                                                                   CTTTGCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTNTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTNTCCCAGATCATATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTATTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCA
  5   1   2       bld Emb4 5g                         IMAGE:4680136.5p                                                                                                                                                                                   TTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACT
  5   1   2       bld Neu4      in                    IMAGE:4084140.5p                                                                                                                                                                                   TTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCCTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCCCCCCATTCTTGGC
  5   1   2       bld Ov1  5g3  in                    IMAGE:5074766.5p                                                                                                                                                                                   ATATCGTCGACCCACGCGTCCGGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTA
  5   1   2       bld Oo1  5g                         IMAGE:6639391.5p                                                                                                                                                                                   TTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGGTGGAGAAGATGACTTTTTGATAGTGGAAGTTGAATTGATGAAAAGTGGCAAGGGAATCACCCGAAATGCAAAAGCTTGTTCCTACNGCATTAGCAACTGGATGGAACTCAAAAAGCAGTTCTGGCCGCCCCTCAGGGGGGGAAAAATTTGGGTTGCCCCACCCTTTAAAAAACAAGCAAGGCCTGGCCTTTCTTGGGAGCCGGGGNCACAAAGGGGAGGCCTTTAATG
  5   1   2       bld Ga15 5g3  in                       XL402e10ex.5p                                                                                                                                                                                   TCGTCGCTTGGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAAGATGACTTTTGATA
  5   1   2       bld Ga15 5g3  in                       XL460d04ex.5p                                                                                                                                                                                   TCGCTTGTGCAAGATGTTAGTCAGGGCATAGCGTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCT
  5   1   2       bld Ga15 5g3  in                       XL497a14ex.5p                                                                                                                                                                                   CTTTGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttCNCCTGGTTATTTGNGGCCTCGATGGGTACANATTTCGTAAATGCTTTTTAANAATACAAACAGCANAACAGCGCAAAGNGGCTCCATTGANAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGANACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACNACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGNGGAGCAAAANATCAATGAAGNGTCCTTATCTGACNACAAANATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGNGTCACTCCGTTTTATGCCGNAAAATGCAACNATGGCAAAGCCATTGTGAANACTCTCTCCATTCTTGGNGCCGGCTTTGACTGTGCCAGTAAAACTGAAATCCAACTAGTACANAGTATTGGAGTTTCCCCCNANCGGATTATCTATGCAAACCCGNGTAAACAAGTTTCCCAAAATCAAATACC
  5   1   2       bld Ga18      in                       xlk74g24ex.5p                                                                                                                                                                                   CTCNNNNGTTCTAGTTACGGATAGCTGTTAGGAGCTNNNNNGAGGAAGTCTCttttttttCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGNAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAANCATTGTGAAGACTCTCTCCATTCTTGGTNCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGANGACTTTTGATAGTGAAGTNGAACTGATGAAAGNG
  5   1   2       bld Ga18 5g3  in                      xlk157p10ex.5p                                                                                                                                                                                   CTCNNNNGTTCTAGTTACGGATAGCTGTTAGGAGCTNNNNCGAGGAAGTCTCttttttttCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGNAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGNTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCANNNNNNGTTCTACGCATAGNAACTGATGACTCAAAAGCAGNCTGCCGCCTCAGTGTGAAANTTGGTGCCACCCTTAAAA
  5   1   2       bld DMZ  5g                              xl243i19.5p                                                                                                                                                                                   GTCGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCA
  5   1   2       bld DMZ  5g                              xl310j08.5p                                                                                                                                                                                   GTCGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATG
  5   1   2       bld DMZ  5g3  in                         xl319m11.5p                                                                                                                                                                                   CTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGAT
  5   1   2       bld DMZ  5g3  in                         xl324i20.5p                                                                                                                                                                                   CTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGC
  5   1   2       bld DMZ  5g3  out                        xl288c23.5p                                                                                                                                                                                   CTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTG
  5   1   2       bld DMZ  5g3  in                         xl303i10.5p                                                                                                                                                                                   GTCGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATG
  5   1   2       bld DMZ  5g3  in                         xl303g06.5p                                                                                                                                                                                   GTCGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTG
  5   1   2       bld DMZ  5g3  in                         xl299i20.5p                                                                                                                                                                                   GTCGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGT
  5   1   2       bld DMZ  5g   ?                          xl264n18.5p                                                                                                                                                                                   CTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAANATCAATGAAGTGTCCTTATCTGACGACAAACATGCCTTTTATGTTGCTGATCNTG
  5   1   2       bld DMZ  5g                              xl331g04.5p                                                                                                                                                                                   CTTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGT
  5   1   2       bld Emb4 5x3  out                   IMAGE:4960101.5p                                                                                                                                                                                    TTTGCTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTNTGACTGTGCCAGTAAGACTGAA
  5   1   2       bld Spl  5g3  in                    IMAGE:8464518.5p                                                                                                                                                                                    TTTGCTGGTTCTAGTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCCCAGCGGACTATCTATGCAAACCCGTGTTAACAAGTTTCCCGGATTAATACGCAGCTAGCTGTGGTGTGTAGAAGAGTATTTTGATATTGAGTTGATTGATGAAATGGCAGGATCACCCGA
  5   1   2       bld Ga18      in                      xlk149f22ex.5p                                                                                                                                                                                    AGTCGTCGCTTGTNCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGNNNNCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTNNNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGNCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGNTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAANNTTGTTCTGCGCATAGNNNCTGATGACTCAAAAGCAGTCTGNCGNCTCAGTGTGAAANTTGGTGCCACCCTTAAAACAAGCCGGCTACTTCTGGAGCGAGNAAAAGAGCTTAATGTGGATNT
  5   1   2       bld Tbd1 5g                              AW764423.5p                                                                                                                                                                                     CGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTG
  5   1   2       bld Ga15 5g                            XL415f12ex.5p                                                                                                                                                                                     CGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGCGGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAAGATGACTTTTGATAGTGAAGTTG
  5   1   2       bld Ga15 5g3  in                       XL464d11ex.5p                                                                                                                                                                                     CGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAANATGACTTTTGATAGTGAANTTGAACTAATGAAA
  5   1   2       bld Ov1  5g                         IMAGE:8330139.5p                                                                                                                                                                                     CGTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCTCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAATATGCCCCTAGCTGTGGTGTGGAAAGATGACTTTTGTAGTGAAGTTGAACTATGAAAGTGGC
  5   1   2       bld Ga18 5g                           xlk123j23ex.5p                                                                                                                                                                                     TGCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTNNNCNGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCAttttttttGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGNAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGNTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTCGCTGATCTTGGNGACATTGTGAAAAAGCATGTNNGTTGGNTTAAAGCGCTCCCCCGTGTCACTCCGNTTTATGCCGTAAAATGCAACGATGNNAAAGCATTTGTGAAGACTCTCTCCATTCTTGGNGCCGGCTTTNACT
  5   1   2       bld DMZ  5g3  in                         xl314a23.5p                                                                                                                                                                                     GTCGCTTGGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGC
  5   1   2       bld Neu4 5g3  in                    IMAGE:3557131.5p                                                                                                                                                                                      GCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTAATGGAGTTTNCCCCGAGCGGGATATCTATGCAAACCCGTGTAAACAAGTTTTCCAGATCAAATACGCACCT
  5   1   2       bld Tbd7 5g3  in                         XL074j16.5p                                                                                                                                                                                      AGGGCTTGTGCAAGTGTTAGTNGGGNATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTAT
  5   1   2       bld Oo1  5g                         IMAGE:6638488.5p                                                                                                                                                                                      CACGCGTCCGGTTACCGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCCGAATGCAAAAGCTTGGTTCCTACGCATAGCAAACTGGATGGTACTCAAAAAGCAGTCCTGCCCGCCNTCAGGTGTTGAAAATTTTGGGTGGCCCACCCCCTTTAAAAACCAAAGCAGGGGCTGCCT
  5   1   2       bld Oo1  5g                         IMAGE:5084367.5p                                                                                                                                                                                      GTCGCTTGTGCAAGCATTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGGAAGTGAACTAATGAAAGGGCAAGGGATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTTGCCGCCCTCAGTGGGGAAAATTTGGTGGCCCACCCCTTAAAAACAAAGCC
  5   1   2       bld Egg3 5g                         IMAGE:6325107.5p                                                                                                                                                                                      TCCCGGGTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCCTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAANAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCCGTAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGGAATCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCANATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGNTGAACTGATGAAAGTGGCAGGGATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCANAAGCAGTCTGCCCGCTCAGTGTGAATTTGGGTGCCACCCTTAAAACAGCAGGCTGCTTCTGGAGCGGGCAANGGAGCTTAATGTGGATATAT
  5   1   2       bld Ga15 5g                            XL426f17ex.5p                                                                                                                                                                                      GCTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCANATCAAAT
  5   1   2       bld Spl  5g                         IMAGE:8462549.5p                                                                                                                                                                                      GTCGCTTGTGCAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCTATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAGATGACTTTGATAGTGAAGTGAAACTATGAAGTGGCAGGATCACCAATGCAAGCTGTCTGCGCATACACTGAGATCAAGCATCTGCGCTCGTGGAATGGTGCACCTAACAGCGCT
  5   1   2       bld Ga18      in                      xlk161j04ex.5p                                                                                                                                                                                      TCGTCGCTTGTNCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGNNNNCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTNNNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAANNCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTNNCCCCGAGCGGANTATCTATGCNAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGNGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGNG
  5   1   2       bld Ga18      in                      xlk162b15ex.5p                                                                                                                                                                                      TCGTCGCTTGTNCAAGCATTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGNNNNCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTNNNNNATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCANNNNGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGNTAGNTGTGGTGTGGAAAAGANGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGNAAGGAATCACCCAAATGCAAANNTTGTNCTGC
  5   1   2       bld Ga18 5g3  in                      xlk101l15ex.5p                                                                                                                                                                                      TCGTCGCTTGTNCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCANNNNNCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTNNNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGNCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTNAGACTGAAANCCAATTAGTACAGAGNATTGGAGTTTCCCCCGAGCGGANTATCTATGCNAACCCATGTNANCAAGTTTCCCAGATCNAATATGCAGCTAGCTGTGGTGTGGAAAAGANGACTTTTGATAGNNAGTTGAACTAATGAAGNGGNAGGGAA
  5   1   2       bld DMZ  5g3  in                         xl236d19.5p                                                                                                                                                                                      GTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGA
  5   1   2       bld DMZ  5g3  in                         xl247i06.5p                                                                                                                                                                                      GTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGC
  5   1   2       bld DMZ  5g3  in                         xl229l10.5p                                                                                                                                                                                      GTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTG
  5   1   2       bld DMZ  5g3  in                         xl255l21.5p                                                                                                                                                                                      GTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTG
  5   1   2       bld DMZ  5g3  in                         xl247n15.5p                                                                                                                                                                                      GTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTCTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAACAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCCGCTAGCTGTGGT
  5   1   2       bld DMZ  5g3  in                         xl252k15.5p                                                                                                                                                                                      GTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGT
  5   1   2       bld DMZ  5g3  in                         xl231m07.5p                                                                                                                                                                                      GTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGT
  5   1   2       bld DMZ  5g3  in                         xl311n03.5p                                                                                                                                                                                      GTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCA
  5   1   2       bld DMZ  5g3  in                         xl311b14.5p                                                                                                                                                                                      GTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTCTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAACAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCCGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAG
  5   1   2       bld DMZ  5g3  in                         xl308k10.5p                                                                                                                                                                                      GTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTG
  5   1   2       bld DMZ  5g3  in                         xl294d13.5p                                                                                                                                                                                      GTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGT
  5   1   2       bld DMZ  5g3  in                         xl285d16.5p                                                                                                                                                                                      GTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCC
  5   1   2       bld DMZ  5g3  in                         xl313m07.5p                                                                                                                                                                                      GTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTCTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAACAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCCGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAAC
  5   1   2       bld DMZ  5g3  in                         xl224h22.5p                                                                                                                                                                                      GTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTCTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAACAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCCGCTAGCTGTGGTGTGG
  5   1   2       bld DMZ  5g3  in                         xl267o06.5p                                                                                                                                                                                      GTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTG
  5   1   2       bld DMZ  5g3  in                         xl240j15.5p                                                                                                                                                                                      GTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGT
  5   1   2       bld DMZ  5g3  in                         xl240l01.5p                                                                                                                                                                                      GTCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGA
  5   1   2       bld Ooc3 5g                         IMAGE:3436353.5p                                                                                                                                                                                       CTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTNTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTGCCCCGAGCGGATTATCTATGCTAACCCGTGTAAACAGGTTTCCCAGATCAAATACGCAGCTAGC
  5   1   2       bld Tbd3 5g3  in                    IMAGE:3548681.5p                                                                                                                                                                                       GCTGGTTCTAGTTACGGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTATGACTGTGCCAGTAAGACTGAAGTCCAACTAGTACAGAGTAGTTGGAGTTTCCGCGAGCGGATTATCTATTCCAAACCC
  5   1   2       bld Oo1  5g                         IMAGE:5083735.5p                                                                                                                                                                                       CTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGNAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCNAAAGCAGTCTGCCCGCTCAGTGTGAAATTTGGNTGCCACCCTTAAAAACAAGCAGGGCTGGCTTCTGGGAGCGGGCAAAAGGAGCTTTAATTGGGGGATAATAATTGGGGTGTGGAGTTTT
  5   1   2       bld Oo1  5g                         IMAGE:5083873.5p                                                                                                                                                                                       CTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTNTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCCGCCTCAGTGGTGGAATTTTGGTGGCCACCCTTTAAAACAAGCAGGGCTGGCTTTCTGGGAGCGGGGCAAAAGGGAAGCTTAATGGGGGGAAAATAAATTG
  5   1   2       bld Ga15 5g3  in                       XL460n10ex.5p                                                                                                                                                                                       TCGCTTGTGCAAGCATTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTACAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAA
  5   1   2       bld Ga15 5g                            XL408d20ex.5p                                                                                                                                                                                       CTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAAT
  5   1   2       bld Ov1  5g3  in                    IMAGE:8327961.5p                                                                                                                                                                                       TCGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTT
  5   1   2       bld Ov1  5g                         IMAGE:8331405.5p                                                                                                                                                                                       GCTGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGT
  5   1   2       bld Ga18 5g3  in                       xlk72b03ex.5p                                                                                                                                                                                       TGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGNAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGNNGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCATTGTGAAGACTCTCTCCATTCTNNNGCCNNNTTTTGANTGTGCCAGTNAGACTGAAANCCAACTAG
  5   1   2       bld DMZ  5g3  in                         xl301a14.5p                                                                                                                                                                                       CTGGTTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTG
  5   1   2       bld DMZ  5g3  in                         xl279g02.5p                                                                                                                                                                                       CGCTTGGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTG
  5   1   2       bld Emb1 5g                         IMAGE:3401608.5p                                                                                                                                                                                        CGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGGTATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTACAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTGTGATTGTGCCAGTAGACTGGAA
  5   1   2       bld Tbd3 5g                         IMAGE:3548044.5p                                                                                                                                                                                        CTGGTTCTAGTTACGGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTATGACTGTGCCAGTAAGACTGAAATCCAACTAGTACATAGTATTGGAGTTTACCTCCGAGCGGATTATCTATGCCTAACCCGTGTAAACAAGTTTACCAGATCAGATACGCCAGCTAGCTGGGGTGTGGGGAAGATGACCTTTGATAGGGAAGTN
  5   1   2       bld Neu7 5g3  in                         XL033f18.5p                                                                                                                                                                                        ACGAGGGCAAGTGTTAGTCAGGGNATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCANAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTNCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGT
  5   1   2       bld Neu7 5g3  in                         XL034l12.5p                                                                                                                                                                                        GGCTTGTGCAAGTGTTAGTNGGGNATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGC
  5   1   2       bld Oo1  5g                         IMAGE:5085079.5p                                                                                                                                                                                        GCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCTATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGGAAATTTGGTGCCCACCCTTAAAACAAGGCGGGCTACTTTCTGGGAGCCGAGCAAAAAGAGCTTAAATGTGGGATATAAATTGGGA
  5   1   2       bld Ga15 5g                            XL482d14ex.5p                                                                                                                                                                                        CGCTTGTGCAAGCATTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAA
  5   1   2       bld Ga15 5g3  in                       XL517l06ex.5p                                                                                                                                                                                        CGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCAC
  5   1   2       bld Ov1  5g3  in                    IMAGE:8328944.5p                                                                                                                                                                                        CGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTCTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAACAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCNAATATGCCGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAAACTATGAA
  5   1   2       bld DMZ  5g3  in                         xl242d09.5p                                                                                                                                                                                        CGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTT
  5   1   2       bld DMZ  5g3  in                         xl236o02.5p                                                                                                                                                                                        CGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTG
  5   1   2       bld DMZ  5g3  in                         xl243f17.5p                                                                                                                                                                                        CGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGT
  5   1   2       bld DMZ  5g3  in                         xl301f08.5p                                                                                                                                                                                        CGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAA
  5   1   2       bld DMZ  5g3  in                         xl274n05.5p                                                                                                                                                                                        CTGGTTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTC
  5   1   2       bld DMZ  5g                              xl289e10.5p                                                                                                                                                                                        CGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAGATGACTTTTGATAGTGAAGTT
  5   1   2       bld DMZ  5g3  in                         xl330k17.5p                                                                                                                                                                                        CGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTG
  5   1   2       bld DMZ  5g3  in                         xl330c11.5p                                                                                                                                                                                        CGCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGT
  5   1   2       bld Egg3 5g3  in                    IMAGE:3377879.5p                                                                                                                                                                                         CCGGGCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCCTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGGTTAAAGCGCTCCCCCGGGTCACTCCG
  5   1   2       bld Emb3 5g                         IMAGE:3398909.5p                                                                                                                                                                                         TGGTTCTAGTTACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGA
  5   1   2       bld Ooc3 5g                         IMAGE:3436564.5p                                                                                                                                                                                         CTGGTTCTAGTTACGGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTNTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAANGGAATCACCC
  5   1   2       bld Oo1  5g                         IMAGE:6859127.5p                                                                                                                                                                                         GCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACCGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGGCAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTNTAAAACAAGCCGGCTACTTTCTGGAGCGAAGCAAAGAGTTTAATGGTGGATATAATTGGGTGTAAAGTTTCCATGGTTGGCAAGTGGCTGGCACTGATTCCTCAGAACTT
  5   1   2       bld Oo1  5x                         IMAGE:6861048.5p                                                                                                                                                                                         TCGCTTGTGCAAGTGTTAGTCTGGCATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACCGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGANATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGGAATCACCCCAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGGCCGCCTCAGTGTGAAATTTGGTGGCCACCTTTTAAAACAAGGCCGGCTACTTTCTGGGAGCGAAGCAAAAAGAAGTTTAATGGGGGATATTAATTGGGTGTAAAGGTTTCCATGTTTGCCAAGTGGGCTGGCCCTGGATCCTCCAAAACT
  5   1   2       bld Egg3 5g                         IMAGE:6324106.5p                                                                                                                                                                                         TCCCCGGGGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCCTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATNGAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCANAAGCAGTCTGCCGCCTCAGTGGTGAAATTTTGGTGCCACCCTTTAAAACAAGCANGGCTGCTTNCTGGGAGCGGGGCAAAGGAAGCCTTAATGGTGGGATANTAATTTGGGTGGTGGAGTTTTCCAATGGTTGGGCAGATGGGGCTGGCACT
  5   1   2       bld Ga15 5g                            XL496i12ex.5p                                                                                                                                                                                         GCTTGTGCAAGCATTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATA
  5   1   2       bld Ga18      in                       xlk68p23ex.5p                                                                                                                                                                                         TCNNTTGTNCAAGCATTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGANNGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAANTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTNNNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCANNNNNTTGTGAAGNCTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTNAGACTNAAATCCAATTAGTACAGAGTANTGGAGTTTCCCCCGAGCGGATTATCTATGCNAACCCATGTAAACAAGTTTCCCAGATCAAANNTGCAGCTAGCTGNNNGTGNAAAAGATGACTTTTGATAGTGAAGTTGAACTA
  5   1   2       bld Ga18      in                       xlk59o23ex.5p                                                                                                                                                                                         TCNNTTGTNCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCANNNNNCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTNNNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCANNNNNNTGTGAAGACTCTCTCCATTCNTNGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGNACAGAGTATTGGAGNTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATNNNCAGCTAGCTGTGGTGTGGNAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGNNGNA
  5   1   2       bld DMZ  5g3  in                         xl308a12.5p                                                                                                                                                                                         GCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTT
  5   1   2       bld DMZ  5g3  in                         xl269o11.5p                                                                                                                                                                                         GCTTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTT
  5   1   2       bld Neu7 5g3  in                         XL031f18.5p                                                                                                                                                                                          CGAGGGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTG
  5   1   2       bld Oo1  5g                         IMAGE:6643591.5p                                                                                                                                                                                          TTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCTATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCAGTCTGCCGCCTCAGTGGGGAAATTTGGTGCCACCCTTAAAACAAGCCCGGCTACTTCTGGAGCGAGCAAAAGAGCTTATGTGGGATATTAATTGGTGGTAGTT
  5   1   2       bld Oo1  5g                         IMAGE:6860970.5p                                                                                                                                                                                          TTGTGCAAGTGTTAGTCACGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTCCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCTATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCCAAGCTTGTTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCTTCAGTGGGAAATTTGGTGCCACCCCTTAAAAAAAGCCGGGCTACTTTTGGAAGCGAGCCAAAAGAGCTTTATGTGGATATAATTGGGTGGTAAGTTTCCATTGTTGGGCAGTGGCTTGCACTG
  5   1   2       bld Oo1  5g                         IMAGE:5079518.5p                                                                                                                                                                                          TTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCTATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCCTCAGTGGTGAAATTTTGGTGGCCACCCCTTTAAAAACA
  5   1   2       chi Egg3                            IMAGE:6868081.5p                                                                                                                                                                                          CCCGGGAGTTACTGATAGCTGCTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCCTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAAACTCTCTCCATTCTTGGGGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTGGCCCCGAGCGGATTATCTATGGAAACCCGGGGAGACGCGTTTCCCAGATCGAATACGCGCCCTACCTGGGGGGTGGGGCAAGACGCCCGTCGACCCTGACGGTCGCCTGGTGGGACGGCGGCGAGGGGCCCGGAACGCCGAAGGCGGTGCCTCCCGGACCAGAGGGGCGACTAGGGAGCCGCCGCGCCACCGCGTCATAGGATAGTGCCGCGGCCCACACCCTAGCGAAGGCGTCTCGCTGGGGGCCCGTCTAGCCGCCAACGCCGTCGAGCGGGGGCGGCACATAGGGGACGCCGCGGCCACCCTACACTGCAGGAGACCGTCGAGGCAGGCTCGTTGCGGGTGAGCTCGGACTCGCGGGACTCGAGTGCTCCCCCGCCACGTGTCGCCTTTTCGCTGCTGCGCAACC
  5   1   0       chi Egg3                            IMAGE:6871632.5p                                                                                                                                                                                          GATTCCCCGGGCTGATAGTTGTTATGCGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTNGCAGGGATATCGTGGGAGCAAAGAATCATGAAAGTGTCCTTATCTGACGACNAAGATGGCTTTTTATGTTGGCTGATNCTTGGCGACNTTGGTGAAAAAGCATGTGGCGGTTGGGTTTAAAGCGGCTCCCCCGGGGTCCCTCCCGGTTTTATGCCCGTAAAATTGGCACCGATGGGCAAAGCCCTTTTGGGGAAGAACTCTCCCCCCATTTCTTGGGGGGCCCGGGCTTTTTGACTTGGGGGCCCGGGAAAAAACTTGAGAATTcccccccctttgtcaaaggaggtttttggggggggtttttccccccgcgagggcgggtgtttttctcttttggggccaacccccccgggggggtaaaaaaaaattttttcccccagaaaaaaaaaataccccccccccttatcccgggggggggggggggggaaaaaaaaaaaaCCTTTTTTTAAAAAGGGGGAGGGGGGGAACCCGGTGTGAAAAAggggggggggggggAAATCTCCCCCCAAGGTGGGAAAGTGTTGGTTTTTCTCCCCCCTTTCTACCAGGGGGGTGTGGTCTTCAAAGAAAAATTTCGGcccccccccccggggggagaaaattttggggggcccccccccttaaaaaaaaaCAACGGTGTTTCTTCTTGGTGAGG
  5   1   2       bld Oo1  5g                         IMAGE:6638750.5p                                                                                                                                                                                           TTGTGCAAGCATTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAAATTTGGTGCCCACCCTTTAAAACAAGCCGGGCTACTTTCTGGGAGGCGAGCAA
  5   1   2       bld Oo1  5g                         IMAGE:6639484.5p                                                                                                                                                                                           TTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCACCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACCGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGANAGTGGCAAGGAATCACCCANATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGCCCGCTCAGTGGTGAAATTTGGTGGCCACCCTTAAAACAAGCCGGGCTACTTTCTGGGAGCGAGCAAAAAGAAGTTTAATGGGGGGATATAAATTGGGGTGTNAGNTTTTCCATGGNTGGNCAGTGGNNCTGCACTGGATCCNNTCAGAACTTAA
  5   1   2       bld Oo1  5g                         IMAGE:6642469.5p                                                                                                                                                                                           TTGTGCAAGCATTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGCAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTANAACAAGCCGGCTACTTCTGGAGCGAGCAAAAGAGCTTAATGGGGGAATAAATTGGGGGAAGTTTCCATGTTGGGCAGTGGCTGCACTGATCCTCATACTTATGG
  5   1   2       bld Oo1  5g                         IMAGE:6859027.5p                                                                                                                                                                                           TTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACCGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGGTGAAATTTGGTGCCACCNCTTAAAACAAGCCGGCTACTTCTGGAGCGAGCAANAGAGTTTAATGGTGGATATAAATTGGTGGGTAAGTTTCCATGGTTGGNNCAGTTGGCTGCACTGGATCCCTCAGAACT
  5   1   2       bld Oo1  5g                         IMAGE:6859367.5p                                                                                                                                                                                           TTGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACCGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGNCAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGGTGGCACCCTTAAAANCAGCCGGGCTACTTCTGGAGCGAGCAAAAAGAGTTTAATGGTGGATAATAATTGGGTGGTAAGTTNCATTGTTTGGCAGTGGGCTGGCACTGA
  5   1   2       bld Oo1  5g                         IMAGE:5084234.5p                                                                                                                                                                                           TTGTGCAAGCATTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTTCCCAGATCAAATATGGCAGCTAGCTTGGGGGGGTGGGAAAAAGAATGACCTTTTTGGATAAGGGGGAAGGTTGGGAAACTAAAATGGAAAAGGTGGGGCAAAGGGGAAATTCCAACCCCCCAAAATTGGGCCAAAAAGGCCTTTGGGGGTTCCTGGGGCGCGGCCCATTTAAAGCCCCAA
  5   1   2       bld Ga15 5g3  in                       XL422e07ex.5p                                                                                                                                                                                           TTCTAGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTT
  5   1   2       bld Ga18 5g3  in                      xlk147k12ex.5p                                                                                                                                                                                           GNTCTAGTTACGGATAGCTGTTAGGAGCTNNNNCGAGGAAGNCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGNACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGANTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGNGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGNNGCNTTTTGNAACCGAATAATTGCNAAAATGAACAGCTTCAGNNATGACGACTTTGACTTCNGNNTCCTGGAGGNAGGNTT
  5   1   2       bld Ga18 5g3  in                       xlk81m15ex.5p                                                                                                                                                                                           GTTCTAGTTACGGATAGCTGTTAGGAGCTNNNNNGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGNAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAANCATTGTGAAGACTCTCTCCATTCTTGGNNCNGGCTTTGACTGTGCCAGNNGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGNTTATCTATNCAAACCCGTGTAAACAAGTTTCNCAGATCAAATACGCAGCTAGNTGTGGTGTGGAGAAGATGACTTTTGATANTGAAGTGAACTGATGAAAG
  5   1   2       bld Ga18      in                       xlk74e15ex.5p                                                                                                                                                                                           GTTCTAGTTACNGATAGCTGTTAGGAGCTNTNNCGAGGAAGNCTCTTTTTTTCTCNCCTGATTATTTGTGGCCTCGATGGGGACAGATTTCGTAAATNCTTTTTNAGAATACAAACAGCAGAACANCGCAGAGTGGNTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGNGNGAGACTGAAGCTTTCTTTATAGNNNTNCCCATCTCTTACTTGTCCATTTTTTTGCATAA
  5   1   2       bld Ga18 5g3  in                      xlk165m14ex.5p                                                                                                                                                                                           GCTTGTNCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCNNNNNNCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTNNNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAANNCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTG
  5   1   2       bld Ga18      in                      xlk156h19ex.5p                                                                                                                                                                                           GTTCTAGTTACGGATAGCTGTTAGGAGCTNNNNNGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTNNNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAANNNNNTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGNTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCANA
  5   1   2       bld Egg4 5g3  in                    IMAGE:3744800.5p                                                                                                                                                                                            TGTGCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTNTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTTCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTTGGAAGACTCTCTCCATT
  5   1   2       bld Kid  5g                         IMAGE:7008865.5p                                                                                                                                                                                            CTAGTTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTA
  5   1   2       bld Ga15 5g                            XL483o21ex.5p                                                                                                                                                                                            TTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACNCATAGCAACTGATGACTCA
  5   1   2       bld Ga18      in                      xlk154d02ex.5p                                                                                                                                                                                            TTCTAGTTACGGATAGCTGTTAGGAGCTTNNNCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGNAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACNAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGNG
  5   1   2       bld DMZ  5g                              xl319a03.5p                                                                                                                                                                                            TTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATC
  5   1   2       bld DMZ  5g3  in                         xl317a03.5p                                                                                                                                                                                            TTCTAGTTACTGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGA
  5   1   2       bld Ov1                             IMAGE:5048618.5p                                                                                                                                                                                             CACGCGTCCGGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAAAT
  5   1   2       bld Te2  5g3  in                    IMAGE:7208079.5p                                                                                                                                                                                             TCTAGTTACGGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTGAACTGATGAAAGTGGCAGGGAATCACCGATGCAAAGCTGGTCTACGA
  5   1   2       bld Ga18      in                       xlk80d05ex.5p                                                                                                                                                                                             TCTAGNTACGGATAGCTGTTAGGAGCTTTGCCGAGGAAGTCTCTTTTTTTCTCNCCTGATTATTTGTGGCCTCGATGGGNACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGNGGCTCCATTGAGAGCGTAGGANTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGNGNGAGACTGAAGCTTTCTTTATAGNTNTCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGNNNCATTTTGNAANCGAATAATTNC
  5   1   2       bld Ga18      in                        xlk5i10ex.5p                                                                                                                                                                                             TTGTNCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCNNNNNNCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAANTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTNNNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCANNNNNTTGTGAAGACTCTCTCCATTCTTGGNGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGNACAGAGNATTGGAGNTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTNGNAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGNGG
  5   1   2       bld Ga18      in                      xlk105d22ex.5p                                                                                                                                                                                             TTGTNNAAGCATTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGNNNNCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACNGCTNNNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTNTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAANNCGTTGTGAAGACTCTCTCCATTCTTGGNNCCGGCTTTGATTGTNCCAGTAAGACTGAAATCCAATTAGTACAGAGNATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTNTCCCAGATCNAATATGCAGCTAGCTGTGGTGTGGAAAAGANGACTTTTGATAGTGAAGTTGAACTAATGAAAGNGGCA
  5   1   2       bld Ga18 5g3  in                      xlk158k06ex.5p                                                                                                                                                                                              TGTNCAAGTGTTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCANNNNNCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTNNNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAANNCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGNTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAANNTTGTTCTGCGCATAGNNNCTGATGACTCAAAAGCAGNCTGNCGNCTCAGNGTGAAANTTGGTGNCACCCTTAAAACAAGNCGGGNNCTTCTGGAGCGAGCAAAAGAGC
  5   1   2       bld Ga18 5x                           xlk116f21ex.5p                                                                                                                                                                                              GTNNAAGTGTTAGTCAGGGATAGCTGCTGTCCNNNNAGGTCTTTTTATTTTTCCGCCTGGTTATNTGTGGCCTCGATGGGTAGAGACTTCGTAAATNCNNTTTAAGAATACAAACAGCAGAACAGCGCAGAGAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAANTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATNAACGGCTNNNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATNNNNGAGCAAAAAATAAANNANGNGTCCTTATCTGANGNCNNANATGCTTT
  5   1   2       bld Egg3 5g3  in                    IMAGE:3378087.5p                                                                                                                                                                                               CCGGGCTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTNTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTTACCAGGCTTTTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAAGCTTGGCGTTGGTTTAAAGCGCCTCCCCGTGTCACTTCCGTTTA
  5   1   2       bld Sp1  5g3  in                    IMAGE:4963786.5p                                                                                                                                                                                               AGTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTG
  5   1   2       bld Ga18 5x                            xlk73f14ex.5p                                                                                                                                                                                               TTCTAGTTACGGATAGCTGTTAGGAGCTTNNNNGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTNNCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTNCATTTTGAAACCGAATAATTGCAAAAATGAACANTTCAGNAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAANGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCANNNCANTNTGAAGACTCTCTCCATTCTTGGNNCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATNCAAACCCGTGTAAACNAGNTNNCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGNNGACTTTTGATAGTGAAGTTGAACTGANGAAAGNNNAAGGAATCA
  5   1   2       bld Ga12 5g3  in                         XL147n04.5p                                                                                                                                                                                                GCAAGTGTTAGTNGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACA
  5   1   2       bld Egg3 5g                         IMAGE:6325788.5p                                                                                                                                                                                                CCGGGCTGATAGTTGTTAGTAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCANAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGGCTTCTGGAGCGGGCAAAGGAGCTTAATGTGGATATAATTGGGTGTTGAGTTNTCCATGGTTGGGGCAGTGGCT
  5   1   2       bld FaB  5g                         IMAGE:8072953.5p                                                                                                                                                                                                GTTACGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAAT
  5   1   2       bld Oo1  5g                         IMAGE:6639375.5p                                                                                                                                                                                                 TTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGGTGATTTGATTGAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGGTGAAATTTGGGGCCACCCCTTAAAACAAGCAAGCTGCTTTCTGGAGGCGGGGCAAAGGAGCTTAAGGGGGGAAATTAAATTTgggggggggAGGTTTCCCATGGTTGGGCAAGGGGGCTTGGCCCTTGGATTCC
  5   1   2       bld Oo1  5g                         IMAGE:6639422.5p                                                                                                                                                                                                 TTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGGTGGAGAAGATGACTTTTGGATAGTGGAAGTTGAAATTGATGAAAGNTGGCAAGGGGAATCACCCGAANTGCAAANGCTTGGTTTCCTACGCATAGCAACTGGGATGGACTCANNAAAGCAGTCTGGCCCGGCCNTCAGGTGGTGAAAATTTTGGGNTGCCCCACCCCTTNAAAAACNAAGNCAGGGNCTGGCTTTCCTGGNNAGCGGGGGCAAAGGGGAGCCTTTAAATGTGGGGAATATAAAATTGGGNTGGTTGAAGATTTTCCCAAATGTGTTTGGGCCAGTTGGGGGCTTGCCAACCTGGAT
  5   1   2       bld Oo1  5g                         IMAGE:6643998.5p                                                                                                                                                                                                 TTACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCCTTAAAAAAGCAGGCTGCTTCTGGAGCGGGCAAAGGAGCTTAATGGGGATATAATTGGTGTGAGC
  5   1   2       bld Emb1 5g3  in                    IMAGE:3401893.5p                                                                                                                                                                                                  TACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTGTGACTGTGCCAGTAAGACTGANATTCCACTAGTACAGAGT
  5   1   2       bld Gas7 5g3  in                    IMAGE:4083438.5p                                                                                                                                                                                                  CCGGGGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAAATGCACTTGTTCAG
  5   1   2       bld Emb4 5g                         IMAGE:4930161.5p                                                                                                                                                                                                  TACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCCGAATGCCAAGCCTTGTTCTACGCATAGCCAACGGGATGACTCCAAAAGCAGGTCTGCCGGCCTCAGGGGGTGAAATTTTGGTGGCCCACCCTTTAAAAACCAAGCAGGGCTGGCTTTCTGGGGAGCGGGGCCAAAAGGGAAGCCTTTAAATGTC
  5   1   2       bld Emb4 5g                         IMAGE:4679712.5p                                                                                                                                                                                                   CGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCAttttttttGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGGTTAAAGCGCTCCCCCGTGTCACTCCGGTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAAACTCTCTCCATTCTTGGTGCGGGTTTTGACTGGGCCAGTAAGACTGAAATCCAACTAAGACCGAGAATTGGAGTT
  5   1   2       bld Emb4 5g                         IMAGE:4679713.5p                                                                                                                                                                                                   CGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCAttttttttGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGGTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGGAAAATGCAACGATGGCAAAGCCATTTGTGAGACTCTCTCCATTTCTTGGGCCGGTTTTGAT
  5   1   2       bld Emb4 5g                         IMAGE:5571216.5p                                                                                                                                                                                                   CGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGGTGTGGAGAAGATGACTTTTTGATAGTGAAAGTTGAATTGGATGAAAGTGGCAAGGGAATCACCCGAAATGCAAAGCTTGTTCTACGCCTTAGCAACTGATGACTCAAAAGCAGTCTGCCGCCCTCAGGGGTGAAATTTGGGGGGCCACCCCTAAAAACAAGCAGGCTTGCTTCTGGGAGcgggggcaagggagcttaatgggggaaaataattggggggg
  5   1   2       bld Ov1  5g                         IMAGE:6317216.5p                                                                                                                                                                                                   TACTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGGAAGACTGAAATCCAACTAGTACAGAGTATTGGGAGTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAACCAAGTTCCCAGATCAAATACGCAGCTAGCTGGGGGGTGGAGAAAATGACTTTGGATAGGGAAGTTGAACTGAAGAAAGGGGCAAGGAATCCCCCGAATGCCAGGCTTGGTCTTCCCCTAAGAACCTGGAGAATTCAAAAGCAGTCTGCCGCCCTCGGGGGGAAATTGGGTGCCACCCCCTTAAAACCAACAGGGCTGCTTTCTGGGAGCGGGGGAAAAGGAGCTTAAgggggggaataaaattggggggggAGGTTTCCCTGTGTGGGCACGGGGTTTGCCCCCGAATCCCCCCAAAACTTATGGGTACCCGGGTGGGTCTCCAAAACGGCCCTATTGGTGC
  5   1   2       bld Oo1  5g                         IMAGE:6638066.5p                                                                                                                                                                                                   ACGGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAATCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGGAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGGAAATTTGGTGGCCACCCTTAAAAACAAGCAGGGCTGCTTTCTGGNAGCGGGGCAAAAGAAGGCTTAATG
  5   1   2       bld Te2       in                    IMAGE:7390229.5p                                                                                                                                                                                                   GACGGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAGGGATCACCCGAATGGCAAGCTTGT
  5   1   2       bld Ga15 5g                            XL441o07ex.5p                                                                                                                                                                                                    CATTAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAANTGAAAGTGGC
  5   1   2       bld Ga15 5g                            XL462g12ex.5p                                                                                                                                                                                                    CGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATC
  5   1   2       bld Ga15 5g                            XL476c05ex.5p                                                                                                                                                                                                    CGGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGA
  5   1   2       bld Oo1       in                    IMAGE:3405309.5p                                                                                                                                                                                                     GGATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATT
  5   1   2       bld Oo1  5g                         IMAGE:6642500.5p                                                                                                                                                                                                     GGATAGCTGGTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGGTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGGTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGGAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGATTCCCACATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGTATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCATGAGCAGTCTGCCGCCTCAGCGTGNAATTTGGTGCCACCCCTACAACAAGCAGGCTGCTTCTGGAGCGTGCAAAGGAGCTGTATGCGCATATAAATGGGAGGGAGTTCTCATGTTGGCAGTGGCTGCCCTGATCC
  5   1   2       bld Brn1 5g                         IMAGE:6955305.5p                                                                                                                                                                                                     GGATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAAGCCATTGTGAAGACTCTCTCCATTTCTTGGTGCCGGGCTTTGACTGTGCCCAGTAAAGACTGGAAATCCAAACCTAGTACAGAGGTATTGGGAGTTTTCCCCCCGAGCCGGGATTATTCTATGCAAAAACCCGTGGTAAAACAAGTTTTCCCCGGATTCAAAATACGCCACCCTAGCTTGTTGGTTGTGGAAAAAAGAAAGAACCTTTTTGAAATAGTGGAAAATTTGAAACCTAATGGAAAAGGTGGGCCAAGGGAAATTCCCCCCAAAATGGCCAAAGCCTTTGGTTTCTTAAGGCCTTAAGGCAAACCTGT
  5   1   2       bld Ga15 5g                            XL408a12ex.5p                                                                                                                                                                                                     TCCGGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCNATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGG
  5   1   2       bld Emb9 5g                         IMAGE:7978383.5p                                                                                                                                                                                                     CGGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACTACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAATGATCAATGAAGTGTCCTTATCTGACTACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTTAAGCGCTCCCCCGGTGTCACTCCGTTT
  5   1   2       bld Ov1  5g                         IMAGE:8331258.5p                                                                                                                                                                                                     CTGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGA
  5   1   2       bld Ga18      in                      xlk155o15ex.5p                                                                                                                                                                                                     GCATTAGTCAGGGNTAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCNGANNGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGNNTGAANNTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTNNNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCANNNNNTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAANNTTGTTCTGCGCATAGNNCTGATGACTCAAAAGCAGNCTGCCGCCTCAGTGTGAAANTTGGTGCCACCCTTAANNAAGCCGGCTACTTCTGGNGCGAGNAAAAGAGCTTAATGTGG
  5   1   2       bld Ooc1 5g3  in                     Ooc1-db25g04.y1                                                                                                                                                                                                      GGGTCGACCCACGCGTCCGGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTANAATGCAATGACAGCAAAGCCGTTGTGA
  5   1   2       bld Neu7 5g3  in                         XL045b22.5p                                                                                                                                                                                                      GGTNAGGGNATAGCTGCTGTCCGAGGNAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAG
  5   1   2       bld Ov1  5g                         IMAGE:6318569.5p                                                                                                                                                                                                      TGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGGTGAAATTTGGGTGCCACCCCTTAAAACCAAGCAGGCTGCCTTCTGGGAGCGGGGCAAAAGANAGCTTA
  5   1   2       bld Emb9 5g                         IMAGE:7978148.5p                                                                                                                                                                                                      GATAGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCCTCAGTGTGAAATTTGGGTGCCACCCTTAAAACAAGGC
  5   1   2       bld Emb9 5g                         IMAGE:7974406.5p                                                                                                                                                                                                      GGATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAATGCTTGTTCTACGCTAGCAACTGATGACTCAAAACAGTCTGCGCCTCATG
  5   1   2       bld Ooc3 5g3  in                    IMAGE:3437519.5p                                                                                                                                                                                                       GATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTT
  5   1   2       bld Oo1  5g                         IMAGE:5078396.5p                                                                                                                                                                                                       TAGTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGC
  5   1   2       bld Lmb1 5g3  in                    IMAGE:8533184.5p                                                                                                                                                                                                       GATAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAGATGACTTTTGATAGTGAAGTTGACTGATGAAGTGGCAGGAAATCACCGATGCAAGCTTGTCTACCATACACTGATGATCAAGCATCTGCGCTCATGTGAATTGTGCACCTAACAGCAGTGCTCTGAGCGCAAGACT
  5   1   2       bld Oo1  5g                         IMAGE:5077984.5p                                                                                                                                                                                                        GTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCTATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCC
  5   1   2       bld Egg3 5g                         IMAGE:6323432.5p                                                                                                                                                                                                        GGGCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGAGACATTGAGAAAAAGCACTTGCGATGAATTAAAGATCTCCCCCGAGTCGCTCCATTTTATGACGCAAAATGCAATGACAGAAAAGACGCTGAGAACACTCTCTCCATTCTTGGAGCCGGCTTTGATTGTGCCACCAACACTGAAATCCAATTACTACACAGCATTGCAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCACATCAAATATGCAACTAGCTGTGGTGTGGAAAAGATGACTTTTGATACTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAACAACGGATGACTCAAAAGCAGTCTGCCGCCCTCAGTGTGAAAATTTGGTGGCCCCCCTTAAAACAAGCCCGGGTTACTTTCCTGGAGGCGAACCAAAAGGAGCCTAAATGTTGGGATAATAAATTTGGNTGGGAAAGGTTTCCCCATGGTTGGGCCCAGTGGGGCCTGGCACCTTGGATCT
  5   1   2       bld Oo1  5g3  in                    IMAGE:3404809.5p                                                                                                                                                                                                         GTCAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGTATATCGTGGCGCCAAAAATAACGAAGCCGCCTTATCTGATGACAAAGATGCTCTTTAATGCTGCGATCTTGGTGACACTGCGAAAAAGCACTTGCGCTAGTTTTAAAGCTCCTCCCCGCGTCGCTCCA
  5   1   2       bld Ooc3 5g                         IMAGE:3437536.5p                                                                                                                                                                                                         TAGCTGTTAGGAGCTTTGTCAGAGGAAGTCttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGC
  5   1   2       bld Egg3 5g                IMAGE:3379218-IMAGp.IMAGp                                                                                                                                                                                                         AGGGGGGGCTTTTGGTAGAAGGGAAAGTCCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCCTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGCGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAGGGAGCTTAATGTGGATATAATTGGTGTGAGTTTCCATGTTGGCCAGTGG
  5   1   2       bld Ga15 5g                            XL463d19ex.5p                                                                                                                                                                                                         AGCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCA
  5   1   2       bld Te2  5g3  in                    IMAGE:7391132.5p                                                                                                                                                                                                         ATAGTTGTTAGGAGCTTTGTCCGAGGAAGTCTTTTTTTCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAGGAATCACCCGATGCAAAGCTGGTCTACGCTAGCACTGATGACT
  5   1   2       bld Emb1 5g                         IMAGE:6635161.5p                                                                                                                                                                                                          AGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGGCTCAGTGTGAAATTTTGNTGCCACCCCTTAAAAACAGGCAGGGCTGCCTTCTGGAAGCGGGGCAAAC
  5   1   2       bld Emb1 5g                         IMAGE:6864515.5p                                                                                                                                                                                                          AGTTGTTAGGAGCTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGGCCACCCTTTAAACAAGCAGGGCTGCCTTCTGGGAGCGGGGCAAAAAGGAGCCTTAAATGTGGGAATATTAATTTGGGTGGTGAAGC
  5   1   2       bld Ga15 5g                            XL418k01ex.5p                                                                                                                                                                                                          GCTGTTAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTT
  5   1   2       bld Tbd5 5g                         IMAGE:3581011.5p                                                                                                                                                                                                           CTGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAACTTTCTGGGAGAAAGGTTTTTCTGGCAGGGATTTTGTGGAGCAAAAGAACAATGAAGTGTCCTTAATTGAAGACAAAGATGCCTTTTATGTTGCTGATTTTTGCGACATTGTAAAAAAC
  5   1   2       chi Bla2                            IMAGE:7300538.5p                                                                                                                                                                                                           GGGCGATTGGGTCCGGGCCCCCCTCGAGttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGATCACCCGAATGCAAGCTTGTCTACGCTAGCACTGATGATCAAAGCATCTGCCGCTCATGTGAATTGGTGCCACCTNAACAGCAGCTGCTCTGAGCGGCAAGACTATGTGATTATGTGTGAGTCAGTGGCTGCTGCCGTCCAACTTGTCACG
  5   1   2       bld Egg3 5g3  in                    IMAGE:3378223.5p                                                                                                                                                                                                            AGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTNTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTNTATGCCGTANAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCTCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAGATATGCAGCTAGCTGTGGTGTGGNAAAGATGACTTTTGATAGTGAAGTTGAC
  5   1   2       bld Oo1  5g                         IMAGE:3403342.5p                                                                                                                                                                                                            AGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTG
  5   1   2       bld Oo1  5g3  in                    IMAGE:3403800.5p                                                                                                                                                                                                            TGTTAGGAGCTTTGTCAGAGGAAGTCtttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAACGATGCCTTTTATGTGGCTGATCTTGGCGACATTGTGAANAAGCATGTGCGTCGACTAAAAGCGCTGCCGCGCTGTCCTGCGTTT
  5   1   2       bld Oo1  5g3  in                    IMAGE:3403914.5p                                                                                                                                                                                                            AGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTG
  5   1   2       bld Oo1  5g3  in                    IMAGE:3403555.5p                                                                                                                                                                                                              CAGGGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTG
  5   1   2       bld Oo1  5g3  in                    IMAGE:3404168.5p                                                                                                                                                                                                              GGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTG
  5   1   2       bld Oo1  5g                         IMAGE:6640235.5p                                                                                                                                                                                                              GGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGGTGGAAAAGATGACTTTTTGGATAGTGAAGTTGAACTAATGANAGTGGCAAGGAATCACCCAAATGCNAAGCTTGTTCTGCGCATAGCAACTGATGACTCNAAAGCAGTCTGCCGCCTCAGTGGTGAAATTTGGTGCCACCCCTTAAACAAGCCGGCTACTTCTGGAGCGAGCAAAAGAGCTTATGTGGATATAAATTTGGTGTAAGTTTTCATGTTGGCAGTGGCTGCACTGATCCTCATACTTATGTGCAAGCTGGTTCAGATGG
  5   1   2       bld Oo1  5g                         IMAGE:6859259.5p                                                                                                                                                                                                              GGATAGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAGCCGGGCTACTTCTTGGAGCGAGCAAAAGAGCTTAATGTGGGATATAATTGGTGTAAAGTTTCCATGTTTGGCAGTGGGCTGCACCTGGATCCNTCAGACC
  5   1   2       bld Ga12 5g                              XL144c17.5p                                                                                                                                                                                                               GAGGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGT
  5   1   2       bld Ga18 5g3  in                      xlk143c17ex.5p                                                                                                                                                                                                               TTAGGAGNTNNNNCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGNAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTNCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGNTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGNAAGGAATCACCCGAATGCANNNNNNGTTCTACGCATANNAACTGATGACTCAAAAGCAGTCTNC
  5   1   2       bld DMZ  5g3  in                         xl305i03.5p                                                                                                                                                                                                                 GGAGCTTTGCCCGAGGAAGTCTCTTTTTTTCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGG
  5   1   2       bld Oo1  5g                         IMAGE:6641623.5p                                                                                                                                                                                                                  GCGATTTTGTCCGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGGCAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTTGAAATTTGGGTGCCAACCCTTTAAAAACAAGCAGGGCTGCTTTCTGGGAGCGGGGCAAAGGGAGCCTTAATGGTGGAATATTC
  5   1   2       bld DMZ  5g                              xl304h13.5p                                                                                                                                                                                                                  AGCTGCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTCTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAACAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCCGCTAGCTGTGGTG
  5   1   2       bld Neu7 5g3  in                         XL021p06.5p                                                                                                                                                                                                                     GCTGTCCGAGGNAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTA
  5   1   2       bld Tbd2 5g3  in                    IMAGE:3199926.5p                                                                                                                                                                                                                      GCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTNTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTG
  5   1   2       bld Oo1  5g                         IMAGE:6638122.5p                                                                                                                                                                                                                      GCTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCCCGGCTACTTTCTGGAGCGGAGCAAGAGAGCTTTAATGTGGGATATAAATTGGGTGTAGAGTTTTTCCATGTTTGGGC
  5   1   2       bld Oo1  5g                         IMAGE:6641175.5p                                                                                                                                                                                                                       CTGTCCGAGGAGGTCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAAGACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTTAAACAAGCCGGCTACTTCTGGAGCGAGCAAAAGAGCTTAATGTGGATATAATTGGGTGAAAGTTTCCATGTTGGGCAGTGGCTGCACTGATCCTCAGACTTATGGTGCAAGCTGGTTCAGAA
  5   1   2       bld Ov1  5g3  in                    IMAGE:5074298.5p                                                                                                                                                                                                                        GACCCACGCGTCCGCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGC
  5   1   2       bld Egg3 5g3  in                    IMAGE:3379178.5p                                                                                                                                                                                                                          GTCAGAGGAAGTCttttttttCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCCTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTNTATGCCGTACAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTAATTGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAAC
  5   1   2       bld Oo1  5g3  in                    IMAGE:3405290.5p                                                                                                                                                                                                                          CAGAGGAAGTCttttttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGTGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCCGTAAATGCAACGAT
  5   1   2       bld Egg3 5g                         IMAGE:6870565.5p                                                                                                                                                                                                                             GATTCCCCGGGTTTATTTTTCCGCTTCGTTATTTGTGGCCTCGATGGGTAGATACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCTCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCCACCCTTAAAACAAGCCGGGTAACTTCTGGAGCGAGCAAAAAGAGCTTAATGTGGGGATATAATTGGGTGTAAGTTTCCCATGTTTGGGCAGTGGGCTGCCCCTGAATCCCTCAAGACATTATG
  5   1   2       bld Emb1 5g                         IMAGE:6863028.5p                                                                                                                                                                                                                               GGACGCGTGGGTTTTTCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTANAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGANATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAAACTGATGAAGTGGGCAGGATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGGTGCCACCCTTTAAAACAAGCAAGGCTGCTTCTGGGAGCGGGCAAAAGGAACTTAAATGGTGGAATATAAATTGGNGGGGAAGTTTTCCCATGGTTTGGCAAGTGGGCT
  5   1   2       bld Egg4 5g3  in                    IMAGE:3744969.5p                                                                                                                                                                                                                                GGAATTCCTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAGTGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTTGTGCCCGGCTTTGATTGTGGCCCGTAGACTGAAATCCAATTAGTACAGAGTAATTGAGTTTCCCCTGAGCGGATTATCTATGCAAACCGATGTAAACCAGTTTCCCAGACAAATATGCAGCCTGCCTTTGGTGTGGAAAAAT
  5   1   2       bld Egg3 5g3  in                    IMAGE:3377985.5p                                                                                                                                                                                                                                 CCGGGTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTA
  5   1   2       bld Ga18 5g3  in                        xlk6e01ex.5p                                                                                                                                                                                                                                   GNGNCTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCANNNNNCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAANTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTNNNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAANNCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGNGGNAAGGAATCACCCAAATGCAAANNTTGTT
  5   1   2       bld Int2 5g                         IMAGE:8528051.5p                                                                                                                                                                                                                                    CTCttttttttCTCGCCTGATTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCCTAGCAACTGATGAA
  5   1   2       bld DMZ  5g3  in                         xl240c08.5p                                                                                                                                                                                                                                     CTTTTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTCTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAACAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCCGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAA
  5   1   2       bld Oo1       in                    IMAGE:3404473.5p                                                                                                                                                                                                                                        TTTATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAA
  5   1   2       bld Ga18      in                      xlk131d13ex.5p                                                                                                                                                                                                                                         tttttttttCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTNNNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGANTGTNCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGNNTATCTATGCNAANCCGTGNAANNNAGNTTCCCAGATCAAATANGCAGCTAGCTGTGGNGNNGNGANGANGACTTTTGATAGTGAAGTTNAATTGATGAANGNG
  5   1   2       bld Ga18 5g3  in                       xlk79j10ex.5p                                                                                                                                                                                                                                          TTTATTTTTCCGCCTGGTTATTTGTGGNCTCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGNGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACNGCTNCNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTNTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAANNCGTTGTGAAGACTCTCTCCATTCTTGGTNCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCNAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGNTGTGGNGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAANCACCCAAATGCAAANNTTNGTTCTGCNCATAGNNNCTGATGACTCAAAAGCAGTCTNNCGNCTCAGNGTGAAATTTGGTGCCACCCT
  5   1   2       bld Emb4 5g                         IMAGE:4679888.5p                                                                                                                                                                                                                                           ATTTTTCCGCCTGGTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTCTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAACAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGGTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCGCGAGCGGATTATCTATGCAAACCCATGT
  5   1   2       bld Egg5 5g3  in                    IMAGE:3431014.5p                                                                                                                                                                                                                                                TTCTCGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTAGCCCACCGAGCGGTTATCTATGCAAACCGCTGTAAACAAGTTTCCCCGATCAAATACGCAGCT
  5   1   2       bld DMZ  5g3  in                         xl312d07.5p                                                                                                                                                                                                                                                 CGCCNGGTTATTTGNGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCANAACAGCGCANAGNGGCTCCATTGANAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACNACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGNGGAGCAAAAGATCAATGAAGNGTCCTTATCTGACGACAAANATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGNGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAANACTCTCTCCATTCTTGGNGCCGGCTTTGACTGTGCCAGTAANACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGT
  3  -1   2       bld Gas3      in                      xlnga002o04.3p                                                                                                                                                                                                                                                  GCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCG
  5   1   2       bld Emb3      in                    IMAGE:3400109.5p                                                                                                                                                                                                                                                  CGCCTGGTTATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTTGTGCCGGCTTTTGACTGGCCAGTAAGACTGAAATCCAACTAGTACAG
  5   1   2       bld Oo1  5g                         IMAGE:6861264.5p                                                                                                                                                                                                                                                  GGCTGGACCGGTCCGGAATTCCTCCGATCAGATTTCGTAAATGCTTTTTAATAACACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTNAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAGGAGCTTAATGTGGATATAAATTGGTGTGAGTTTTCATGTTGGCAGTGGCTGCACTGATTCACAGACTTATGTACAAGCTGTCTCAAATGCACGATGTGTCTTTTGAATGGGGGGCTGAGCTTGGCTTTTACATGCATCTACCTTGATAATGGTGGGTGGTATTN
  5   1   2       bld Ov1  5g                         IMAGE:8331444.5p                                                                                                                                                                                                                                                        GTTATTTGTGGCCTCGATGGGTAGAGACTACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTCTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAACAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCCGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGGCAGGAATCACCCAAATGCAAGCTTGGTCTGCGCATAGCAACTGG
  5   1   2       bld Gas6      in                    IMAGE:3473180.5p                                                                                                                                                                                                                                                         TATTTGTGGCCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAAATATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTNTCCCAGATCAAATACGCAGCTTAGCTGTGGTGTGGAGAGATGACCTTTGATTATGAGTTGGAC
  5   1   2       bld Ga18 5g3  in                      xlk141l11ex.5p                                                                                                                                                                                                                                                          ATTTGTGGNCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAANNNTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGNGTGGAGAAGATGACTTTTNATAGTGAAGNTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAANNTTGTTCTACGCATANNAACTGATGACTCAAAAGCAGNCTNNCNNCTCAGTGTGAAATTTGG
  5   1   2       chi Egg3                            IMAGE:6322734.5p                                                                                                                                                                                                                                                              TCCCCGGGCGATGGGTAGAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCAGATCANATATGCAGCTAGCTGTGGTGTGGGAAAGATGACTTTTGATAGTGAAAGTGAACTANTGAAAATGGGCAGGAATCACCCCAATGCAAAAGCTTGTTCTGCGCATAGCAACTGATGAATCAAACAACTGCCCCCCCGGGGATTGCCCCTAAACGGTTTGGAAAAAATGGTATTGGGCTCGGGGGGGCCCATAGTCGGTGGGATGGAAAAnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnA
  5   1   2       bld Ga15 5g                            XL428j14ex.5p                                                                                                                                                                                                                                                                  CCTCGATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAGGAGCTTAATGTGGATATAATTGGNGTG
  5  -1   2       bld Gas3      in                      xlnga002o04.5p                                                                                                                                                                                                                                                                       ATGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTT
  5   1   2       bld Emb1 5g3  in                    IMAGE:3401308.5p                                                                                                                                                                                                                                                                        TGGGTACAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGA
  5   1   2       bld Ooc3 5g3  in                    IMAGE:3437336.5p                                                                                                                                                                                                                                                                              CAGATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAGATGAC
  5   1   2       bld Spl  5g                         IMAGE:8460286.5p                                                                                                                                                                                                                                                                               GAGACTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCTATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAGCAGTCTGCCGCTCAGTGTGAATTTNGTGCCCACCTNAAACAGCCGCTACTTCTGACGACAAAGAGCTATGTGATATATGTGTAGTTCATGTGCATGCTCCTATCTCGATAGG
  5   1   2       bld Oo1  5g                         IMAGE:6860051.5p                                                                                                                                                                                                                                                                                 ATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAGGAGCTTAATGTGGATATAAATTGGTGTGAGTTTCCCATGTTGGCAGTGGGCTGCACTGGATCCACAGAACTTATGTACAAAGCTGTCTCAGGATGCACCGATGTGGTTCTTTGAACATGGGNGGGG
  5   1   2       bld Ga15 5g                            XL445n03ex.5p                                                                                                                                                                                                                                                                                 ATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTCAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCAGGGCTGCTTCTGGAG
  5   1   2       bld Ga15 5g                            XL520e22ex.5p                                                                                                                                                                                                                                                                                 ATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTCCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTA
  5   1   2       bld DMZ  5g3  in                         xl267d06.5p                                                                                                                                                                                                                                                                                 ATTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGT
  5   1   2       bld Emb1 5g                         IMAGE:6636530.5p                                                                                                                                                                                                                                                                                    TACGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCCGGCTACTTCTGGAGCGAGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTTCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTGCAAGCTGTTTCAGATGCCAGGNTGTGTTTTTTGACATGGGGGCCCGAGCTTGT
  5   1   2       bld Oo1  5g                         IMAGE:5084675.5p                                                                                                                                                                                                                                                                                      GTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCAGCTCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCTATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGGAAATTTGGTGCCACCCTTANAACAAGCCGGCTACTTCTGGAGCGAGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAAGTTTCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTGCAAGCTGTTTCAGATGCCAGATGTGTTTTTTGACATGGGGGCCCGAGCTGGGATTTAN
  5   1   2       bld Ga18      in                      xlk128b05ex.5p                                                                                                                                                                                                                                                                                         AATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTNCNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGNTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTNCCCCGAGCGGATTATCTATGCAAANCCGTGTAAACNAGTTTCCCAGATCAAANACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTG
  5   1   2       bld Egg3 5g                         IMAGE:3379144.5p                                                                                                                                                                                                                                                                                            AAGGAAGTACGTGCCAAGGGGTGGGCANAAGAGAGTGGCTCCATNCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTGTATGCCGTACAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTATGACTGTGCCAGTGAGACTGAGATGCAACTAGTACAGAGTATTGGAGTTTCCTCCGAGCGGATTATCTATGCGAACCCCGTGTAACAAGGTTGCCAGATGCAATACGCAGCTATCTGTGGTGTGGAGAAGATG
  5   1   2       bld Emb1 5g                         IMAGE:6632052.5p                                                                                                                                                                                                                                                                                                             ACAGCAGAACAGCGCAGAGTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAGGAGCTTAATGTGGATATAATTGGTGTGAGTTTCCATGTTGGCAGGGGCTGCACTGATCCACAGACTTTATGTACAGCTGTCTCAGATGCACGATGTGTCTTTGAACATGGNNGGCCTGAGCTTGGCTTTTACATGCATCTACTTGGAAATTTGGTGGGGG
  5   1   2       bld Oo1  5g                         IMAGE:6640568.5p                                                                                                                                                                                                                                                                                                                AGCAGAACAGCGCAGAGCAGCTCCATCAAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACCGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAGCCGGCTACTTCTGGAGCGAGCAAAAGAGTTTAATGTGGATATAATGGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTGCAAGCTGGTTCAGATGCCAGGTGTGTTTTTTGACATGGGGGGCCGAGCTTGGATTTAACATGGATCTTCCTTGAAATTGGTGGCGGGATTTCCCGGTTCAAAAGATGTGGGAACTGGAAGTTGGAGGAAGATAACTT
  5   1   2       chi Thy                             IMAGE:8546941.5p                                                                                                                                                                                                                                                                                                                          GCAGAGTGGCTCCATCGAGAGCGTAGGACCCCTCTATGACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTCGGTAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCTAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCCAGTGTGAAATTTGTGCACCTTATACAACAGGCTGTTCTGGACGGGCAAAGACTTATGTGAATTATTGTGGAGTTCAGTTGCATGGTGCCTGTCAAGATTAGTCAACGTCCAAGCACATGCTTGACTGGGTGACTGGCTAAAGATACTGAATGGGAGTCCCGGTAAGAGGAATATTAAATCTTTGAACCACCGTAT
  5   1   2       bld DMZ  5g                              xl229i24.5p                                                                                                                                                                                                                                                                                                                             GAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTT
  5   1   2       bld DMZ  5g                              xl249d06.5p                                                                                                                                                                                                                                                                                                                              AGTGGCTCCTTCGAGAGCGTANGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATNGTTATCCCCATCTCTNACTTGTCCNTTTTTTTGCATAAGTTGCATTTTGAAACCGAACAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCA
  5   1   2       bld Ooc1 5x3  out                     xlnoc001m04.5p                                                                                                                                                                                                                                                                                                                                     TCCATCGAGAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGA
  5   1   2       bld DMZ                                  xl318a03.5p                                                                                                                                                                                                                                                                                                                                            GAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAANTATCCCCATCTCTTANTTGTCCATTTTTTTGCATAAGTTGCATTTTGANACCGAATAATTGCA
  5   1   2       bld Gas9 5g                              BG409538.5p                                                                                                                                                                                                                                                                                                                                             GAGCGTCGGACTTGTCCTCTACTTACCAGGCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTGAAACTGAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGGTATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCCGGCTACTTTTGGG
  5   1   2       bld DMZ  5g3  in                         xl221l03.5p                                                                                                                                                                                                                                                                                                                                                      CTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGNAAAATGCAACNATGGCNAANCCATTGNGAANACNCTCTCCATTCNTGNNGCCGGCT
  5   1   2       bld Emb4 5g                IMAGE:5570758-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                               TAATTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCTAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGT
  5   1   2       bld Ga18 5g3  in                       xlk65f21ex.5p                                                                                                                                                                                                                                                                                                                                                                            GCTTGTATTTCACTGGCAAGCCTCCTTGGGAGTNANNTNAAGCTTTCACTATAGCCCCCCATCTCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTNCNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAANNCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGNAAGGAATCACCCAAATGCAAAGNTTGTTCTGCGCATNNNNCTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCCGGGTACTNNTGGAGCGAGCAAAAGAGCNTAATGTGGATATAATTGGTGTAAGNTNCCATGTTGGCAGTGNNTNNNCTGATCCNCAGACTT
  5   1   2       bld Tail 5g                         IMAGE:8545557.5p                                                                                                                                                                                                                                                                                                                                                                                CCACTATGNGNNGNGAGTACTACATATATTCGTCCCCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAGGAGCTTAATGTGGATATAATTGGTGTGAGTTTCCATGTTGGCAGTGGCTGCACTGATCCACAGACTTATGTACAAGCTGTC
  5   1   2       bld Ga18      in                       xlk54n14ex.5p                                                                                                                                                                                                                                                                                                                                                                                          GCGAGCCTCCTTGGGNGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCNNNNTGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAATGATGGCANANNNNTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGNTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAANNTTGTTCTACGCATAGNAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAANTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAGGNAGCTTAATGTGGANNTAATTGGNGTGAGTTTCCATGTTGGCAGNGGNTGCACTGATCCACAGACTTNTGTACNAGCTGTCTCNGNNCACGATGNGTCTTTNGANNNGGGGGCTGA
  5   1   2       bld Ga12 5g   ?                          XL175g22.5p                                                                                                                                                                                                                                                                                                                                                                                               GCTCCTTGGGAGTGAGACTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAACTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAG
  5   1   2       bld Bla1 5g                         IMAGE:3381382.5p                                                                                                                                                                                                                                                                                                                                                                                                        CCGGGGAGACTGAAGCTTTCTTTATAGTTATTTTCATCTCTTACTTGTCCATTATTTTGCATAAGTTGCATTTTGAAACCGAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATCGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGTCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTCTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACATATAAGCAGTCTGCCGCCTCAGTGTGACATATTGTGTCCACCTTAAAACTAGCAGGCTGCTTCTGGAGCTGGCAACGGAGCTTAATGTTGATATAATAGGTGTGAGTATTCATGTTGGCTGTAGCTTCACTGATCTACAG
  5   1   2       bld DMZ  5g                              xl262c05.5p                                                                                                                                                                                                                                                                                                                                                                                                              CTGAAGCTTTCTTTATAGTTATCCCCATCTCTTACTTGTCCATTTTTTTGCATAAGTTGCATTTTGAAACCGAATAATTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTCTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGACGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTGCGTTGGTTTAAAGCGCTCCCCCGTGTCACTCCGTTTTATGCCGTAAAATGCAACGATGGCAAAGCCATTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCGTGTAAACAAGTTTCCCAGATCAAATACGCAGCTAGCTGTGGTGTGGAGAAGATGACTTTTGATAGTGAAGTTGAATTGATGAAAGTGGCAAGGAATCACCCGAATGCAAAGCTTGTTCTACGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAGGAGCTTAATGTGGATATAATTGGGTGTGAGTTTCCATGTTGGCAGTGGCTGCACTGATCCACAGACTTATGTACAAGCTGTCTC
  5   1   2       bld Te2  5g                         IMAGE:7211553.5p                                                                                                                                                                                                                                                                                                                                                                                                                     TACCCGGGAATTNNCCCGGGATCTTACTTGTCCATTTTGTTGCATAAAGTCGCATTTTGAAACCGAATAACTGCAAATATGAACGGCTTCAGCAATGACGACTTTGACTTCAGCTTCCTGGAGGAAGGCTTCTGTGCCCGGGATATCGTGGAGCAAAAAATCAATGAAGTGTCCTTATCTGATGACAAAGATGCTTTTTATGTTGCCGATCTTGGTGACATTGTGAAAAAGCACTTGCGTTGGTTTAAAGCTCTCCCCCGTGTCGCTCCATTTTATGCCGTAAAATGCAATGACAGCAAAGCCGTTGTGAAGACTCTCTCCATTCTTGGTGCCGGCTTTGATTGTGCCAGTAAGACTGAAATCCAATTAGTACAGAGTATTGGAGTTTCCCCCGAGCGGATTATCTATGCAAACCCATGTAAACAAGTTTCCCAGATCAAATATGCAGCTAGCTGTGGTGTGGAAAAGATGACTTTTGATAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCAGTCTGCCGCCTCAGTGTGAAATTTGGTGCCACCCTTAAAACAAGCCGGCTACTTCTGGAGCGAGCAAAAGAGCTTAATGTGGATATAANTTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTGCA