Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 26 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:3748141.5                      10 END     4           0       40                ubiquitin C [Gallus gallus]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL501h21ex.3.5                      373 PI      85        438     1120                (no blast hit)
     3   0.0    0Xl3.1-XL404p23ex.5.5                      215 PI      89       1122     2127                (no blast hit)
     4   0.0    0Xl3.1-xl287e20.5                          132 PI      83       1122     1325                (no blast hit)
     5   0.0    0Xl3.1-IMAGE:4203101.5.5                   128 PI      83        438     1348                (no blast hit)
     6   0.0    0Xl3.1-xl282o20.5                           98 PI      84       1122     1325                (no blast hit)
     7   0.0    0Xl3.1-IMAGE:6874584.5                      48 PI      83       1805     2021                (no blast hit)
     8   0.0    0Xl3.1-IMAGE:4970901.5                      41 PI      83        437      641                (no blast hit)
     9   0.0    0Xl3.1-IMAGE:4743107.5                      14 PI      83        666     1348                (no blast hit)
    10   0.0    0Xl3.1-IMAGE:7392120.5                      12 PI      88        409     1462                (no blast hit)
    11   0.0    0Xl3.1-IMAGE:3748141.5                      10 PI      99        150      869                ubiquitin C [Gallus gallus]
    12   0.0    0Xl3.1-xlk81i15ex.5                         10 PI      84        918     1654                ubiquitin C [Gallus gallus]
    13   0.0    0Xl3.1-xl256d09.5                            4 PI      88       1076     1807                CG11624-PC, isoform C [Drosophila melanogaster]
    14   0.0    0Xl3.1-IMAGE:7210724.5                       4 PI      85        468     1383                (no blast hit)
    15   0.0    0Xl3.1-XL198f16.5                            2 PI      85       1122     1348                ubiquitin B precursor; polyubiquitin B [Homo sapiens]

 This cluster: approximate FL confidence score = 95%

 1012837218 Xl3.1-XL445h08ex.5.5 - 435 ESTs
                                                                       ....-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xl3.1-XL445h08ex.5.5                                                                                                                                                                     TAGCGAAATTTATTTTGGGACATCTTTGTGATACTGTTGGGCGGTTTCACGCGCATTAAAAAGTCCCTGTTAACGGACACCTCGGAAGGATACACCAACGACACAAATAAAGCCCGCGCCCTTTGTTCTGGTGGCGCAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTTGCACTTTGTTTCAATAAAGCTATTGCATTCCAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012723238                                                                                                                                                                           AATTTATTTTGGGACATCTTTGTGATACTGTTGGGCGGTTTCACGCGCATTAAAAAGTCCCTGTTAACGGACACCTCGGAAGGATACACCAACGACACAAATAAAGCCCGCGCCCTTTGTTCTGGTGGCGCAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTTGCACTTTGTTTCAATAAAGCTATTGCATTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAACTC
                                                      consensus depths                                                                                                                                                                          5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     6     7    12    10    17    33    47    56    71   105   114   136   143   138   143   139   145   142   145   142   145   142   145   143   146   143   147   144   146   143   146   144   147   144   148   145   148   148   151   148   151   149   152   148   153   151   154   153   155   153   156   153   156   153   156   156   158   156   159   157   161   158   160   158   161   159   161   161   162   161   163   160   163   160   164   165   167   162   166   163   165   164   165   159   163   162   165   159   162   155   164   152   164   159   165   149   164   151   165   148   163   148   163   143   162   127   154   124   153   127   154   119   149   127   149   108   144   105   141    98   141    90   136    77   130    83   127    69   120    69   114    61   102    58    98    50    99    47    92    39    85    39    75    38    72    38    67    34    60    33    57    31    55    29    51    34    50    33    44    31    41    31    41    30    39    30    41    30    45    34    48    30    49    34    49    36    50    37    55    38    59    38    63    36    67    37    75    35    81    37    90    40    92    44    98    48   104    59   112    53   120    70   131    76   134    83   141    84   144    79   146    98   153    93   154   119   156   101   158   129   164   134   168   143   173   160   177   157   178   145   175   163   181   161   183   165   184   158   186   172   193   171   193   178   195   172   197   173   197   188   201   184   200   190   209   197   217   196   218   199   223   202   220   205   226   209   228   202   225   216   226   216   225   221   226   218   228   221   232   217   233   223   233   227   238   227   237   227   237   223   234   222   233   223   233   220   233   221   230   219   231   217   230   216   230   215   226   214   226   217   226   216   226   218   224   215   223   216   223   208   219   165   197   153   191    97   142    61   102    58    81    40    59    14    20     3     7
  5   1   2       e>1                            Xl3.1-IMAGE:4030701.5 AAACGTTTCAGTATCACGGTCCGGCTTGACGCCCCTTCCCGCCCCTCTATTTTGTATGCAGTCCTAGTTCGTACGCCAAAGTCAACACTTTCATATAAATATCTGCTTGTGAGCAAGTACGTTCTTATGTCAGTTGTACAGTTTAATTCAGGTACAAACGAACATAGCGAAATTTATTTTGGGACATCTTTGTGATACTGTTGGGCGGTTTCACGCGCATTAAAAAGTCCCTGTTAACGGACACCTCGGAAGGATACACCAACGACACAAATAAAGCCCGCGCCCTTTGTTCTGGTGGCGCAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAAGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGAACCTGACAGGGAAGACATTACTCTTGAAGTTGAAGCAAGTGACACTATTGAGGATGTAAAGGCCAAAATCCCAAGACAGGGAGGCATTGTTCCTCCCCCCCAGAGATTGATA
  5   1   2       e>1                            Xl3.1-IMAGE:4408311.5                                                                                                                                                                                                                                                         CAGTCGACGGTACCGGACATATGCCCGGGAATTCGGCCATTACGGCCGGGGGCAGTTGCACTTTGGTAGCTGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCATAAAGAGTCCACCTTGCACTTAGTTCTTCATCTCTGAGGTGGGATGCTAATATTTGTGAATACCCTGACAGGGAAGACAATACTCACGAGATTATCCATTGTCACTTTGTGATGTATATGCATATCTAGACATAAGGCTTCCTCTGATCTAGAGATGAATAGCTGGTTCCTTGAAAGAGATAAACCTTTAATAATATTCATGAAATTCTGTCTTGCCATCATTAAATCTAGCAATCTCTAGTTCTGGATCATCC
  5   1   2       e>1                               Xl3.1-XL432l14ex.5                                                                                                                                                                                                                                                                                           CCCTTTGTTCTGGTGGCGCAGTTGCCCTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGG
  5   1   2       e50                            Xl3.1-IMAGE:3517001.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTC
  5   1   2       e50                            Xl3.1-IMAGE:8639389.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGCGTCTGAGAGGT
  5   1   2       dbl                               Xl3.1-XL445h08ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTTGCACTTTGTTTCAATAAAGCTATTGCATTCCAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       dbl                            Xl3.1-IMAGE:8550565.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTATGAGCTATTGATGGCAGCATTGGATCAGTAATCAGTAGAGATTCTCTGACACAGATGTCTGCAGCAGCACTGAGATGCGCATTTTTGATACATATCAGAAGATCACTTGCATTGTCTTCGTTCAGAGTGGATGCAATATTGTCAGACTTAACTGTAAAACAATACTCTTGAAGTGAACCAAGTGACACAATGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTGCTTGTGCACTTGTCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTGCACTTGTC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                             ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -A--A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----C-----A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----C-----T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -T----------
                                               BLH ATG     209     841                                                                                                                                                                     
                                               BLH MIN     194     389                                                                                                                                                                     
                                               BLH OVR     209      50                                                                                                                                                                     
                                               EST CLI     158      57                                                                                                                                                                     
                                               ORF LNG     209      11                                                                                                                                                                     
  5   1   2       e>1                            Xl3.1-IMAGE:4030701.5 AAACGTTTCAGTATCACGGTCCGGCTTGACGCCCCTTCCCGCCCCTCTATTTTGTATGCAGTCCTAGTTCGTACGCCAAAGTCAACACTTTCATATAAATATCTGCTTGTGAGCAAGTACGTTCTTATGTCAGTTGTACAGTTTAATTCAGGTACAAACGAACATAGCGAAATTTATTTTGGGACATCTTTGTGATACTGTTGGGCGGTTTCACGCGCATTAAAAAGTCCCTGTTAACGGACACCTCGGAAGGATACACCAACGACACAAATAAAGCCCGCGCCCTTTGTTCTGGTGGCGCAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAAGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGAACCTGACAGGGAAGACATTACTCTTGAAGTTGAAGCAAGTGACACTATTGAGGATGTAAAGGCCAAAATCCCAAGACAGGGAGGCATTGTTCCTCCCCCCCAGAGATTGATA
                                                  Xl3.1-CHK-1012711517       TTCAGTATCACGGTCCGGCTTGACGCCCCTTCCCGCCCCTCTATTTTGTATGCAGTCCTAGTTCGTACGCCAAAGTCAACACTTTCATATAAATATCTGCTTGTGAGCAAGTACGTTCTTATGTCAGTTGTACAGTTTAATTCAGGTACAAACGAACATAGCGAAATTTATTTTGGGACATCTTTGTGATACTGTTGGGCGGTTTCACGCGCATTAAAAAGTCCCTGTTAACGGACACCTCGGAAGGATACACCAACGACACAAATAAAGCCCGCGCCCTTTGTTCTGGTGGCGCAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAAGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGAACCTGACAGGGAAGACATTACTCTTGAAGTTGAAGCAAGTGACACTATTGAGGATGTAAAGGCCAAAATCCCAAGACAGGGAGGCATTxxxCCTCCCCCCCxxxxxTTGATATTTGCT
  5   1   2       bld Emb1                            IMAGE:6862949.5p AAACGTTTCAGTATCACGGTCCGGCTTGACGCCCCTTCCCGCCCCTCTATTTTGTATGCAGTCCTAGTTCGTACGCCAAAGTCAACACTTTCATATAAATATCTGCTTGTGAGCAAGTACGTTCTTATGTCAGTTGTACAGTTTAATTCAGGTACAAACGAACATAGCGAAATTTATTTTGGGACATCTTTGTGATACTGTTGGGCGGGTTCACGCGCATTAAAAGTCCCTGTAAACGGACACTCGGAAGGATACACCNACGACACAAATAAAGCCCGCGCCCTTTTGTTCTGGTGCGCACATTGCACTTTGGTACCCGTGGTGGTCCAAGGGTAACTGATTTGAATCCCGGGCAAGGAACCCGCTTGTGTAACCAAAAATGGGAGAAAATTTTTGGGGAAAAACTCCCCCCTGGGGAAAAAACCATCCCCACCTTTGAAGTTTTGAGCCCACAGGTGGACAAAATTTGGAAAAATGGGGAAAACCTTCAAAAACCCCCaaaaaaaaaaaaaggggggtttttcccccctggggaaacaaaaaaaaaGGGGTGTGGTTTTTTTTTCTCCGGGGGGGAAAAAACAGTTgggggggggggggaggggggAGACAACCCCCCCGGTGGAGAAATAATTTAACAACCTTTTTCAAAAAAGAGGAAAGAccccccccctcgccccgccgggtgggggttcccccccccctttttaaaaaaaggggggggggAGGGACCAACCAAAATTATTATTTTTTTGAGGAAGCACCACCCCCGCGGCGGGGGGGAGGaaaaaaaaaaaaatttccttcttgtgtggggggggggggggggccccccacaccggaggacacacctttttttttataaaaagaaataaaaggagggggggaaaaaaaaatatctctcttcccaaacaaaaaaaaaggaggggggttggtgttcctccccccccccaccagaaaaaaaaaN
  5   1   2      seed Kid  5g                         IMAGE:4030701.5p                                                         TGCAGTCCTAGTTCGTACGCCAAAGTCAACACTTTCATATAAATATCTGCTTGTGAGCAAGTACGTTCTTATGTCAGTTGTACAGTTTAATTCAGGTACAAACGAACATAGCGAAATTTATTTTGGGACATCTTTGTGATACTGTTGGGCGGTTTCACGCGCATTAAAAAGTCCCTGTTAACGGACACCTCGGAAGGATACACCAACGACACAAATAAAGCCCGCGCCCTTTGTTCTGGTGGCGCAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAAGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGAACCTGACAGGGAAGACATTACTCTTGAAGTTGAAGCAAGTGACACTATTGAGGATGTAAAGGCCAAAATCCCAAGACAGGGAGGCATTCCCCCTNATCAACAGAGATTGATATTTGCTTGC
  5   1   1       add Ga15 5g3  in                       XL496h15ex.5p                                                                                                                                             TTTAATTCAGGTACAAACGAACATAGCCGAAATTTATTTTGGGACATCTTTGTGATACTGTTGGGCGGTTTCACGCGCATTAAAAAGTCCCTGTTAACGGACACCTCGGAAGGATACACCAACGACACAAATAAAGCCCGCGCCCTTTGTTCTGGTGGCGCAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGNAAAGAGTCCACCCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCCTGACAGGGGAAAGACCATTACCTCTTGAAGTNGAAGCCCAANTGAACACTTATTGA
  5   1   2       e>1                            Xl3.1-IMAGE:4408311.5                                                                                                                                                                                                                                                         CAGTCGACGGTACCGGACATATGCCCGGGAATTCGGCCATTACGGCCGGGGGCAGTTGCACTTTGGTAGCTGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCATAAAGAGTCCACCTTGCACTTAGTTCTTCATCTCTGAGGTGGGATGCTAATATTTGTGAATACCCTGACAGGGAAGACAATACTCACGAGATTATCCATTGTCACTTTGTGATGTATATGCATATCTAGACATAAGGCTTCCTCTGATCTAGAGATGAATAGCTGGTTCCTTGAAAGAGATAAACCTTTAATAATATTCATGAAATTCTGTCTTGCCATCATTAAATCTAGCAATCTCTAGTTCTGGATCATCC
                                                  Xl3.1-CHK-1012706543                                                                                                                                                                                                                                                               ACGGTACCGGACATATGCCCGGGAATTCGGCCATTACGGCCGGGGGCAGTTGCACTTTGGTAGCTGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCATCTCTGAGGTGGGATGCTAATATTTGTGAATACCCTGACAGGGAAGACAATACTCACGAGATTATCCATTGTCACTTTGTGATGTATATGCATATCTAGACATAAGGCTTCCTCTGATCTAGAGATGAATAGCTGGTTCCTTGAAAGAGATAAACCTTTAATAATATTCATGAAATTCTGTCTTGCCATCATTAAATCTAGCAATCTCTAGTTCTGGATCATCCTTATAT
  5   1   2      seed Tad2 5g3  out                   IMAGE:6872733.5p                                                                                                                                                                                                                                                                                                             CAGTTGCACTTTGGTAGCTGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCAAGTGACACTATGAGATGTAAGCAATCAACAGAGCTCCTGACAATATTGATGAGACTATATAGACTTCTTAGTTTTN
  5   1   1       add Tad2 5g                         IMAGE:6873280.5p                                                                                                                                                                                                                                                                                                             CAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTTACACATTCAGAAAGAGTCCACCTTGCACCTTATTCCTTCGTCTCAGAGGTGGGGATGCAAATATTTTGTGAAGAACCCTGACCGGGAAAAGACAATAACTCCTTGAAAGTTGAACCCAGGTGACACTAATGGAGGAATGGTTAAGGGCCAAAATCCCAAGAAAAGGGGAAGGGCTTTCCCCCCCGTATTCCACCAAAAAATTGGTATTTTTGCTGGTGcaaaacaatttggaaaaaaagtggaaaaaacccccttgccaaaaattaaaaaaT
  5   1   2       chi Thy                             IMAGE:8549655.5p                                                                                                                                                                                                                                                                                                                 GTCCCTTTGGTAGCTGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCATCTGGAATATGGCAAAACCCTGTCAGACTACAACATTCATAAAGAGTCCACCTTGCACTTAGTTCTTCATCTCTGAGGTGGGATGCTAATATTTGTGAATACCCTGACAGGGAAGACAATACTCACGAGATTATCCATTGTCACTTTGTGATGTATATGCATATCTAGACATAAGGCTTCCTCTGATCTAGAGATGAATAGCTGGTTCCTTGAAAGAGATAAACCTTTAATAATATTCATGAAATTCTGTCTTGCCATCATTAAATCTAGCAATCTCTAGTTCTGGATCATCCTTATATAAATTTATTATTTTACGGCTGATTATTTATG
  5   1   2       bld He1  5g3  in                    IMAGE:4408311.5p                                                                                                                                                                                                                                                                                                                       TTGGTAGCTGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGAAAGACATTCCTCTTG
  5   1   2       e>1                               Xl3.1-XL432l14ex.5                                                                                                                                                                                                                                                                                           CCCTTTGTTCTGGTGGCGCAGTTGCCCTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGG
                                                  Xl3.1-CHK-1012685282                                                                                                                                                                                                                                                                                                 GTTCTGGTGGCGCAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGTAAAAC
  5   1   2       bld DMZ  5g3  in                         xl259c13.5p                                                                                                                                                                   CATAGCGAAATTTATTTTGGGACATCTTTGTGATACTGTTGGGCGGTTTCACGCGCATTAAAAAGTCCCTGTTAACGGACACCTCGGAAGGATACACCAACGACACAAATAAAGCCCGCGCCCTTTGTTCTGGTGGCGCAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAGACAAGGAAGGCATNCCCC
  5   1   2       bld DMZ  5g3  in                         xl256o17.5p                                                                                                                                                                   CATAGCGAAATTTATTTTGGGACATCTTTGTGATACTGTTGGGCGGTTTCACGCGCATTAAAAAGTCCCTGTTAACGGACACCTCGGAAGGATACACCAACGACACAAATAAAGCCCGCGCCCTTTGTTCTGGTGGCGCAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGANGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCNAGTG
  5   1   2       bld Int2 5g                         IMAGE:8821923.5p                                                                                                                                                                                                                                                                            AGTTATGTTAAACACGAGCCAAAACAAAATAAATTCGTCCCCTTTGGTAGCGGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGAAATCTACTCTGCACTTGGTCCTTCGTCTTCAGAGTGGCATGCAGATATTTGTCAGACCTTAACTGGAAGATCATTACCCTTGAAGTTGACAGTGACCATGAAATGTAAAAGCAAATTCAGGACAGGACGCATCCTCCTGATCAGGAGATGGATTTGCCTGTAGCAACTTGAAAATGCGGCACCTCTTTCTTGACTACCA
  5   1   0       chi Brn1      in                    IMAGE:6956515.5p                                                                                                                                                                                                                                                                             TTTTAAAAAAACGGCTGGGTTCCGGTCCGGAAATTTCCGGATCTTGGNTNCCCNNNGGNTTTTTGGACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGGAAGACCATTTACCCCTTTGAAGTTGAACCAGTTGACACCAATTGGAAAATGTAAAAAGCCAAAAATCCCAGAACCAAGAAAGGCATTTCCTTCTGAATCCGCCANAAGATTTGATT
  5   1   2       bld Spl  5g3  out                   IMAGE:8463842.5p                                                                                                                                                                                                                                                                                  AAAATTGCTNAATATCCCTTCCNNNGCGGATCCATAAATTNNATTCGNCCCGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCCAACAATTGGAAGATGGAAGAACCCTGTCAA
  5   1   2       bld Ov1  5g3  in                    IMAGE:5074397.5p                                                                                                                                                                                                                                                                                    tcgacccacgcgtccgcccacgcgtccgcccacgcgtccgcccacgcgtccgcgAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCATCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCC
  5   1   2       bld Int2 5g                         IMAGE:8529982.5p                                                                                                                                                                                                                                                                                     TCACTGGGAAGACCATCACACTTGAAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACAGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAGGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCCCAAATCCAAGACAAGGAAGGCATTCCCCCTGATCACAGAGATTGAATTTGCTGGCNAACATTGGAGATGGAAGAACCTGTCGACTATATATCAGAAGATCTCTCTGCACTGTCCTCGTCTCAAGTGCTGCGATATGTCAGACCTACTGGAGACATACCTGAGTGACAGTGCCATGAATGTAACAATCAGACAGAGCTCTCGTA
  5   1   2       bld Te2  5g3  in                    IMAGE:7390105.5p                                                                                                                                                                                                                                                                                          GCCCTTTGTTCTGGTGGCGCAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCCTGATCACAGAGATTGATATTTGCTGGCAAAACATTGGAAGATGGAAGAACCCTGTCAGACTATAATATT
  5   1   2       bld Em10 5g                         IMAGE:7982813.5p                                                                                                                                                                                                                                                                                          GCCCTTTGTTCTGGTGGCGCAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGGGCAACATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGATCTACTCTGCA
  5   1   2       bld Em10 5g                         IMAGE:7982812.5p                                                                                                                                                                                                                                                                                          GCCCTTTGTTCTGGTGGCGCAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAATCCAAGACAAGGAATGCATTCCCCCTGATCCAACAGAGATTGATATTTGCGGCAAACAATTGGAAGAGGAAGAACCTGTCAAATATAATATCCGAGGAATCTACTTGCACTGGTCCTCCTCCTAAAGTGCATGGAA
  5   1   2       bld Int2 5g                         IMAGE:8824541.5p                                                                                                                                                                                                                                                                                              CCGCCCCTGGCTATCACCCGGATCCCACCCCATACAAATTCGTCCCGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGACCCTGTCAGACTATAATATTCAGATGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAGACCATTACCCTTGAGTTGACCAGTGACACAATTGAAAATGTAAAGCAAAATCCAAGAACAAGGAAGCATTCCT
  5   1   2       bld Ov1  5g3  out                   IMAGE:5047483.5p                                                                                                                                                                                                                                                                                               GACGCGTGGTTGGACGCGTGGGCTTTGGTAGCCGTGTGGTTCGAGGTAACAGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAGGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCTGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAAGACATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCCAAA
  5   1   2       chi Te1                             IMAGE:6930498.5p                                                                                                                                                                                                                                                                                                         GGGGCAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACATTACTCTTGAGTTGACCAAGTGACACTATTGAGAATGTAAGCCAAATCAAGACAAGATAGCTTCCCCTGATACAAATGAATTGTGAACATGAAGAGACTGCATAATCAACACCTGCCCAGGGATGATGACCTAGAAAAAACCATGACGAAAAN
  5   1   2       bld Te1  5g                         IMAGE:6930764.5p                                                                                                                                                                                                                                                                                                         GGGGCAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGGAAGGCATTCCCCCCTGATCAACAGAGATTGATATT
  5   1   2       bld Tad2 5g                         IMAGE:6931137.5p                                                                                                                                                                                                                                                                                                         GGGGCAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGGAAGACCATTACTCTTGAAGTTGAGCCCAAGTGACCCTATTGAAGAATGTAAAAGGCCAAAAATCCAAGAACAAGAAAGGCCATTCCCCCCTCGATCAACCAGAACATTTGATATTTTGCTGGGGCAAACCAATTTCGGAAGAATTGGAACAGAACCCCTGGTCAGAACTTATTTATATTTCCGGCAAGGGAAATCCTAACTCCTGGCACCCTTGGGTCCCTTTCGTTCCTTCAGAAAGGGGGGA
  5   1   2       add Te1  5g                         IMAGE:6929500.5p                                                                                                                                                                                                                                                                                                           GGGAGTTGCACTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAAGACATTACTCTTGAAGTTGAACCAAGTGACACTATTTGAGAAATGTAAGGGCCAAAAATCCAAGAACAAAGGAAAGGCATTCTCCCCCTGAATTAACAGAAAATTGGATATTTTGGCCGGGCAAAACAAATTTGAAAAAATGGAAAGAAACCCCGGTTCGGAAACTTTAAATATTTCCGGAAAGGAAAATCTTACTTCTTGCCACTTTGGT
  5   1   2       bld Spl  5g3  out                   IMAGE:8463661.5p                                                                                                                                                                                                                                                                                                           GACCAACGATAGAATTCGTCCCTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCT
  5   1   2       bld Tail 5g                         IMAGE:8545939.5p                                                                                                                                                                                                                                                                                                           GANGAGTACTCAAAAATAATCGTCCCGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCNTGTCAGACTATATATTCAGAAGGATCTACTCTGCACTTGGTCCTCGTCTCAGAGTGGCTGCAGATATTGTCAGACCTTACTGGGAAGACATACCNNTGAGTGACAGTGACCATTGAATGTAAGCAAATCCAGACAGGGCATCTCTGTCGCGAATGATTTGCGTA
  5   1   2       add Egg4      in                    IMAGE:3743512.5p                                                                                                                                                                                                                                                                                                             GGAATTCCCTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGGCTCAGAGGTGGGATGCANATATTTGTGAAGACTCTGACAGGGAAGACAATTACTTCTGGAGTTGAGCACAGTGACACTATGGATGAATGTAAGGCCCATGATCAGGAACAAGAATGCATTCCGCCTGATCGACAGAGA
  5   1   2       bld Egg4      in                    IMAGE:3743536.5p                                                                                                                                                                                                                                                                                                             GGAATTCCCTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTNTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAGAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAAGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCGAGATCCAAGACAAGGAAGCATTCGCCCCTGATCACAGA
  5   1   2       bld Sp1  5g3  in                    IMAGE:4968650.5p                                                                                                                                                                                                                                                                                                             TATCGTCGACCCACGCGTCCGGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGA
  5   1   2       bld Ga15 5g3  in                       XL452f16ex.5p                                                                                                                                                                                                                                                                                                                CTCCGCTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCCTTCGTCTCANAGGTGGCATGCAGATATTTGTCNAGACCCTTAACTGGGGAAGANCCATTACCCCTTGAAAGTTGAANCCAAGTGACACCANTTGAAAAATGTAAAAAGCCAAAA
  5   1   2       bld Ga15 5g3  in                       XL475i04ex.5p                                                                                                                                                                                                                                                                                                                CTCCGCTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGGAAGTTGAACNNGTGACACCAATTGGAAATGTaaaaagcaaaaaaTCCAAGAACAAAG
  5   1   2       bld Emb4 5g                         IMAGE:4930093.5p                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGCCCACGCGTCCGCGAGGTAACAGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAGGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGGTCCTTCGTCTCAGAGGTGGCATGCAGAATATTTGTCAAGACCTTTAACTGTGGAAGACCCATTACCCCTTTGAAGTTTGAACCAAGTGGACCACAATTGaaaaatgtaaaaagccaaaaaTCCCAAGAACAAAGGAAAGGCTT
  5   1   2       bld Emb4 5g                         IMAGE:5572293.5p                                                                                                                                                                                                                                                                                                                  TCTCGGATATCGTCGACCACGCGTCCGAACAGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAGGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAAACCATTGGAAGATGGAAGAACCCCTGTCAGACTATAAATATTCAGAAAGAATCTACTCTGCACTTTGGTCCTTCGCCTCAAAAGTGGCATGCCCATATTTGGTCAAGACCTTAACTGGGAAAACCATTACCCTTGAAGTTGAACCCAGGGACACAATTGAAAATGTAAAAGCCAAAATCCAAGAACAAAGAAGGCATTCCCTCCGGATCCGCCAAAAATGGATTTTTGCCTGGTAAACC
  5   1   2       bld Kid  5g                         IMAGE:7011954.5p                                                                                                                                                                                                                                                                                                                     CTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAACAATTGGAAGATGGAAGAAACCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTCGTCTCAGAAGTGCATGCAGATATTGTCAGA
  5   1   0       chi Eye1                            IMAGE:7019693.5p                                                                                                                                                                                                                                                                                                                     CTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTTTTGAAACCCCCCAGGGGGAAAAATAACCTTTTTGTGTTGCCCGCGGGGCCCCTTTGGGGAAgggggggggcaagacccaaaaaagggggggggggCTCCCCCCCTTGATCAACAGAAAATTGAAATTTTGGCTGGCAAACCAATTGGAAAGATTGGAAGAAACCCCTTGTCCGGAACTAAAAAATTTTCGGAAAGGGGAATTCTACTCTCGGGCACCTTGGGGGCCCTTCCGTCTCCAAAAGGGGGGGCATGGGCAAAAAATTTTTGTGTACAAGACACCCTTTAACGGGGGGGAGAAAACACCCTTTACCCCCCTTTGGAAAGGTGTTGAACACCCAGGGTGTGGCCACCCAATTTTTGGAAAAAAGTTGGTGAAAAACC
  5   1   2       add Ov1  5g                         IMAGE:8332586.5p                                                                                                                                                                                                                                                                                                                     CTTTGGTAGCCGTGTGGTTCGAGGTAACAGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAGGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGGTGACCCTATTGAGAATTCAAGGCCAACATCTAAAACAAGGGAGGGTTTCCCCCTGATTACAGAAATGGATTCTTGCTGGCAACAATTGGTAAATGGAAGAACCTGTTAGATAATATTT
  5   1   2       bld Lmb1 5g                         IMAGE:8531448.5p                                                                                                                                                                                                                                                                                                                     CTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACTCTGTCAGACTATAA
  5   1   2       bld Lmb1 5g                         IMAGE:8533425.5p                                                                                                                                                                                                                                                                                                                     CTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCACAGAGATTGAATTTGCTGGCAAACATTGGAGATGGAGAACCTGTCGACTATATATCAGAAGATCTACTCTGCACTGTCCTCGTCCAGAGTGCTGCAGAATTGTCAGACTTACTGGAGACATACCTGAGTGACAGTGCCATGAATGTAACAATCAGACAGAGCTCTCGATCCAA
  5   1   2       add Lmb1 5g3  in                    IMAGE:8533015.5p                                                                                                                                                                                                                                                                                                                     CTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAACCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGGCAAACATTGGAAGATGGAGAATCCTGTCAGACTATATATTCAGAAGGATCTACTCTGCACTTGGTCCTCGTCTCAGAGTGCATGCAGATATTTGTCAGACTNACTGGGNAGACATACCNNTGAGTGNNACAGTGACCATGNAATGTAAGCAAATCCAGACAGAGCTT
  5   1   2       bld Lmb1 5g                         IMAGE:8533829.5p                                                                                                                                                                                                                                                                                                                     CTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACATTGGAAGATGGNAGATCCTGTCAGACTATATATTCAGAAAGATCTACTCTGCACTTGGTCCTCGTCTCGAAGTGCATGCGATATTGTCAGACCTACTGGNAGACATACCCTGAGTGAACAGTGACCATGAATGTAAGCAAATCCAGACAGAGCTCTCTG
  5   1   2       bld Int2 5g                         IMAGE:8526943.5p                                                                                                                                                                                                                                                                                                                     CTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCTGTCAGACTATATATTCAGAAGGATCTACTCTGCACTTGGTCCTCG
  5   1   2       bld Int2 5g                         IMAGE:8527553.5p                                                                                                                                                                                                                                                                                                                     CTTTGGTAGCCGTGTGGTTCGAGGTAACAGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAGGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAAGAATCTACC
  5   1   2       bld Spl  5g                         IMAGE:8462851.5p                                                                                                                                                                                                                                                                                                                     CTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCCAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGGCAACATTTGGAGATGGAAGAACCTGTCGACTATATATTCAGAAGATCTACTCTGCCTTGGTCCTCTCTCGAAGTGCTGCAGAATTGTCAGACTTACTGGAGACATACCCTGAGTGAACATGACCATGAATGTAAGCAATCAGACAGAGCTCTCGATGCGATGATTGCTGACACG
  5   1   2       bld Lmb1 5g3  in                    IMAGE:8533105.5p                                                                                                                                                                                                                                                                                                                     CTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATNCACAGAGATTGATATTTGCTGGCNNAACATTGNAAGATGGAAGATCCTGTCAGACTATATATTCAGAAGGATCTACTCTGCACTTGGTCCTCGTCTCGGAGGTGCATGCAGATATTGTCAGACTTTACTGGGAGACCATACCTTGAAGTTGACAGTGA
  5   1   2       add Ga18 5g3  in                      xlk148h17ex.5p                                                                                                                                                                                                                                                                                                                     CNNTGGTAGCCGNGNNNTTNGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGNAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGNNAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGNCNAAAATCCAAGACAAGNAAGNNATTCCCCCTGATCAACAGAGNNTGATNNTTGCTGGNAANCANNTNGGAAGATGGGANGANCNCTGTCAGANTATNATATTCAGAAGGNA
  5   1   2       add Ga18 5g3  in                        xlk1l07ex.5p                                                                                                                                                                                                                                                                                                                     CNTTGGTAGCCGTGTGGNTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGNAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAANTATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCANGACAAGGAAGGCATTCCCCCTGATCAACAGAGANTGATATTTGCTGGCAAACNNTTGGAAGATGGNAGAACCCTGTCAGACTATNATATTCAGAANGNAATCTACTCTGCACTTGGNCCTNCGTCTCAGAGGTGGNATGNAG
  5   1   2       add Ga18 5g3  in                      xlk144c19ex.5p                                                                                                                                                                                                                                                                                                                     CNTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGNAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGNGACACTATTGAGAATGTAAAGNCNAAAATCCAAGANAAGGAAGGCATTCCCCCTGATCAACAGAGANTGATATTTGCTGGNAANNAATTGGAAGNNGGAAGNACCCTGTCAGA
  5   1   2       add DMZ  5g3  in                         xl259c21.5p                                                                                                                                                                                                                                                                                                                     CTTTGGTANCCGTGTGGTTCGAGGTANCTGATTGAATCTCGCGCANGACCCGCTCGTCAGCAAACNTGCNGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCNAGTGACACAATTGANAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCTNACAGCTGGAGGATGGACGAACCCTGTCGGATTACAACNTTCNNAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGANAGGGGGGATGCAGATATTTGTGAAGACCCTGACCGGGAANACNATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGANATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGANCCCTGTCTGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCANATATTTGTGAAGACCCTGACTGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACNCTATTGAGAATGTAANGGCCANAATCCCNGACAAGGAANGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAANATGGCAGAANCCTGTCTGANTA
  5   1   2       bld DMZ  5g3  in                         xl259e12.5p                                                                                                                                                                                                                                                                                                                     CTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGANGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGANGTGAACCAGTGACNCATTGAAATGTAA
  5   1   2       bld DMZ  5g3  out                        xl233n04.5p                                                                                                                                                                                                                                                                                                                     CTTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAANGAATC
  5   1   2       bld Tbd3 5g                         IMAGE:3548616.5p                                                                                                                                                                                                                                                                                                                      TTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGGCTGGCAACAATTGGAAGATGGAAGAACGCTGTCAGACTATTATATTCAGAAAGAATCTACTCTGCACTTGGTCCTTTCTCTCAGAGGTGGCATGCAGATATTTGGCAAG
  5   1   2       bld Ov1  5g                         IMAGE:6316053.5p                                                                                                                                                                                                                                                                                                                      TTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCCACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAAACCCTGTCAGACTATAATATTCAGAAAGGAATCTACTCTGCACTTGGGTCCTTCCTCTCAGAGGTGGCATGCAGATATTTTGTCAAGACCCTTACCTGGGAAAGACCATTACCCTTTGAAAATTGGAACCCAGTGAACCCAAATTGAAAATTGTTAAAAGCCAAAAATTCCAAGGACCAAAGAAAGGCCTTTTCCTCCCCGAATC
  5   1   2       bld Oo1  5g                         IMAGE:6641862.5p                                                                                                                                                                                                                                                                                                                      TTTGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCATAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTNGAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCTCTGNATCAGGCAGAGATTGATTTTTTGCTGGTAAAGCAGCTGGGAAGATGGCCCNNGCACTCTTTC
  5   1   2       bld Sp1  5g3  out                   IMAGE:4963938.5p                                                                                                                                                                                                                                                                                                                       TTGGTAGCCGTGTGGCTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAA
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073000.5p                                                                                                                                                                                                                                                                                                                       CCACGCGTCCGCCCACGCGTCCGAACAGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAGGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCCAAAATCCAAGA
  5   1   2       bld Emb1 5g                         IMAGE:6864419.5p                                                                                                                                                                                                                                                                                                                       CCACGCGTCCGCCCACGCGTCCGAACAGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAGGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCCTGACAGGGAAGACAATTACTCTTGAAAGTGAGCCCAAGTGACACTATTTGAGAATGTCAAGGCCCAAAATCCAAGACCAAGAAAGCATTCCCCCCTGATCAACANGAAATTGATATTTGGCTGGCCAACAATTGGGAAGATGGAAAAACCCTTGTCGAACTTTTATATTCCGAAAGGAATCCACTCCGGCACTTGGGCCCTTCGTCCCAAAAGGGGGCTGCAAATTTTTTGTCCAGAACCTTTAACGGGGAAGACCCTTTACCCTTTGAAATTGGAAACAAGTGGAACCCATTTGGAAAATGGTAAAAGCGAAAAATCCCCAGAACCAAAGAAAGGCGTTTCCCCCCCGGAATAAAAAAAC
  5   1   2       bld Spl  5g                         IMAGE:8464467.5p                                                                                                                                                                                                                                                                                                                       TTNGGTGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACTAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCCAACAACTGGAAGATGGAAGACACCTGTCAGACTATAATATTCAGAAGGGGTCTACTCTGCACTTGGTCCTTCGTCTCAAGGTGGCAT
  5   1   2       bld Ga18      in                      xlk111m02ex.5p                                                                                                                                                                                                                                                                                                                        TGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGNAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGNTCTTCGTCTCAGAGGTGGGATGNAAATATTTGTGAAGACCCT
  5   1   2       add Ga18 5g3  out                     xlk126j21ex.5p                                                                                                                                                                                                                                                                                                                        TGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGNATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGNAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGNGGGATGCAAATATTTGTGANGANCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGNCCAAAATCCAAGACAAGGAAGNCATTCCCCCTGATCAACAGAGATTGANNTTTGCTGGCAANC
  5   1   2       add Ga18      in                      xlk126l21ex.5p                                                                                                                                                                                                                                                                                                                        TGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGNAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTNCGTCTCAGAGGNGGGATGCAAATATTTGTGAAGACCCTGACAGGNAAGACAATTACTCTNNAAGTTGAGCCAAGTGACACTATTGAGAATGTNAAGGCCAAAAATCCAAGACAAGGAANNNATTCCCCCTGATCAACAGAGATTGANNTTTNCTGGCAAACNA
  5   1   2       add Ga18 5x3  out                     xlk126n21ex.5p                                                                                                                                                                                                                                                                                                                        TGGTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGNATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGNAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGNTCTTCGTCTCAGAGGTGGGNNGNAAATATTTGTGAAGACCCTGACAGGNAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCNAAAATCC
  5   1   2       bld Sp1  5g3  in                    IMAGE:4174826.5p                                                                                                                                                                                                                                                                                                                         GGTAGCTGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGC
  5   1   2       bld Ga15 5g3  in                       XL442m10ex.5p                                                                                                                                                                                                                                                                                                                          GTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGNAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAANGAATCTACTCTGCACTTGGTCCTTCGTCTCANAGGTGGCATGCAGATATTTGT
  5   1   2       bld Te2  5g3  in                    IMAGE:7390961.5p                                                                                                                                                                                                                                                                                                                          GTAGCCGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATATATTCAGAAGGATCTACTCTGCACTTGGTCCTCGTCTCAGAAGTGCATGCAGATATTTGTCAGACCTTACTGGGNNAGACATACCCCTGAGNNTGACAGTGACACATGAAAATGTAAGCAAATC
  5   1   2       bld Spl  5g3  in                    IMAGE:8463644.5p                                                                                                                                                                                                                                                                                                                          GGGGACCATAAATTGAATTCGTCCCATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGA
  5   1   2       bld Gas9 5g                              BG409960.5p                                                                                                                                                                                                                                                                                                                           CCCACGCGTCCGTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAAGGCATTCCCCCTGATCAACANAAGATTGATATTTGCTGGCAAACAAATTGGAAGAAGG
  5   1   2       bld Ov1  5g                         IMAGE:8331762.5p                                                                                                                                                                                                                                                                                                                               CGTGTGGTTCGAGGTAACAGATTGAATCTCGCGGAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAGGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCCNAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATA
  5   1   2       bld Lmb1 5g                         IMAGE:8533625.5p                                                                                                                                                                                                                                                                                                                               CGTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGNCAACATTGGAAGATGGAAGAACCCTGTCAGACTATATATTCAGAAAGATCTACTCTGCACTTGGTCCTCGTCTCAGAAGTGCATGCAGATATTGTCAGACCTTACTGGGNAGACATACCNNTGAGTGACAGTGACCATTGAATGTAAGCAAATCAGACAGAGGATCTCTGTCACGAAT
  5   1   2       bld Te2  5g                         IMAGE:7394045.5p                                                                                                                                                                                                                                                                                                                                GTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAAGAATCTACTCTGCACTGGNTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAA
  5   1   2       bld Tail 5g3  out                   IMAGE:8542554.5p                                                                                                                                                                                                                                                                                                                                GTGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCT
  5   1   2       bld Emb1 5g                         IMAGE:6636648.5p                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCCAGACCTTAACTGGGAAGAACATTACCCCTGAAGTTGAACCCAGTGACCCAATTGAAATGTAAAAGCCAAAATCCCAAGACAAGGAGGCATTCCCTCCCTNATCAGCAGAAGATTGATTTTTTGCTGGTAAGCCACCTTGGAAGATGGCCCCCCACTC
  5   1   2       bld Kid  5g                         IMAGE:7011576.5p                                                                                                                                                                                                                                                                                                                                 TGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGACCCTGTTAGACTATATATTCAGAAGGATCTACTC
  5   1   2       bld Ga15 5g                            XL432l14ex.5p                                                                                                                                                                                                                                                                                                                                 TGTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCNAAGTGACACAATTGGAAAATGTAAAAAGCNAAAA
  5   1   2       bld Lu1  5g                         IMAGE:4056774.5p                                                                                                                                                                                                                                                                                                                                  GTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGAAGGCATTCCCC
  5   1   2       bld He1  5g3  in                    IMAGE:4407811.5p                                                                                                                                                                                                                                                                                                                                  GTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAG
  5   1   2       bld Ov1  5g                         IMAGE:6318564.5p                                                                                                                                                                                                                                                                                                                                  GTGGTTCGAGGTAACAGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAGGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGGCAACAATTGGAAGATGGAAGAACCCCTGTCAGACTATAATATTCAGAAGGGAATCTAACTCTGCACTTGGGTCCTTCCGTCTCAGAAGGTTGGCATGCCAGATATTTTGGTTCAAGAACCTTTAAACTGGGGAANNGACCNATTTACCCCTTTGAAAGGTTGAAANCCCAAGGGGGACACCAAACTGGaaaaaatgttaaaaaaggcaaaaaaaTCCCCAAGAACCCAAAAGAAAGGGCAATTTTCCCTTCCCCGGGAA
  5   1   2       bld Emb1 5g                         IMAGE:6633435.5p                                                                                                                                                                                                                                                                                                                                  GTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCCACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTTCAAGACCTTTAACTGGGGAAGACCATTTACCCCTTGAAAGTTGAAACCCAAGTGACCCCAATTGGAAAAATGTTAACAGGCAAAAAATCCCAGGAACCAAGGAT
  5   1   2       bld Te2  5g                         IMAGE:7392474.5p                                                                                                                                                                                                                                                                                                                                  GTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACATTGGAAGATGGAAGAACCTGTCAGACTATATATTCAGAAAGATCTACTCTGCACTTGGTCCTCGTCTCAGAGGTGCATGCAGATATTGTCNAGACCTTACTGGGNAAGACATACCCTNNGAGTGAACCAGTGA
  5   1   2       add Thy  5g3  in                    IMAGE:8550565.5p                                                                                                                                                                                                                                                                                                                                  GTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACATTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACATTGGAAGATGGAAGAACCTGTCAGACTATATATTCAGAAGGATCTACTCTGCACTTGGTCCTCGTCTCAGAGTGCATGCGATATTGTCAGACCTACTGGGAGACATACCNTGAGTGNACAGTGACCATGAATGTAAGCAAATCAGACAGAGGCTCTCTGTACGAATGATTGCGTACACTGAATGCCCC
  5   1   2       bld DMZ  5g3  in                         xl335o20.5p                                                                                                                                                                                                                                                                                                                                  GTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGANGAACCCTGTCAGACTATAATANTTCAGAAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAAAGGTGGCATGCANATATTTG
  5   1   2       bld DMZ  5g3  in                         xl325o14.5p                                                                                                                                                                                                                                                                                                                                  GTGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCANAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACNATNACCCTNGAAGTNGAACCA
  5   1   2       bld Te2  5g                         IMAGE:7209239.5p                                                                                                                                                                                                                                                                                                                                   TGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGG
  5   1   2       bld Te2  5g                         IMAGE:7394312.5p                                                                                                                                                                                                                                                                                                                                   TGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTAAATATTCAGAAGGATCTACTCTGCACTTGGTCCTCGTCTCGAGGTGCATGCAGATATTGTCAGACCTTNACTGGAGANNCATACCTGNNAGTGACAGTGACCATTGAATGTAAGCAAACCAGACAGAAGCTCTCTGTCACAAATGATTTGTGTACACG
  5   1   2      seed Te2  5g3  in                    IMAGE:7389939.5p                                                                                                                                                                                                                                                                                                                                   TGGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTT
  5   1   2       bld Emb4 5g                         IMAGE:4680173.5p                                                                                                                                                                                                                                                                                                                                    GGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACTAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAAT
  5   1   2       bld DMZ  5g                              xl264g04.5p                                                                                                                                                                                                                                                                                                                                    GGTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGANGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCANANGTGGCATGCANATATTTGTCAAGACCTTAACTGGGAAGACATTACCTTGAGTNGAACNAGTGACNCATTGAAATGTAAAGC
  5   1   2       bld Emb4 5g                         IMAGE:5514785.5p                                                                                                                                                                                                                                                                                                                                     GTTCGAGGTAACTCATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTTGTCAGACCTTNACTGGA
  5   1   2       bld Te2  5g3  in                    IMAGE:7391063.5p                                                                                                                                                                                                                                                                                                                                     GTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACATTGGAAGATGGAAGAAACCTGTCAGACTATNATATTCAGAAGGAATCTACTCTGCACTTGGTC
  5   1   2       bld Ov1  5g                         IMAGE:8332618.5p                                                                                                                                                                                                                                                                                                                                     GTTCGAGGTAACAGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAGGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGGCAACAATTGGAAGATGGAAGAACCCTGTCAGACTANTATATTCAGAAAGGATCTACTCTGCACTTGGTCCTTCGTCTCAGAAGTGGCATGCAGATATTTGTCA
  5   1   2       add Ga18 5g3  in                       xlk71g09ex.5p                                                                                                                                                                                                                                                                                                                                     GTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGNAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGNCTCAGAGGTGGGATGCNNNNATTTGTGAAGACCCTGACAGGGAAAGACAATTACTCTTGAAGTTGAGCCAAGNGACACTATTGAGAATGTNAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGANNAACAGAGNNTGATATTTGCTGGNAAACANNTGGAAGNNGGNNNGAACNCTGTCAGACTATNATATTCAGAANGNATCTACNCTGCACTTGGNCCTTCGNCTCAGANG
  5   1   2       bld DMZ  5g3  in                         xl335m22.5p                                                                                                                                                                                                                                                                                                                                     GTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGANGAACCCTGTCAGACTATAATATTTCNGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCANAGGTGGCATGCAGATATTTGTCAAGA
  5   1   2       bld DMZ  5g3  in                         xl322j17.5p                                                                                                                                                                                                                                                                                                                                     GTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTTGGTCCTTCGTCTCAAAGGTGGCATGCANATATTNGTCAAGACCTTAACTGGGAAACCATTACCCTTGAAGTNGAACCAGTGACNC
  5   1   2       bld DMZ  5g3  in                         xl325f08.5p                                                                                                                                                                                                                                                                                                                                     GTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCANANGTGGCATGCANATATTTGTCAAGACCTTAACTGGGAANACCATTACCCTNGAAGTTGANCNAGTGACCCATTGAAATGTAA
  5   1   2       bld DMZ  5g3  in                         xl270d24.5p                                                                                                                                                                                                                                                                                                                                     GTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGANGAACCCTGTCNGACTATAATATTCCNNAANGAATCTACTCTGCACTTGGTCCTTCGTCTCAAAGGTGGCATGCANATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAA
  5   1   2       bld DMZ  5g3  in                         xl274e02.5p                                                                                                                                                                                                                                                                                                                                     GTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTANCTGGGAAGACNATNACCCTNGAAGTTGANCCAGTGACNCATTGAAATGTAAAGCAAAATCNAGACAAGAAGGCNT
  5   1   2       bld DMZ  5g3  in                         xl338i14.5p                                                                                                                                                                                                                                                                                                                                     GTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCANGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAGTGACNCAATNGAAAATGT
  5   1   2       bld DMZ  5g3  in                         xl329m02.5p                                                                                                                                                                                                                                                                                                                                     GTTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAAAGGTGGCATGCANATATTTGTCANGACCTTNACTGGGANGACNATTACCCTTGANGTNGAACNAGTGACACANTNGAAATGTAAAAGCAAAATCCA
  5   1   2       bld Oo1  5g                         IMAGE:6640827.5p                                                                                                                                                                                                                                                                                                                                      TTCGAGGTAACAGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAGGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGGAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCCTTGAAAGTTGAACAAGNTGACACAATTTGAAAATGTAAAAAGCAAAATCCCAGACCAAGGAAGCATTCCCTCCTGATCAGCAGAAGATTGATTTTTGCTGGGTAACCAGCTGGAAAAATGGC
  5   1   2       bld Te2  5g                         IMAGE:7209094.5p                                                                                                                                                                                                                                                                                                                                      TTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTC
  5   1   2       bld Ga15 5x3  out                      XL412f04ex.5p                                                                                                                                                                                                                                                                                                                                      TTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCNAGTGGACNCCATTTgaaaaatgtaaaaagcaaaaaTCCCAANGACAAAGAAGGCATTTCCTCCCTGATCANCANANAATTGATTTTTTGCTGGGTAAGCNNCTGGGAANATGG
  5   1   2       bld Ga15 5g                            XL438d06ex.5p                                                                                                                                                                                                                                                                                                                                      TTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCNAAAATCCAAGACCAAGGAAGGCNTTCCTCCCGATCACCAGAGATTGATTTTTTGCTGGTAAGCAGCTGGAAGATGGC
  5   1   2       bld Ga15 5g3  in                       XL489p22ex.5p                                                                                                                                                                                                                                                                                                                                      TTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCNGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTTCGGTCTCAGAGGGTGGGCAATGCAAAATATTT
  5   1   2       add Ga18 5g3  out                     xlk166d11ex.5p                                                                                                                                                                                                                                                                                                                                      TTCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGNAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCANATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGNTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGNATTCCCNCCTGATCAACAGAGANTGATATTTGCTGGCAAACANNTGGAAGAT
  5   1   2       bld Ga15 5g3  in                       XL445n20ex.5p                                                                                                                                                                                                                                                                                                                                       TCGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACNCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGGAAGACCATTACCCTTGAANTTGAACCAAAGTGACNCNATTGAAAATGTAAAANGCAAAAAATCCNAGACCAAAGGAAGGCATT
  3   1   2       bld Ga18      out                     xlk132f13ex.3p                                                                                                                                                                                                                                                                                                                                       TNCGAGGTNACTGATNNNNTCTCGCGCAGGNNCCGCTCGTCAGNNACATGCAGANATTTGTGAAAACTCTNACTGGGAAGNCCATCACNCTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAANTCCAAGATAAAGAAGNNNNTCCCCCTGNCCAACAAAGGTTGATCTTNGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCNCTCTNNACTTGGTTCNCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACANNCCTTTTNNNNNCNNNCTNCATTACTT
  5   1   2       bld Emb4 5g                         IMAGE:5515921.5p                                                                                                                                                                                                                                                                                                                                        CGAGGTAACAGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAGGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTTGTCAGACCCTTACTGGGGAAGACATTTACCTTNNGAGTGAACNAGTGACACATTTGAA
  5   1   2       add Ga15      in                       XL494j08ex.5p                                                                                                                                                                                                                                                                                                                                        CGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCANAGGTGGGATGCAAATATTTGTGAAGACCCTGACNGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTCNNGAATGTAAAGGCCAAAATCCAAGACAAGGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCNGACTATAATATTCAGAANGAATCTANCTCTGCACTTGGTCCTTCGTCTCCANAGGGNGGCATGCAGATATTTGTCAAGNACCCTANCCTGGGAAAGACCCTTACCCCTTGNAGTTGNAACCNNAGTGGACACCATTTGANAANTGTANAAGCAAAAA
  5   1   2       bld Emb4 5g                         IMAGE:5543093.5p                                                                                                                                                                                                                                                                                                                                         GAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGGATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTTAACTGGGAAAGACATTTACCCTTGAAGTTGAACAAAGTGACACCATTGAAAATGGTAAAGCCAAAATCCCAGACAAAGAAAGCATTCCTCCTGATCAGCAGAAGATTGATTTTGGCCTGGTAAACAACCGGG
  5   1   2       bld Ov1  5g3  in                    IMAGE:8328751.5p                                                                                                                                                                                                                                                                                                                                         GAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCTCTGATCAACAGAGATTGATATTTGCTGGGCAAACAATTGGAAGATGGGAGAACCCCTGTCAGACTATAATATTTCAGAAGGAATCTACTCTGCAA
  5   1   2       bld Thy  5g                         IMAGE:8548056.5p                                                                                                                                                                                                                                                                                                                                         CGAGGAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGG
  5   1   2       bld He1  5g3  in                    IMAGE:4406801.5p                                                                                                                                                                                                                                                                                                                                          AGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAAC
  5   1   2       bld Sp1  5x3  out                   IMAGE:4964341.5p                                                                                                                                                                                                                                                                                                                                          AGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAA
  5   1   2       bld Ov1  5g                         IMAGE:8332500.5p                                                                                                                                                                                                                                                                                                                                           GGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTTGGCAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAAAGGAATCTACTCTGCACTGGGTCCTTCGTCTCAGAGGTGCATGCAGATATTGTCAAGA
  5   1   2       bld Ov1  5g                         IMAGE:8332524.5p                                                                                                                                                                                                                                                                                                                                           GGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAANCCTGTCAGACTATAATATTCAGAAAGGATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGCATGCAGATATTTGTCAGA
  5   1   2       bld Emb4 5g3  in                    IMAGE:4959762.5p                                                                                                                                                                                                                                                                                                                                            GTAACAGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAGGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTTTTATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTC
  5   1   2       bld Tbd3 5g                         IMAGE:3550137.5p                                                                                                                                                                                                                                                                                                                                             TAACTGATTGAATCTCGCGCAGNACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAA
  5   1   2       bld Sp1  5g                         IMAGE:4964465.5p                                                                                                                                                                                                                                                                                                                                              AACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAAT
  5   1   2       bld Emb4 5g3  in                    IMAGE:4959811.5p                                                                                                                                                                                                                                                                                                                                              AACAGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAGGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCATATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAG
  5   1   2       bld Emb1 5g                         IMAGE:6631849.5p                                                                                                                                                                                                                                                                                                                                              AACAGATTGAATCTCGCGCAGGAACCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAGGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCCAAAATCCAAGACAAGGAAGGCANTTCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGGAAGATGGGAAGAACCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAAAGGTGGCATGGCAGATATTTGTCAAGAACTTAACTGGGAAGACCATTTACCCTTTGAAGTTGAACCAAGGTGACACCATTGgaaaatgtaaaaagcaaaaaaTCCCCAGACCAAGGAAGGGCAATTCCCTTCTTGGATCAGGCCAGGAGATTTGGAATTTTTTTGCCTGGTTAAAGACAAGGCCTGGGA
  5   1   2       bld Emb1 5g                         IMAGE:5157104.5p                                                                                                                                                                                                                                                                                                                                              AACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCCTTGAAGTTGAANCCAAGTGACACAAATTGAAAATGTTAAAAGCAAAAATCCCAAGACAAAGAAGGCATTTCCTCCCTGAATCAGCAGAAGATTGAATTTTTTGCCTGGTAAGGCAAGCCTGGC
  5   1   2       chi Ga15      in                       XL401c12ex.5p                                                                                                                                                                                                                                                                                                                                              AACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACNAGGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGTAAGCNACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCCGAAAGAGTCCNCCCTTGCACTTANTTCTTCCTCTGAANANGTGGGATGCCANATATTTNTG
  5   1   2       bld Ga15 5g3  out                      XL450p17ex.5p                                                                                                                                                                                                                                                                                                                                              AACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCANAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCCAGTGANACNATTGAAAATGTAAAAAGCAAAAATCCAAGACCAAAGAAAGGCATTTCCNCCTGATCNGCANAAGATTGGATTTTTGCTGG
  5   1   2       bld Ga15 5g                            XL500c02ex.5p                                                                                                                                                                                                                                                                                                                                              AACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGNACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAAACCNAAGTGACACAATTGAAAATGTAAAGCCAAAAATCCCAAGACAAANGAAGGCATTCCC
  5   1   2       bld Ga15      in                       XL470i16ex.5p                                                                                                                                                                                                                                                                                                                                              AACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGANGACCATTACCCTTGAAGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCTCCTGATCCNCANAAGATTGNATTTT
  5   1   2       add Ga18 5g3  in                       xlk73p03ex.5p                                                                                                                                                                                                                                                                                                                                              AACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGNATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGNAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGNATTCCCCCTGATCAACAGAGANTGATATTTGCTGGCAAANNNNNTGGNAGATGGAAGAACNCTGTCAGACTATNATATTCAGAANGAATCTACTCTGCACTTNGNNCTTCGTCTCAGAGGNNG
  5   1   2       add Ga18 5g3  in                       xlk75b10ex.5p                                                                                                                                                                                                                                                                                                                                              AACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGNATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGNAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGNNAGACAATTACTCTTGAAGNTGAGCCAAGTGACACTATTGAGAATGTAAAGNCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGNNTGATATTTGCTGGCAAACAATTNGNAAGATGNAAGAACCCTGTCAGACTATAATATNNAGAANGAATCTACTCTGCACTTNNNNNTTCGTCTCAGAGGTGGNATGCAGANNNTTGTCAA
  5   1   2       bld DMZ  5g                              xl247m21.5p                                                                                                                                                                                                                                                                                                                                              AACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTNGAAGTTGANCCAGTGACANATTGAAAATGTAAAGCNAAATCNAGACNAGAAGGCNTTC
  5   1   2       bld Emb4 5g                         IMAGE:5572716.5p                                                                                                                                                                                                                                                                                                                                               ACAGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAGGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATNCACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGGCATGCAGATATTTGTCAAGACCCTTAACTGGGGAAGACATTTAACCCCTTGAAGTTTGAACCNNAGTGACNACCATTTGAAAATGGTAAAAGCAAAAAATCCCAGAACNAAGGAAGGCATTCCCTTCCTGATCCAGCAAAAGAATTG
  5   1   2       add Brn3 5g                         IMAGE:8539959.5p                                                                                                                                                                                                                                                                                                                                               ACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATATATTCAGAGGAATCTACTCTGCACTTGGTCTTCGTCTCAGAGGTGCATGCGATTTTGTCAGACCTTACTGGAAGACATACCCTTGAGTTAACAAGTGACCATTGAATGTAAACCAAATTCAAACAAGAGCTT
  5   1   2       bld DMZ  5g3  in                         xl325g05.5p                                                                                                                                                                                                                                                                                                                                               ACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGANGAACCCTGTCNGACTATAATANTTCAGAANGAATCTACTCTGCACTTGGTCCTTCGTCTCANAGGTGGCATGCANATATTTGTCAAGACCTTAACTGGGAANACCATTACCCTNGAAGTTGA
  5   1   2       bld Gas6 5g                         IMAGE:3473400.5p                                                                                                                                                                                                                                                                                                                                                CTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCANATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATNTGCTGGCAAACAATTG
  5   1   2       bld Te2  5g                         IMAGE:7211460.5p                                                                                                                                                                                                                                                                                                                                                CTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACANNTTACCCTGAAGTTGAACCAGTGACACAATTTGAAATGTAAAAGCAAAAATCCCAGACAAAGAAGGCAATCCTCCTGATCAAGCAAAAATGGATTTTTGGCTGGTAAGCAGCTGGAAAAAGGGCCGCACCCCTTCTGGATACAACAAT
  5   1   2       bld Te2  5g3  in                    IMAGE:7389881.5p                                                                                                                                                                                                                                                                                                                                                CTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTC
  5   1   2       bld Thy  5g                         IMAGE:8548212.5p                                                                                                                                                                                                                                                                                                                                                CTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAANGGATCTACTCTGCACTTGGTCTTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACATTACCCTGAA
  5   1   2       bld Oo1                             IMAGE:6639150.5p                                                                                                                                                                                                                                                                                                                                                 CGAGGTAACTGATTGAATCTCGCGCAGGACCCGCTCGTCAGCAATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGGAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAAGATTGATTTTTTGCTGGGNTAAGCAGCTGGGAAGATGGCNCCGCACTCTTTTCTGACTACNACAATTCAAAAAAAGAAA
  3   1   2       bld Ga18      in                       xlk70l02ex.3p                                                                                                                                                                                                                                                                                                                                                  ATTNANTCTCNCGCAGGNNCCNCTCGTCAGCAAACATGCAGATATTTGNNAAANCTNCNCNCTGGGAAGNCCATCACNCTTGAANNNGANCNAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCNAGATAAAGAAGGCATTCCCCCTNNCCAACAAAGGTTGATCTTCGCTGNCAAACAGCTGGAGGATGGNCGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACANTTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAGAAAGAATCCNCCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGANNNCNTTTTNNCnnnnnnnnCATTACTTNC
  5   1   2       bld Ga15 5g3  in                       XL419j21ex.5p                                                                                                                                                                                                                                                                                                                                                   ATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCNAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCNAGACAAAGAAGGCATTCCTCCTGATCANCANNANATTGATTTTTGCTGGTAACCANCTGGAAAGATGGC
  5   1   2       bld Int2 5g                         IMAGE:8527007.5p                                                                                                                                                                                                                                                                                                                                                   ATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTT
  5   1   2       add Ga18 5g3  in                       xlk55i04ex.5p                                                                                                                                                                                                                                                                                                                                                   ATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGNAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGANGCAAATATTTGTGAAGACCCTGACAGGNAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATNTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAANCAANTGGAAGATGGAAGAACCCTGTCAGACTATNATATTCAGAAGNAANCTACTCTGCACTTNGNCCTTCGNCTCAGAGGNGGNATNNAGATNTTTGNCAAGA
  5   1   2       add Ga18      in                       xlk70l02ex.5p                                                                                                                                                                                                                                                                                                                                                   ATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGNAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGNTGAGCCAAGTGACACTATTGAGAATGTAAAGNNCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGNNTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATNATATTCAGAAGGAANCTACTCTGCACTTGGNCCTTCGTCTCAGAGGTGGCATGNAG
  5   1   2       add Ga18 5g3  in                       xlk71p23ex.5p                                                                                                                                                                                                                                                                                                                                                   ATTGAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGNATTCCCCCTGACCAGCAGAGANTGATTTTTGCTGGNAAGNAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGNTCTNCGTCTCAGAGGTGGGATGNAAATATTTGTGAAGACCCTGACANGGAAGACAATTACTCTNNAAGNNNAGCCAAGNGACACTATTGAGAATGNAAANGNCAAAATCCAAGACAANGAAGNNATTCCCCCTGANC
  5   1   2       bld Oo1  5g                         IMAGE:3403832.5p                                                                                                                                                                                                                                                                                                                                                      GAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAGGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACTACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAGACCCTGACAGGGAAGACCAATACCTCTG
  5   1   2       bld Oo1  5g                         IMAGE:5078137.5p                                                                                                                                                                                                                                                                                                                                                      GAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGAC
  5   1   2       add Te2  5g                         IMAGE:7393289.5p                                                                                                                                                                                                                                                                                                                                                      GAATCTCGCGCAGGACCCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGCATGCAGATATTTGTCAGACCTTACTGGAAAAGACATACCTNNGAGTGACAGTGACACATGAAATGTAAAGCAAATT
  5   1   2       add Te2  5g3  in                    IMAGE:7208491.5p                                                                                                                                                                                                                                                                                                                                                                      CCGCTCGTCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCCTTACTGGGAAGACCATTTACCTTNNGAGTGAAC
  5   1   0       add Ga15      out                      XL408m15ex.5p                                                                                                                                                                                                                                                                                                                                                                            TGCAGANATTTGTGAAAACTCNCNCGTGGGAANACCAGTCACACTTGAAGTTGAGCCTGAGATGACACANTTGAGAATGNGAAAGCTAANATCCNANATNAAGAAGGCATTCCCCCTGACCAACAAANGTTGATCNTTGCTGGCANACAGCTGGANGATGGACNAACCCTGTCNCATTNCNNCATTCANNAGGAATCCACTCTGCACTTGGTTCTCCGGTTGAGANGGGGGATGCNCNATATTTGTGAAGCACCCTGGACAGGGAAGACNGATGTACTCTTGAGGTGGAGCCNCTGTGACNCTATTGCAGAATGTAAAGGCAANAATCCACGACGAGGAAGGTATTCCCCCTGANCAGCNGANATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCANAAAGAGTCCACCTTGCACTTANTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAANACAATTACTCTTGAAGTTGANCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAANGAANGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAANATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCANAGGTGGCATGCNNATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCCAANNGACANCCATTGAAAAATGTAAAAGCNANAAATNCCNANNACAANGAAAGNCATTCCNCC
  5   1   2       bld DMZ  5g3  in                         xl306g07.5p                                                                                                                                                                                                                                                                                                                                                                                 CAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAANGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAAATATTTGTCAAGACCTTAACTGGGGAAGACCATTACCCTTGAAGTTTGAACCAAGTGACACNATTGAAATGTAAAGC
  3   1   0       add Ga18      in                      xlk111m02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                     AANANANTNACTCTTGAAGTTGNNCCAAGTGACACAATTGAAAACGTNAAAGCAAAAATNCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTNNCTGGTAAGCAACTAGAAGATGGCAGANCCCTGTCNGACTACAATATTCAGAAAGANTCANCCTTGNACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAANACCCTGACCGGGAAGACAATTACTCTAGAAGTTGANCCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGNACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACANNCCTTTTnnnnnnnnCNNCATTACTTNC
  5   1   2       bld Tbd3      in                    IMAGE:3550103.5p                                                                                                                                                                                                                                                                                                                                                                                                                      AGACCATCACACTTGAAGTTGAGCCAAGTGACACAATTGAGAATGTGAAAGCTAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATACTACTTTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCACATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAA
  5   1   2       bld Tad2                            IMAGE:6934496.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAGATAAAGAAGGCATTCCCCCTGACCAACAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAACAATCCAAGACAAAGGACGCATTTCCTCCTGATCAGCAGAGATTGATTTTTTGCTGGGTAACCAGCTGGAAAGATGCCCGCACTCTTTTCTGACTACCACATTTCAAAAAGAATCCACCCTTGCCACTTAGTTTCTTTCGTCCCCNAAGGTGGGGATGCCAN
  5   1   2       bld Te2       in                    IMAGE:7206982.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCCCCCTGACCACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAGCAGCTGGAAGATGGCGCACTCTTCTGATACACATTCAAAGATCACCTGCACTAGTCTCGTCTCAAGTGGAGCAATATGTCAGACTACTGAA
  5   1   2       bld Ga15      out                      XL421f10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAAGGTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCCACCCTTGCACTTAGTTCTTTCGTCTCANAGGTGGGGATGCCAGATATTT
  5   1   2       bld Spl       out                   IMAGE:8463910.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGAGATTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATT
  5   1   2       bld Ga15      in                       XL435f18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTGATCTTCGCTGGCAAACAGCTGGAGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGACATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGCAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCCAAAAGAATCCACCCTTGCNCTTAGTTCTTCNTCTCANAAGGTGGGAATGCCAGANATTTTGNCCAGNACCTTAA
  5   1   2       bld Tad2      out                   IMAGE:6872085.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGATGGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCCTTGAAGTTGAACCAAGTGACACCATTgaaaaatgtaaaagcaaaaaaTCCAAGACAAAGGAAAGCATTCCTCCCTGATCAGCAGAAGATTGGATTTTTGGCTGGGAAACCAACTGGGAAAAATGGCCCCCACCTCTTTTCTTGACTTACAACCATTTCCAAAAAAGAATCCCACCCCTTG
  5   1   2       bld Brn3                            IMAGE:8541305.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGACGAACCCTGTCAGATTACAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGGTAGCAGCTGGAAGAATGGCGCACTCTTNCTGACTACACATTCAAAAGAATCCACCTGCACTAGTTCTCGTCTCAGAGTGGGAGCGATATTGTCAGACCTACTGGNAGACATACTCTGAGTGAGCAGTGCCATTGAATGCAGCTAATCAGATAGAGATC
  5   1   2       bld Gas5                            IMAGE:3751467.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAACATTCAAAAGGAATCCACTCTGCACTTGGTTCTTCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTACTTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCT
  5   1   2       bld Ooc2                            IMAGE:3746111.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAAAAGGAATCCACTCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACATTTGGAAATGTATATGCAAAGATCCAAGACAAAGCAAGCATTTCTCCTGATCAACACAAATTGGTT
  5   1   2       bld Te2       in                    IMAGE:7208221.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTGCACTTGGTTCTCCGTTTGAGAGGGGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTNCAGACCTTACTGGGTAAACATTACTNCTGAAGTGAC
  3   1   2       bld Egg4      in                    IMAGE:3743512.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACCCCAA
  3   1   2       bld Egg4      in                    IMAGE:3743536.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGCAGATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAAA
  5   1   2       bld Emb1      out                   IMAGE:3402803.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCA
  5   1   2       bld DMZ       in                         xl336g06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGAAGACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCANATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTNGANGTTGAGCCAAGTGACACTATTGAGATGTCCAGGCTAAAATCCNGNATAAGGAAGGANTCCCCCTGACCA
  5   1   2       bld Ga15      in                       XL492m24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAATTACTCTTGAGGTGGAGCCAAGTGACACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCCTGACCAACCAAAGATTGATCTTTTGCAGGCAAGCANCTGGGAAGATGGCCNGCNCTCTCTCTGACTACAATATTCCANAAAGAATCCNCTCTGCANTTTGGGTCCNTTCGTCTCANAAGGNGGGAATGCAAAATATTTGTCAAGACCTTTANCTGGG
  3   1   0       add Ga15      in                       XL401c12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAAGNGACNCCANTTGAGAATNTTAAGNCAAAAATCCAATNCAAAGAAGGCATTCCCCCTGNTCAACAGNNATNGATTTTTGCTGGGAAGCAGNTTGAAGATGGCCGCANTCNNTTTGATNACAACATTCAAAAAGAGTCCACCTCGACNCCTAGTTCTGTNGTCTCAGAGGTGGGANGCAGATANTTGTCAAGACCTTAACTGGGAAGACCATTACTCNTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACT
  5   1   1       add Ga18      in                       xlk67k04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGNGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGNAAGNAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTNCGTCTCAGANGTGGGANGCAGATATTTGTCAAGACCTTAACTGGNAAANACAATTACTCTTGAANNG
  5   1   2       e50                            Xl3.1-IMAGE:3517001.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTC
                                                  Xl3.1-CHK-1012705193                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTA
  5   1   2      seed Gas8      in                    IMAGE:3517001.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGGAGCCAAGTGACACTATTGAGAATGTATGGCAAAAATCCAAGACAAAGAAGGTATTCCTTCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTTGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTTCAAAAGAATCCACCCTTGCACTA
  5   1   2       bld Ga15      in                       XL490a15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCANGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCNGGCAAGCAGCTGGAANATGGCCGCACTCTCTCTGACTACNATATTCNGAAAGAATCCCCNCTGCATTTGGTCCTTCCNTCTCAAAGGTGGGGATGCCAAATATTTTGTCAAGAACCTTAAC
  5   1   2      skin Ga15                               XL492m18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCCTGACCAACAAAGATTGAATCTTTGCAGGGCAAGCAGCCTGGAAGATGGCCCGCACTCTCTCTGACTACNA
  5   1   2      skin Eye1      in                    IMAGE:6957326.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGGATTCCTTCTGACCAACAAAGATTGATCTTTTGCAGCAAGCAGCTGGAAGATGGGCCGCACTCTCTCTGACTACNATATTCAGAAAGAATTCCACTCTGCATTTGGGTCCTTCGTCTCCAAAGGTGGGAATGCAAATATTTTGGTCAAGACCTTAAACTGGGTAAAAACAATTAACTCCTTGAAAGTTGGAACCAAAGTGGACCCA
  5   1   2      skin Kid                             IMAGE:7010910.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGCCTTCGTCTCAGAGGGGGATGCAATATTTGTCAGACTTACTGGTAAACATTACTCTGAAGTGAACAGTGAAAATT
  5   1   2       e50                            Xl3.1-IMAGE:8639389.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGCGTCTGAGAGGT
                                                  Xl3.1-CHK-1012691760                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCxxxTxxCGTCTG
  5   1   2       bld Skin                            IMAGE:8643818.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGG
  5   1   2      skin DMZ       in                         xl245e10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCANAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCANAGGTGGGATGCNAATATTTGTCAGACCTTAACTGGTAAACAATTACNCTTGNANTTGANCCNGTGACNCNNTGNANACGTNAANCAANNTCCAGACNANNANG
  5   1   2       bld Tbd3                            IMAGE:3549742.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAATTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCTTTTTATAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAAATTGATCTTTGCAGGAAAG
  5   1   2      skin Thy                             IMAGE:8547680.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGTTTTATTGGGGGGATCAAAAAGATTCGAATTCGTCCCATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATACAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAATGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAGATGGCAGACCCTGTCTGACTACATATTCAGAAAGAG
  5   1   2       add Ga18      in                      xlk146n08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGNCACTATTGAGAATGTAAAGNCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGNAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGNAAAACAATTACTCTTGAAGNTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACANAGATTGATCTTTGCAGGCAAGCAGNTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGNCCTNCGTCTCAGAGNNGGGATGCAAATATNNNNCAAGACCTTAACTGGNAAAACAATTACTCTNGAAGNGAACCAAGNGA
  5   1   2       bld Ga15      in                       XL440o13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATNCCAAGACAAAGAAGGCATTCCCCCTGACCCAGCCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCCTGTCTGACTACCAATATTCNNAAAGAGTCCACCCTTGCNCTTAGTTCCTTCCTCTGANANGGNGGGAATGCACATATTT
  5   1   2       add Thy       out                   IMAGE:8550641.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAATCAGATACACGAGAAATTCGCATCGAATTCGTCCCAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAGACATTACTCTAGAAGTTGACCAGTGACACCATGAGATGTAGGCAAATCAGACAAGAGCATCCCCTGATCACGAGATGATTTTGCTGGACACTGAGATGCGCACTCTTCGATCACATCCAAAGTCACTGACTTAGTTCTTCGCTCCGGTGGGATGCGAATTTGTCGGCCTTTCCTG
  5   1   2      seed Lmb2                            IMAGE:8639389.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAAATCCAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAANG
  5   1   2       add Ga12      in                         XL156i09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAATCNAGACAAGGAAGGCATTCCCCCTGATAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGNACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCANAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGNAAAACAATTACTCTTGGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATNCAAGACCAAAGAANGNATTNCCCCTGACCANCANAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGNCGNAAACCCCTGGTCTGACTTCCATATTCAAAAAGANTCCAACCTTGCACTTANNTTCTTTCGTCTGGAAAGGGGGGATGCAAAAATTTG
  5   1   2      skin Bone      in                    IMAGE:8740942.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAAGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGACCCTGTCTGACTACATATTCAGAAAGAGTCAACCTTGCACTAGTCTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAACACTGACGGGAGACATTACTCTAGAGGTGGACAGTGACTCATGAGATGTAGGCAAAATTCAGACAGATGCATTCCCCTGATCCACACGAGAAGAATTGAGT
  5   1   2      skin Lmb1      in                    IMAGE:8532103.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTANCATATT
  5   1   2       bld Int2                            IMAGE:8527826.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTTGATTTTGCTGGNNTAGCACTAGAAGATGGCAGAACCCTGTCTGACTACATATTCAGAAGAGTCAACCTGCACTTGGTCTCGTCTGAGAGTGGGAGCGNAATTGTGAAACCTGACGGAAGACATACTCTGAGTGAACAGTGACCATGAGATGTAGGCAAATCAGA
  5   1   2       bld Tad1      out                   IMAGE:6878423.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGNTAAAGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTTGCACTTAGTTCCTTCGTCTGAAAAGGTGGGGATTGCAAATATTTTGTTGAAAAACACTTGACCGGGGAAAGACAATTTACTCCTAGAAAGTT
  5   1   2      skin Sp1       in                    IMAGE:4174309.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGGAAGAGGTAACCTTGCACTTAGTTCTT
  5   1   2       bld Te2       in                    IMAGE:7207447.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAACACTGACCGGNAAGACATACTCTAGAGTTGAACCAGTGACACATGAGAATGTAGGCAAATNCAGACAGAAGGCATCCCTGATCACAAATGATTTGCTGGACACTGAGATGCCATCTCGATCACTCAA
  5   1   2       dbl                               Xl3.1-XL445h08ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTTGCACTTTGTTTCAATAAAGCTATTGCATTCCAAAAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012685115                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTTGCACTTTGTTTCAATAAAGCTATTGCATTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   0       add Ga18      in                      xlk158i06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCATNCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGNANNNNCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGNAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGNAANNAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGNCAACCTTGCACTTAGNNCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGANAACACTGACCGGNAAGACAATTACTCTNGAAGNTGAACCAAGNGACANCATTGAGAATGNTAANGNCAAAAATCCAAGACAAAGAAGGCATTCCCCCNGANCAACAGAGATTGANTTTTNCTGGNNAGNAGCTGGNAGANGNNCNCNCTCTTTCTGANNNCNACNTTCAAAAAGAGNCCA
  5   1   1       add Ga15      in                       XL479m19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAACTGACAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCCAAGACAAAGAAAGCCATTCCCCCCTGATCAACCAGAGATTCATTTTT
  5   1   2       bld Ga15      in                       XL402b07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGCTCCGAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCCAAGACCAAAGAAGGGCATTCCCCCCTGATCAACCAGAGATTGATTTTTGCTGG
  5   1   1       add Ga18      in                       xlk68k09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGNGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGNAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAANNNACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTNCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACNGGGAAGACAATTACTCTAGAANNNAANCAAGTNACACCATTNAGAATGTTAAGGCAAAAATCCNAGANAAAGNAGNNATTCCCCCTGATCAACAGAGATTGATTTTTGCTG
  5   1   2       add Ga18      in                      xlk160d17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTNAGNGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGNAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAANGTTAAGNCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGANTGATTTTTGCTGGGAAGNAGCTGGAAGANGGCCGCACTCTTTCTGANTACAACATTCAAAAAGAGTCCANCTTGCACTTNGNTCTTCGNCTCAGAGGNGGGATNCAGATATTNTCAAGACCTTNACTGGNNAGACCATTACTCNTGAANNNAACCAAGNNACACCNTTGAGAATNTAAAGGCAAAATCNAGG
  5   1   2       bld DMZ       in                         xl250l06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCGATTCGGGGCAAACTGGTATTCACTCAATCCATGGGCAAACTGTATTCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACNACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGNATGCAAATATTNGTCAAGACCTTAACTGGGAAGACNATTACTCTNGA
  5   1   2       bld DMZ       in                         xl250h06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCGATTCGGGGCAAACTGTATTCACTCAATCCATGGGCAAACTGTATTCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGANGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACNATACTCTTGAAGTNGAACNA
  5   1   2       bld DMZ       in                         xl327n04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGANAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACNACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAAAGGTGGGATGCAGATATTTGTCAGACCTTAACTGGGAAGACATNACTCT
  3   1   0       add Ga18      in                      xlk126j02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACNCTNCTGACTNNNCNTTCAAAAGNATCNNCTNCACTTAGTTNTTCNTCTNAGAGNTGGGATGCAGATATTTGTCAAGNCCTTAACTGNNAAACAATTACTCTTGAAGTTGAACCNAAGTGACACANTTGAAAACGTAAAAGCAAAANTNCAAGACAAAGAAGNNATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCANCTANNAGATGGCAGANNCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGANCCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGANAATCCTTTT
  5   1   2       bld Ga15                               XL424b19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTTCACCTTGCACTTAGTTCTTCGTCTCANAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCCATTGAGAATGTAAAGGCAAAAATCCAGGGATAAGGAAGGCATTCCCCCCGGACCAGCCANAGANTTGATATTTTGCTGG
  3   1   2       add Ga18      in                      xlk158i06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CNTCNNNNANNTGGGATGCAGANNNTTNNCNANGNCCTNAACTGGGNAAGNNCNTTACTCTTGAAGTTGANNCAAGTGANNCTATTGAGAATGTCAAGNCTAAANNCCAGGATAAGGNAGGNNTTCCTCCTGNNCAACAAAGATNGATCTTTGCANNNAAGCAGCTGNNAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTANCTGGTAAAACAATTACTCTTGAAGTTGANCCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACNCTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCNCCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACANNCCTTTTnnnnnnnnnCNNCATTACTT
  5   1   2       add Ga18      in                       xlk68o18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCGTCTCAGAGGTGGNATGNAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTANNNNCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTNNGNNNCTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGNGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGNTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGANCAANAGAGANTGATTTTTTGCTGGGAAGNAGNTGGANNNNGGCCGCACTCTTTCTGATTNCNACATTCANAAAGAGTCCANCNTTGCACTTAGNC
  3   1   2       bld Ga18      in                      xlk146n08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCTNNNAGNTGGGATGNAGATNTNNTCANNNCCTTANCTGGTAANACANTTACTCNTNNAGTNGANNCAAGTGACNCTATTGAGAATGTNNNNGCTAAAATCCANNNTANNNNAGGNNNNCTCCTGNNCAACANAGATTGATCTTTGCAGGNAAGCAGCTGNNAGATGGCCGCACTCTCTCTGNCTACAATATTCAGAAAGAATCCNCTCTGCATTTGNTCCTTCGTCTNAGAGGTGGGATGCANATATTTGTCAAGNCCTTANCTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCNCCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACANNCCTTTT
  3   1   2       bld Ga18 5g3  in                       xlk71p23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GNGGGATnnnnnnnnTTTNTCANGNNCNNTNACTGGGAAGNNCNNTTNCTCTNGAAGTTGNANNCCAAGNNNNCTNTNNAGAATNTNNAAGGCTNAANTCCNNGNATAANNAAGGNNNTCCNNCCTGANCANNAAAGATTGATNNTTGCAGGCAAGCAGCTNGAAGATGGNCGCACTCTNTCNGACTNNNNNATTCAGAAAGAATCCNCTCTGCNTTTGGTNCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGNNNNTNACTGGNAANACANTTACTCTNGAAGTTGNNNCNAGTGACACAATTGAAANCGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCNGACTACAATATTCAGAAAGAGTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACNCTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACANNCCTTTT
  3   1   2       bld Ga18 5g3  out                     xlk158p11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TNAGAGNNNGGATGCANATATTTNTCANGNCCTTNACTGGGAAGACCATTNCTCNTGANGTTGAGCCAAGTGACNCTATTGAGAATGTNNAGGCTAAANNCCANGATAANNNANGNNTTCCNCCTGACCAACANAGATTGATCTTTGCNNGCAAGCAGCTGGNAGATGGCNNNACTCTCTCTGNCTACAATATTCAGAAAGAATCCNCTCTGCANTTGNTNCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGNCCTTAACTGGNAAGACAATTACTCTTGAAGTTGNNCAAGTGACACAATTGANAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACNCTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAANCCTTTTnnnnnnnnnTNCATTACTTNC
  3   1   1       add Ga18 5g3  out                     xlk159m05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TNAGAGGTNGGATGCAGANNTTTNTNNAGNCCTNNNCTGGNAANANATTACTCTTNNAGTTGAGCCAAGTGANNCNATTNNGAATGTNANNGCNAAATCCANGANNNGGAANGAATTCCNNCCTGNCCAACANAGATTGATCTTTNNNNNCAAGCAGCTGGAAGATGGNNNNNCTCTCTCNGACTANAANATTCAGAAAGNATCCNCTCTGCNNNNNNTCCTTCGTCTCAGAGGTGGGATGCANATATTNGNNAAGNCCTTAACTGGNAANACAATTACTCTTGAAGTTGANCCAAGTGACACAATTGANAACGTAAAAGCAAAANTCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCANCTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACNCTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCNCCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACANNCCTTTTANNNNCNNNCTNNNTTACTT
  5   1   2       add Brn1                            IMAGE:7018855.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCAGATTGCAGATATTTGTCAAGACCTTTTCCGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCCTTGCACTTAGTTCTTCGTTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGGATAAAGAAAGCATTTCCCCCTGACCAGCAGAAGATTGATATTTTGCTGGCCAAGCAAGCTGGAAAGATGGGCCGCACCTCTCTTCTGAATTAAA
  3   1   2       add Ga18 5g3  in                       xlk75b10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGTGGCATGCANANNNTNGTNAANNCNNNNNCTGGGANNACNTTACNCTGAAGTNNNNCCNAGTGACACAATTGNAAATGTAAANGCAAANTCCAAGACAAANNNAGGNNTNCNNCTGANCAGCAGAGATTGATNTTNGCTGGTAAGCAGCNGGNAGATGGCNNNANNNTTTCNGACTACAACATTCAAAAAGAATCCNCCTTGNNCNNAGTTCTTCGTCTCAGAGGTGGGATGCAGATNTTTGTCAAGNCCNTAACTGGTAANACAATTACTCTTGAAGTTGANCCAAGTGACACAATTGAAAANGTAAAAGCAAAANTCCAAGACAAAGAAGGNATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAANACNCTGACCGGGAAGACAATTACTCTAGAAGTTGANCCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCNCCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAANCCTTTTNNCNNCNNNCTNCNTTACTTNC
  5   1   2       bld DMZ       in                         xl226o09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGANAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACNACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCANAGGTGGGATGCAGATATTTGTCAAGACCTNAACTGGGAAGACCATACTCTTGAAGT
  5   1   2       bld Ga15      out                      XL451m17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGGCCGCACTCTCTCCTGACTACCAACATTCCAGAAAGNAATCCAC
  5   1   1       add Ga18      in                      xlk126j02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGNGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTNAGNNCTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGNAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGNTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCNNAGACAAAGAAGGCATTCCCCCTNATCAACAGAGANTGANTTTTNC
  3   1   2       bld Ga18 5g3  in                       xlk71g09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TNNNCAAGNCNNNNNCTGGGAAGNCCNNNCNCTTGAAGTTGANCCAAGNGACNCNATTGAGAATGTCAAGGCTAAANNCCNNGATNNNGGAANGGAATNNNNCNTGACNAACAAAGATTGNTCTTTGCAGGCAAGCAGCTGGAAGATGNNNNNNCTCTCTCTGACTACAATATTCAGAAAGANTCNNCTCTGCATTTGGTCCTNCGTCTNAGAGGTNGGATGCAAATATTTGTNAAGNCCTTAACTGGNAANNNNATTACTCTTGAAGTNGNNNCAAGTGACACAATTGANAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAANACNCTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACANNCCTTTTNNNNNCNNTCNNNNTTACTT
  3   1   2       bld Ga18 5g3  in                       xlk73p03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ANNTTGTCAAGNCCNNACTGGGNAGNCCATNNCTCTTGAAGTTGANCNANTGANNTATTGAGAATNNNANGNCTAAAATCCAGGATAAGGAAGGANTNCNNCTGNCCAACANAGATTGATCTTTGNNNGNNAAGCAGCTGGAAGATGGCNNNCTCTCTCTGNNNACAATATTCAGAAAGNATCCACTCTGCNNTTGGTNCNTCNTCTNAGAGGTGGGATGCAAATATTTGTNAAGACCNTNNCTGGNAANACAATTACTCTTGAAGTTGNACCAAGTGACACAATTGNNANCGTAAAAGCAAAAATCCAAGACAAAGNAGGCATNNCCCCTGNCCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAANNCNCTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACANNCCTTTTNNCnnnnnnnnCNTTACTT
  3   1   2       bld Ga18      in                      xlk145d15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CNNNGCNTNCNAATTACTCTTGAAGTTGAGCCAAGTGACNCTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGNAAGGAATTCCTCCTGNCCAACAAAGATTGATCTTTGCANNNAAGCAGCTGGAAGATGNNNGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGNTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGNCCTTAACTGGTAANACAATTACTCTTGAAGTTGANCCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACANNCCTTTTNNNNNCNNNCNNNATTNCTTNC
  5   1   2       bld DMZ       in                         xl253f06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTNGAACCAAGTGACACCATTGAGANTGTAAGGCAAAAATCCAGGATAAGGANGCATTCCCCTGACNGCAAGATTGATATTGCTGGCAGCAGCTG
  5   1   2       bld DMZ       in                         xl261k14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAGGCAAAAATCCAGGATA
  5   1   2       add Ga18      in                      xlk145d15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGNAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGNGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAANNAGCTGGAAGANGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTANNCTTCGTCTCAGAGGTGGNNTGNAGATATTTGTCAAGACCTTAACTGGNAAGACCATTACTCTTGAAGTTGAACCAAGNGACACCATTGAGAATNNAAAGGCAAAAATCCAGGATAAGGGAAGGNATTCCCCCTGA
  3   1   2       bld Te2       in                    IMAGE:7208221.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGGGCCAAGGTAACCATTATTTGGGAATGTTCAAGGGCAAAAATCCCGGGAAAAGGGAAGAAATCCTCCTTGACCAACAAAGGATGATTCTTGGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTTGCACTAGTTCAATAAAAGCCCA
  5   1   2       bld Ga15      in                       XL462k21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGGATAAGGAAGGCATTCCCCCTGGACCCAGCAGAGATTGATATTTGCCTGGCAAGCAGCTTGGAAGAATGGCCGC
  3   1   2       add Ga18 5g3  in                      xlk144c19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAAGNNGNACCNAGTGACACNATTGANAATGTAAAANCAAAANTCNAGACAAAGNAGGCATTCCNNCCTGATCAGCAGAGATTGATTTNNCTGGTNNGCAGCTGGAAGATGNCCNNACTCTNTCNGACTACAACATTCAAAAAGANTCCACCTTGCACTNAGTTCNTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGNCCTTAACTGGTAANACANTTACTCTTGAAGTTGANCCAAGTGACACAATTGAAAACGTAAAAGCAAAANTCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGANCCCTGTCTGACTACAATATTCAGAAAGAGTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACNCTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACANNCCTTTTNNNNNCNNNCTNCATTACTT
  3   1   2       bld Lmb1      in                    IMAGE:8532103.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTGGAGAAGGACCATACTCTGAAAGTGAGCAGTGACAGTATGAGAGTTCCAGCTAATCCAGATAGGAGGAATCTCTGACACAAAGATGATCTTGCAGCCAAGCAGCTGAAGATGCCGCACTCTCTCTGACTACAATATCAGAAAGAATCCACTCTGCATTGGTCGTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACATTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTGTGCACTTTTTCAAAAAG
  3   1   2       bld Ga18 5g3  out                      xlk66m12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGTTGANCCAAGTGACACAATTGAAAANGTAAAAGNAANNNNNNAAGACAAAGNAGGCATTCCNCCTGNTCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTNCNGACTNNNACATTNAAAAAGAATCCNCCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGNAGATATTTGTCAAGNNCTTNACTGGNAAGACAATTACTCTTGAAGTTGANCCAAGTGACACAATTGAAANNGTAAAAGCAAAAATCCNAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCANCTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCANNCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAANCCTTTTA
  3   1   2       bld Ga18 5g3  out                     xlk147e15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTNNNCAAGTGACANNNTTGAAAATGTNNAAGCAAAAATCCAAGACAAAGAANGNNTTCCNCCNTGATCANNANNGATTGATTTTNGCTNNNANGCAGCTGGAAGATGNCCGCACTCTTTCNGNCTACNACATTCAAAANGAATCCNCCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGNNCNNNACTGGNAANACAATTACTCTTGAAGTTGANNCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCNAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACANNCCTTTTA
  3   1   2       add Ga18 5g3  in                      xlk148h17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CNAAGTGACACAATTGAAAATGTAAANNCNAAAATCCAAGACAAAGAAGGCNTTNCCNCCTGATCANCANAGATTGNNTTTNGCTNGTAAGCAGCTGNAAGATGGNCGNNCTCTTNCTGACTACAACATTCAAAAAANNATCCNNCTTGCNCTTAGTTCTTCGTCTNAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACNGGTAANACAATTACTCTTGAAGTTGNNCAAGTGACACAATTGAAANNGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGNAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACNCTGACCGGGAAGACAATTACTCTAGAAGTTGANCCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCNCCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTNNNNNCNNNCNNNNTTNCTT
  3   1   1       add Ga18      in                       xlk68k09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GNNACACTATTGAGAATGTNAAGGCTNNNNNCCNNNANAAGGAAGGAATTNCTCCTNNCNNNCNAGNNTGNTCTTNGCANGCANGCAGCTGGAAGATGNCCNNNCTCTCTCTGNCTACAATATTCAGAAAAGAATCCACTCTGCNTNTGGNNCTTCNTNTNAGAGGTGGGATGCAANTNTTTGTCAAGACCTTAACTGGTAAAACAATTACTCTNGAAGTTGANCCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCANCTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACNCTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGANNNCCTTTTNNCnnnnnnnnCATTACTTNC
  3   1   2       bld Ga18      in                       xlk74k04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTGNNNCNATTNAGATGTNNNGGCNNAANTCCNNGANAAGGNAGGANTTCCNCCTGACNNNCANAGATTGATNNTTGCAGNNANGCAGCTGGAAGATGGCCNNACTCTCTCTGACTACNATATTCAGAAAGANTCCACTCTGCNTTTGNTCCTTCGTCTCAGAGGTGGGATGCANATATTTGTCAAGNCCTTAACTGGTAANACAATTACTCTTGAAGTTGANNCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACNCTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACANNCCTTTTNNNNNCNNTCTNNATTACTT
  3   1   2       bld Eye1      in                    IMAGE:6957326.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATTCAAAGGCTAAAATTCCCGGGTTAAGGGAGGGAATTTCTTCCTGGGCCCAACCAGGATTGATCTTGGCAGGGCAAGCAGCTGGAAGATTGGCGGCCACTCTTTTTTGATTACATTATTCCAGAAAGGAATCCACTCGGCATTTGTCTTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTTCACTTGTTC
  3   1   2       bld Te2       out                   IMAGE:7208662.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAATTTTAAAGGGTAAAAATTCCAGGATAAAGGAAAGGAATTTCCTCCCTGACCCAAAAAAGATTGATTTTTGCAGGCAGGCAGCTGGAAAGATGGCCGCACTCTTTCTGACTACAATATTCAGAAGGAATCCACTCTGCATTGGTTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACGGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTTATGCATCTGCTCTGCATTACTTGCTTGTTGCACTATGTTCAATAAAAGGC
  3   1   2       bld Bone      in                    IMAGE:8740942.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAAGTGAACACTATGAAGAAATGTTCAAGGCTAAATCCAGATAAGATGATTCTTCTGACACCAAGATGATCTTGCAGCAAGCAGCTGAGGATGCGCACTCTCTCTGACTACAAATATCAGAAAAGAATCACTCTGCATTTGGTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCATGCAATTTA
  5   1   2       add Ga18      in                        xlk2o12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGTAAGNGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTNANNNCTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGNAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGNGGGATNNAGATATTTGTCAAGANCTTAACTGGNAAGANCATTACTCTTGAAGTTGAACCAAGNGACACCATTGAGAATGTAAAGNCAAAAANCCAGGATAAGGAAGNNATTCCCCCTGANCAGCAGAGATGATATTTNCTGGCAANNAGCTNGNAGA
  5   1   2       bld DMZ       in                         xl276h01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAATGTCAAGGCTAAAATCCAGGATAAGGAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGANAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCANAGATTGATATTTGCTGGCAAGCAGCTGGAANATGGCCGCACTCTCTCTGACTACAACATTCANAAGAATCC
  3   1   2       bld Eye1                            IMAGE:6948370.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAAGGGTTAAAAATCCAGGATTAAGGAAGGAAATCCTTCCTGACCAACAAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCTTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTG
  3   1   2       bld Ga18      in                       xlk67k04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AANGTAAANGCAAAAATCCAAGACAAAGANNGCNNTCNTCCTGATCAGNAGAGATTGATTTTTGCNGGTAAGCAGCTGGAAGATGGCNNNACTCTTTCTGACTACAACATTCAAAAAGANTNNNCNTTGCNCTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGNCCTTAACTGGTAANNCANTTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACNCTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTNNNNNCNNTCTNCATTACTT
  3   1   2       bld Ga18      in                      xlk160d17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ANNAAAATCCNAAGNNNAANNNAGNNNTNCNTCCCTGATCNGCANNGNNTTGATTTTGCTGGTAAGCAGCTNNAAGATGNNCGNACTCNTCTGACTNNACATTCAAANANNATCCNCCTTGCACTNAGTTCTTCGTCTCAGAGGTGGATGCAGATATTTGTCAAGNCCTTANCTNGTAANANANTTACTCTTGANGTTGANCCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCCTGACCAGCAGAGATTGATTTTNGCTNGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCANNCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAANCCTTTT
  3   1   2       bld Te2  5g3  in                    IMAGE:7390961.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTATTGTCGTGACGATCAGCTACGAGCTCTTAGTGCATGCTATGGATCAGTAATCAGTAGAGATTCTCTGCACAGATGATTGCAGCAGAGCTGAGATGCGCATTCTCGATACATATCAGAAGATCACTTGCATTGTCTTCGTTCAGAGTGGATGCAATATTGTCAGACNTTACTGTAAAACATTACTCTGAAGTTGAACCAAGTGACACAATGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTGCACTTGTCAAAAGATAA
  3   1   2       bld Te2  5g3  out                   IMAGE:7391168.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAACTAGCCTCTTTGTTAGGGAATCACTACGAGCTCTTATGACAGCTTGGATCAGTAACAGTAGAGATCTCTGCACAGATATCTCAGCACAGTGAGATGCCCATCTTCGATACATATCGAAAGATCACTTGCATTGTCCTCGTTCAGAGTGGATGCAATATTGTCAGACCTTACTGTAAACAATACTCTGAAGTGAACCAAGGACACAATGAAAACGAAAAGCAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTTATGCATCTGCTCTGCATTACTTGCTTGTGCACTTGTCATAAGATAATTTNNCCGCAG
  3   1   2       add Ga15 5x3  out                      XL497h15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGGAAGGGCATTCCCTCCAGACCAAACAAAGGGTTGATTTTTTGCTGGCAAACAGCTGGAAGATGGTTCGAACCCTATCAGACTATAACATTCAAAAGGAATCCACTNTGCACTTAGTTCTCCGTCTGAGAGGTGGAATGCAAATATTTGTCAAGACCTTAACTGGGAAGACAATTACCCTTGAGGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTGGAAGATGGCAGAACACTGTCTGACTACAATATTCAGAAGGAATCCACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACTCTAACAGGGAAGACAATTACTCTTGAGGTTGAGCCTAGCGATACTATTGAGAATGTCAAGGCCAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAACAAAGATTGATCTTTGCTGGTAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTCCGTCTGAGAGGTGGAATGCAAATATTTGTCAAGACCTTAACTGGGAAGACAATTACCCTTGAGGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAGGATAAGGAAGGAATCCCTCCTGACCAACAGAGATTGATCTTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATACAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAGGACAATCTGTTATGCATCTGCTCTGCATTACTTGCTTGTGCACT
  3   1   2       bld DMZ       in                         xl226o09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATCCNGNTAAGNAGGANTNCTCCTGNCNACAAAGANTGATNTTGCAGGCCAGCAGCTGGAAGATGNCGCACTCTNTCTGACTNCATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTNTGANTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTNTTNGTNTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTGCTGTG
  3   1   2       bld Ga12 5x3  out                        XL200b10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAAGGAATTCCTCCNGNCCCAACCAAAGATTGANTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTTTTTTTGACTACAATTTCAGAAAGAATCCACTNTGCATTTGTCTTTNGTCTCAGAGGTGGGATGCAAATATTTGTCAAGCCCTTAAGTGGTTAAANCAATTACTNCTTGAAGTTGACCCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTTGCACTT
  3   1   2       bld Te2  5g3  in                    IMAGE:7389939.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGCTACGAGCTATTGATGGCAGCTTGGAGTCAGTAATCAGTAGAGNATCTCTGCCACAGATGTCTGCAGCAGCAGCTGAGATGCGCATCTTCGATACATATCAGAAGATCACTTGCANTGTCTTCGTTCAGAGTGGATGCAATATTGTCAGACCTAACTGGTAAAACAATACTCTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATACTTGCTTGTGCACTTGTCAAAAGATCCCC
  5   1   2       bld Gas8      in                    IMAGE:3517715.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAGGAATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTTGGAAGACCATTACTCCTGAAGTTGACCAAGTGACACCATTGAGGAATGTAAAGGCAAAATCCAGGAATAGGAAAGGATTCCCC
  3   1   2       add Te2  5g3  in                    IMAGE:7389881.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCATTCACTATGAGCTCTTAGTGCCAGCTTGGAGTCAGTAATCAGTAGGAGATCTCTGCACAAGATATTGCAGCACAGTGAGAGCGCATCTTCGATACATATCAGAGAATCACTTGCATTGTCTTCGTTCAGAGTGGATGCAATATTGTCAAGCCTACTGGTAAGACATTACTCTGAAGTGAACCAAGTGACACAATGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATCCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTTTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTGCTTGTGCACTGTACAAAGATT
  3   1   2       chi Ga15      in                       XL470i16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATCAGNAGAGAGTTNGTTTTGGGTNGGTAAGCAGNTGGAAGATGGNCCGCNCTTCTTTNCTGANTNACAACATTNAANAANGAATCCACNTTGCCNCTTTAGTTCTTTCGTCTNCNGAGGNGGGANGCAGATATTTTGTCAAGACCTTNACTGGTAAAACAATTACTCTTGAAGTNGAACCAAGTGACACAATTGANAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGNCCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACT
  3   1   2       bld DMZ  5g3  in                         xl329m02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGNATTCTCCTGACCAACNAAGANTGATNTTTGCAGGCNAGCAGCTGGAAGATGGCCGCACTCTNTCNGANTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTNTCAGAGGTGGGATGCAAATATTTGTCAAGACNTTAACTGGTAANACAATTACTCTTGAAGTTGANCCAAGTGACACAATTGANAANGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATACTGCTGTGC
  5   1   2       bld Ga15      in                       XL457j09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATTCCTCCTGACCAACAAAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGCGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGG
  5   1   0       add Ga18      in                       xlk74k04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGNGCTGGAAGATGGCAGAACCCTGTCAGACTACAACATTCAGAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACAGGGAAGACAATTACTCTTGAAGTTGAGCCAAGTGACACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGATCAACAGAGATTGATATTTGCTGGCAAACAATTGGAAGATGGAAGAACCCTGTCAGACTATAATATTCAGAAGGAATCTACTCTGCACTTGGTCCTTCGTCTCAGAGGTGGCATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACCCTTGAAGTTGAACCAAGTGACACAATTGAAAATGTAAAAGCAAAAATCCAAGACAAAGAAGGNATTCCTCCTGATCAGCAGAGATTGATTTTTGCTGGNAAGNAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGNGGGATGCAGATATTTGTCAAGACCTTNACTGGNAAGACCATTACTCTTGAAGNTGAGCCAAGTGACACTATTGAGAATGTCANGGCTAANATCCAGGATAAGG
  3   1   2       bld Ga18      in                       xlk68o18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACTGATCAGCAGAGATTGATTTTTGCTGGTAAGCAGCTGGAANGATGNCNGCACTCTTNCNGNCTACNACATTCAAAAAGANTCCNNNTNNNNACTTAGTTCTTCGTCTNAGAGGTGGGATGNAGATATTTGTCAAGNNNNTAACNGGTAANACAATTACTCTNGAAGTTGNACCCAAGTGACNNAATNGAAAACGTAAAANGCAANNNNNAAGACAAAGNAGGCATTCCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGNAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCNCCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAANCCTTTT
  3   1   2       bld Brn1      in                    IMAGE:6956515.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCCCAACCAAGGTTTGATCTTTGCAGCCAAAGCAGCTGGAAAGATGCCCGCACTCTTTCTGATTACAATATTCAGAAAGAAATCCACTCTGCATTTGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTGCTTGTGCACC
  3   1   2       bld Ga12      in                         XL156i09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CANCAAAGATTNATNTTTGCAGNCAAGCAGTTGGAAAAATGNCCGCATNTNTTTTTGNNTTNCCNNATTTTTAGAAAAAGGATCTCTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACNTTAGCTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACNCAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAAATATCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCANCAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATTCCTTTTATGCAT
  3   1   2       bld Te2  5g3  in                    IMAGE:7390105.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGATGGCAGACATTGGATCAGTAATCAGTAGAGATTCTCTGCACAAGTGATTGCAGCAGCGCGAGATGCCGCCTCTTCGATACATATCAGAGGATCACTCTGCATTGTCTTCGTTCAGAGTGGGAGCAAAATTGTCAAGACTTAACTGTAAAACATTACTCTTGAAGTGAACCAAGGACACAATGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTGCACTTGTCAAAAGATAC
  3   1   2       bld Ga15      in                       XL494j08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATTGATNTTTGCNGGCCAAGCCAGGNTGGAAGGATGGNCCGCNNTCTTCTCTGAACTNCNAATATTCAGAAAGAATTCCACTNTGCATNTGGTCNTTCGTGTCAGAGGTGGGGATGCAAATATTTGTCAAGGNCCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCAT
  3   1   2       bld Ga15      in                       XL457j09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGATTGATTNTTTGCAGGGCAAGGCAGGCTGGAAGATGGCCGCACTCTNTCTNGACTACAATATTCAGGAAAGAATCCACTNGGGCATTTGGTCCTTCGTCTCAGAGGTGGGGATGCAAATATTTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACT
  3   1   2       bld Ga18      in                        xlk2o12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GNNCAGCANAGATNGATNTTNCTGGTAAGCAGCTGNNAGATNGNNGCACNNNNCTGACTANNACNTTCAAAAAGANNNCACCTTGCACTTAGTTCTTCNTCTNAGAGGTGGGATGCAGATATTTGTCAAGNCCTTAACTGGTAAAACAATTACTCTTGAAGTTGANCCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGNATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCANCTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGANCCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAANCCTTTT
  3   1   2       bld Tad2      out                   IMAGE:6876602.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACAAAGATTGATCTTGCCAGGCAAGCAGCAGGAAGATGCCCGCACTCTCTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATAGGA
  3   1   2       chi Te2  5x3  out                   IMAGE:7390776.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGATACATTCACCAGAACAGTAGACATAGCTATTAGTGCATATAGACAGTTTCGTCNGATNCCCGGATANTATCAGAAAGATCCACTCTGCATTGGTCTTCGTCTCAGAGTGGGATGCAAATATTGTCAAGACNTTACTGGTAAAACAATACTCTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTGCACTTGTCAAAAGATACCNC
  3   1   2       add Ga15                               XL425p02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATTGATTTTTTGCAGGCAAGCAGCTNGGANGATGGCCGCACTNTTTTCNGNCTACAATATTCAGAAAGGAATCCACTNTGCATTTGGTCCTTCGTTTCAGAGGTGGGGATGCAAATATTTGTCAAGACCTTAACNGGTAANACAATTACTCTTGAAGTTGANCCAAGTGACACAATTGAAAANGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGANTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACNCTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCAT
  3   1   2       bld Te2  5g3  in                    IMAGE:7391063.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCTGATGACAGCTATGGATCAGTAAACAGTAGAGATCTCTGCACAGTGATCTGCGCACAGTGAGATGCGATCTTTCGATACATTCCGAAGATCACTTGCATTGTCCTCGTTCAGAGTGGATGCAATATTGTCAGACTTACTGGTAAACATTACTCTGAAGTGAACAAGTGACACAATGAAAACGTAAAGCAAAATCCAAGACAAAGAAGCATTTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTGCACTTGTCAAAAAGATCCC
  3   1   2       bld Ga15      in                       XL479m19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTGATNTTTGGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTNTTTTGATTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTNGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACT
  3   1   2       bld Ga15      in                       XL492m24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTGCNGGGCAAGCAGGTTGGAAGATGGCCGGCACTCTTCTCTGACTNCAAATATTCAGGAANGAATCCACTTTGCATTTGGTCCTTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGNCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCNTTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTGCA
  3   1   0       chi Ga18      out                     xlk122n20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAGNTGATNNNNCNNGNAAGCAGNNGNAGANGNCNGNACTCNNNNTGNCTNNANNNTCAGAAAGNATCCNCNCTGCANNTTNNTNCTTCNTCTNAGAGNTGGGATGCANATNNTNTCAAGANCTTNACTGNNAANACANTTNCTCTTGAAGTTGNNCCAAGTGACACAATTGANANNGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGANCCCTGTCTGNCTACAATATTCAGAAAGANTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAANACNCTGACCGGGAAGACAATTACTCTAGAAGTTGANCCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAANCCTTTT
  3   1   2       bld Ga15 5g3  in                       XL452f16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGCAGNTGGAAGGANNGGCNGCACCTCTTTTNTGATTACAATATTNNAGGAAAGAATCCCCTTTTGCATTTGGTCCTTTCGTGTNCAGAGGTGGGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGANCCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCNTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTGCACT
  3   1   2       bld Spl  5g3  in                    IMAGE:8463644.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCAGAAAGAGAATCTCTGCACAAGTGATCTGCAGCAGAGTGGAGAAGCGCATCTTCTGATACATATCAGAAGATCACTTGCATTGTCNTTCGTTCAGAGTGGATGAAATATTGTCAAGACCTTAATGGTAAAACAATACTCTTGAAGTGAACCAAGTGACACAATGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTGCACTTGTCAAAAGATTA
  3   1   2       chi Ga15                               XL458j15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ANNGTTNAGGNCAANAATTCCAAGACAAAGAAGGNCATTCCCCCCTTGATCAACCGGAGAATTGATTTTTTGCTGGGAAGCAGNTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCT
  3   1   2       bld Ga15      in                       XL462k21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGCAGCTGGAAAGATGGNCCGCACTCTTTNTNGATTACAATATTCAGAAAGAATCCACTNTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTA
  3   1   0       chi Ga18      out                     xlk129o24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTNNAGNNAAGCAGCNGGNAGATGnnnnnAnnnnnnCTGACTANANATCAGAAAGATCCACTCTGNNNTTGGTCCTTCNTCTNAGAGGTGGGATGCNNTNNTGTCAAGNNCTTANCNGNNAAACANTTNCTCTTGAAGTTGNNCCAAGTGACACAATTGAAAACGTAAAAGCAAAAATNCAAGACAAAGAAGGNNTTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACNCTGACCGGGAAGACAATTACTCTAGAAGTTGANNCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTNCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACANTCCTTTT
  3   1   2       add Spl       out                   IMAGE:8463168.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGATCTCTGCACAAGATATCTGCAGCAGAGCTGAGATGCGCATCTTTTGATACATATCAGAAGATCACTCTGCTTGGTCTTCGTTCAGAGTGGATGCAATATTGTCAGACTTAACTGGTAAACAATACTCTGAAGTTGAACCAAGTGACACAATTGAAACGTAAAGCAAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATCTTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTGCTTGTGCACTTGTCAAAAGC
  3   1   2       bld DMZ  5g3  in                         xl322j17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGCTGGAAGATGGGCCGCACTCTTTNGGANTACANNTTCAGAAAGGATCCACTNTGCATTTGGTCCTTCGTNTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGANCCAAGTGACACAATTGANAANGTAAAAGCAAAAATCCAAGACAAAGAAGGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTGCTGTG
  3   1   2       bld DMZ       out                        xl321d14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGNTGGAAGATGGGCGCACTNTTTCNGATTNAATATTCAGAAAGAATCCNCTTTGCATTTGTCCTTNGTTTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATTCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGT
  3   1   2       bld DMZ       in                         xl336g06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGTGGAAGATNGCCGCACTTTTTNTGACTACAATATTCAGAAAGAATCCACTNTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTNGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGNTGAACCAAGTGACACAATTGANAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTGTGC
  3   1   2       bld DMZ       in                         xl327n04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGNTGGAAGATGGCCGCACTNTNTNTGANTACAATATTCAGAAAGATTCCACTNTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACNCCNTTGAGAATGTTAAGGCAAAAATCCAAGNCAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACNTGCNTGTGC
  3   1   2       bld DMZ       in                         xl261k14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTGGAAGATGGCCGCACTCTCTCTGANTACAATATTCAGAAAGAATTCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATACNTGCTGTGC
  3   1   2       bld Ga15      in                       XL402b07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAAGATTGGCNGCCACTTTTCTCTGNNTACAATATTCAGAAAGAATCCACTNTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATT
  3   1   2       bld Lmb1 5g3  in                    IMAGE:8533015.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAAGATGGCCGCACTCTCTCTGACTACAATATCAGAAAGAATCACTCTGCATTTGGTCATCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTTATGCATCTGCTCTGCATTACTGCTTGTGCACTTGTCAATAAAG
  3   1   2       chi Ga15                               XL459j15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGGAAGGGCATTTCCCCNNGGATCAAGCAGAGATTGGATTTTNTGCTGGGAAGCAGGNTGGANNGATGGNCCGCNCTNTTTGTGATTACANCATTNAAAAAGAGTCCACCTTGCACTTAGTTNTTCGTNTCAGAGGTGGGATGCAGATATTTGTCAAGACNTTATNTTGGGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGGTAAGCANCTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTGC
  3   1   2       bld Lmb1                            IMAGE:8532644.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGGCCGCACTCTCTCTGACTACAATATCAGAAAGAATCACTCTGCATTTGGTCGTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATACTTTTATGCATCTGCTCTGCATTACTGCTTGTGCACTTGTTCAAAAAG
  5   1   1       add Ga15      in                       XL420g12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGCACTCTTTCTGACTACNACATTCNAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCANAGATTGATTTTTGCTGGTAAGCANCTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCNNAAAGAGTCAACCTTGCACTTANTTCTTCGTCTGAGAGGNGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCANGAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAANATGGCCGCACTCTTTCTGATTACNACATTCGAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGNANAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGG
  3   1   2       add DMZ  5g3  out                        xl297l22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCACTCTTTCGGATTACAATNTTCAGAAGANTCCACTTTGCATTGGTCCTTCGTTTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGNAAGANCAATTACTCTTGAAGTTGANCCAAGTGACACAATTGAGAATGTAAAAGCNAAAATCCAAGACAAAGAAGGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTNGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACNTTGCACTTAGTTCTTCGTTTGAGAGGTGGGATGCAGATATTTGTGAAAACNCTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATACTGCTGTGC
  3   1   2       bld Te2  5g3  in                    IMAGE:7208491.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCACTCTTTCTGACTACAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTTATGCATCTGCTCTGCATTACTTGCTTGTTGCACTTTGTTCAATTAAAGCCTT
  3   1   2       bld Ga18      in                        xlk2g04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCTNTCTGACTNNNNATTCAGAAAGNNTCCNCTCTGCATTTGNTNCTTCNTCTNAGAGGTGGGATGCANATATTTGTNNAGACCNTNACTGGNNANACANTTACTCTTGAAGTTGNNCCAAGTGACACAATTGANNNNGTAAAAGCAAAAATCCAAGACAAAGAAGNNATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAANACNCTGACCGGGAAGACAATTACTCTAGAAGTTGANCCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACANNCCTTTT
  3   1   2       bld DMZ  5g3  in                         xl325g05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTCNGANTACAATATTCAGAANGAATCCACTTTGCATTGGTCNTTCGTNTCAGAGGTGGGATGCANATATTTGTCAAGACCTTAACTGGTAAGACAATTACTCTTGAAGTTGANCCCAAGTGACACAATTGAGAANGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACNCTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTGCTGTG
  3   1   2       bld DMZ       in                         xl253f06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCTGANTACAATATTCAGAAAGGATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCAT
  3   1   2       bld Ga15 5g3  in                       XL419j21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ANTACAATATTNCAGGAAAGAATCCACCTCTGCATTTGGTCNTTNCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTNACTGGTAAAACAATTACTCTTGAAGTTGANCCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGANTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCA
  3   1   2       bld DMZ  5g3  in                         xl306g07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCNGACTACAATATTCAGAANGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAANACAATTACTCTTGAAGTTGANCCAAGTGACACAATTGANAANGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCAT
  3   1   2       bld DMZ  5g3  in                         xl259e12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACAATATTCAGAAAGAATCCACTNTGCATTTGGTCCTTCGTNTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAANACAATTACTCTTGAAGTTGANCCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTGT
  3   1   2       bld DMZ  5g3  in                         xl338i14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTNTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAANCTGGTAANACAATTACTCTTGAAGTTGANCCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATACTGCTG
  5   1   2       add Te2  5x3  out                   IMAGE:7390826.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGAATTTGCTGGCAGCAGCTGGAAGATGGCGCCTCTCTCTGACTACACTTCAGAAGATCACCNTCACTGGTCTGCGTTGAGGTGGGATTNAGACATCTTTAGCTCTGCTCTGCATACTGCTGTGCACTGTTCATA
  3   1   2       bld DMZ  5g3  in                         xl259c13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATATTCAGAAAGAATCCACTCTGCATTTGGTCCTTCGTNTCAGAGGTGGGATGCAAATATTTGTCAAGACNTTNACTGGTAANACAATTACTCTTGAAGTTGANCCAAGTGACACAATTGAAAANGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATACTGCTGTGC
  3   1   2       bld Ga15 5g3  in                       XL475i04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCNGAAAGGANTCCACTCTGCATTTGGTCCTTCGTTTCAGAGGTGGGATGCAAATNTTTNTTCAANACNTTAGCTGGTAANACAATTACTCTTGAAGTTGAANCAAGTGACACAATTGAAAAGGTAAAAGCAAAAATNCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACT
  3   1   2       bld Ga15      in                       XL445h08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCNGGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGNGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACT
  3   1   2       bld DMZ  5g3  in                         xl325o14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAGAANGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATACTGCTG
  3   1   2       bld DMZ       in                         xl250h06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGAAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCAT
  5   1   2       bld Ov1       in                    IMAGE:5073745.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCACGCGTCCGCTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGG
  3   1   2       bld DMZ  5g3  in                         xl335o20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAAGAATCCACTTTGCATTNGGTCCTTCGTTTCAGAGGTGGGATGCAAATATTTGTCAAGACNTTAACTGGTAANACAATTACTCTTGAAGTTGANCCAAGTGACACAATTGANAANGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATACTGCTGTG
  5   1   2       bld Ga15      in                       XL445h08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGGTTGCACTTTGTTTCAATAAAGCTATTGCATTCCAA
  3   1   2       bld DMZ       in                         xl245e10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGAATCCACTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACNTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAANACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACNTGCTGTG
  5   1   2       bld Ga15      in                       XL409j16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACTCTGCATTTGGTCCTTCGGTCTCNGAGGTGGGATGCANATATTTGTCANGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGCTGACNCANTTGAAAACGTANAAGCAAAAATCCNAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTANTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAANATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTTGCACTTTGTTTCAATAAAGCTATTGCATTCC
  3   1   2       bld Te2       in                    IMAGE:7206982.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCCACTCTGCATTTGGTCNTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGATAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACAGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGTAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCTGGCAAGCAGCTGGAAGACGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTGCACTTTGTTCAATAAAA
  3   1   2       bld DMZ  5g3  in                         xl335m22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCACTTTGCATTNGGTTCTTCGTNTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAANACAATTACTCTTGAAGGTGANCCAAGTGACACAATTGANAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATACTGCTGTG
  3   1   2       bld Ga15      in                       XL409j16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCACTNTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACT
  3   1   2       bld Te2       in                    IMAGE:7207447.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCACTCTGCATTGGGTCNTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGAGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTGCACTTTGTTCAATAAAGG
  3   1   0       chi Ga15      in                       XL420g12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTTCTTNNTNCTCAGAAGGGGGGANNGCAGGATATTTNTTCAAGTCCTTNAAGNGNGTAANNCAATTTACTCTTGGAAGTNGANCCAAGNGGACACAATTGAAANNGGTAAAAGCAAAAATCCAAGGNCAAAGAAGGCATTCCCCCTGNCCAGCAGAGATTGATTTTTGCTGGTAAGCANNTAGAAGATGGCAGAACCCTGTCTGNCTACAATATTCAGAAAGAGTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGC
  3   1   2       bld Lmb1 5g3  in                    IMAGE:8533105.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATCACTCTGCATTTGGTCCTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACTTAACTGGTAAAACAATTACTCTTGAAGTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCATGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTTATGCATCTGCTCTGCATTACTTGCTTGTGCATTTTTT
  3   1   2       bld DMZ  5g3  in                         xl256o17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCTGCATTTGGTCCTTCGTCTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATACT
  3   1   2       add DMZ  5g3  out                        xl259m24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGCANTTGGTCNTTCGTTTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGNAAGACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGANAACGTAAAAGCAAAAATCCAAGACAAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGANTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTGCTGTG
  3   1   2       bld DMZ       in                         xl250l06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCATTTGGTCCTTNGTCTCAGAGGTGGGATGCAAATATTNGTCAAGACCTTAACTGGTAAANCAATTACTCTNGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCNAAAATNCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAANTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTNTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCANTTAGTTNTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATACT
  3   1   2       bld Ga18 5g3  in                        xlk1l07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTAGTNCTNCGTCTNAGAGNTGGGATGCAGATATTTGTNAAGNCCNNNACNGGTAAANACAATTNCTCTTGAAGTTGNNCCAAGTGACACAATTGNNAAACGTAAAANGCAAAAATCCAAGACAAAGAAGGCATTNCCCCTGACCAGCAGAGATTGATTTTNGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCANCCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACNCTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACNCCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACANNCCTTTT
  3   1   0       add Ga18      in                      xlk126l21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GNNCTTAGNNTNCNTNTNAGAGGTGGGATGCAGATNTTTGTNNAAGNCNNNNCTGNNAANACANTNACTCTTGAAGTTGANCCAAGTGACACAATTGAAAANGTAAAAGNAAAAATCCAAGACAAAGAAGNNATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCANCTAGAAGATGGCAGANCCCTGTCTGACTACAATATTCAGAAAGAGTCANNCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAANACNCTGACCGGGAAGACAATTACTCTAGAAGTTGANCCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACANNCCTTTT
  3   1   0       chi Ga15                               XL493j01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTNTCAGAGGTGGGGATGCAAATNTTNTNNNCAAGGCCCTTGATTGGTNGNANCAGNTTNCTCTGGAAGTTGAACCANAGNTGACACAATNGAATGCGTAAAAGCAAANAATCCNAGACANAGAAGGCATTCCCCTTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAANTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTNGTNTGAGAGGTGGGATGCAGATATTTGTGAAAACNCTGACCGGGAAGACAATTACTCTAGAAGTNGAACCAAGTGACNCCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTNTTNGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTGTGCACT
  3   1   2       bld Skin      out                   IMAGE:8641580.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGTCTTTGTTTCAGAGGTGGATGCCAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAGGTGACACAATGAAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATACCTGCTTGTGCACTTTTCNAANGCTCNNNNNNAAAAGAACGGGG
  3   1   2       bld DMZ  5g3  in                         xl325f08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCGTNTCAGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAANACAATTACTCTTGAAGTTGANCCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATACTGCTGTG
  3   1   2       bld Ga18 5g3  in                       xlk55i04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TNNTCNTCTNAGAGNNNGNATGCAANTATTTNNCAAGNCNNTANNTGGNAAACAATNNCTCTNGAAGTTGNNCCAAGTGACACAATTGAAANNGNAAAGCAAAANTCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTNNCTGGTAAGCANCTAGAAGATGGCAGNNNNCTGTCTGACTACAATATTCAGAAAGAGTCANCCTTGCACTTANTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACNCTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACANNCCTTTT
  3   1   2       add DMZ  5g3  in                         xl259c21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTCTAAGAGGTNGGATGCANATATTTGTNNAGACNNTNACTGGTNAGACAATTACTATNGAAGNTGATCCAAGTGACACAATTGAGAACGTNAANGCAANNNTCCAGGACAAAGAAGNCATTCCCCCTGGCCAGCAGAGATTGATNTTTGNTGGTANGCAGCTAGAAGATGGCAGAACCNTGTCTGANNANAANATTCAGAAAGAGTCNACNTTGCATTTAGTTGTTANTTTGAGAGGTGGNATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCNTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCATCTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCANTNCTCTNGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTNGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATACTGCTG
  3   1   2       bld Ga18      in                       xlk76c14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCAGAGGTGGGATGCAGATATTTGTCAAGNCCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAANCCTTTTANNNNNNNTCTNCNTTACTT
  3   1   2       bld Ga15      in                       XL435f18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGTGGGGATGCAGATATTTNTCANGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGANCCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAANTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTGCAC
  5   1   2       bld Te2N                            IMAGE:7766998.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAGGTGGGATGCAAATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTTGCACTTTGTTTCAATAAAGCTATTGCATTCCAA
  5   1   2       add Ga18      in                       xlk76c14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAGGTGGGNTGCAGATATTTGTCAAGACCTTAACTGGTAAAACAATTACTCTTGAAGTTGAACCANGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAANNNCTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGNCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGNAGCTGGAAGATGGCCGCACTCTCTCTNACTACAACATTCAGAAAGAATCCACCCTCCACNTGGNCCTGCGTTTGAGGNNNGGGNNNTTAAGACAATCCTTTTATGCATCTGCTCTGNATNNCTTGCNTNNTTNNACTTTGTTTCNNT
  5   1   2       bld Brn3                            IMAGE:8540141.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCCATCGTGNGNNNGAAGATCCATCGATATAAATTCGTCCTTACTCTTGAAGTTGAACCAAGTGACACAATTGAAAACGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTTGTTGCACTTTGTTTCAATAAAGCTTATGCATTCCTAANNaaaaaaaataaaaaTAACTCAATATTAATATGTCCGCAAGTATTCCTCTTCAAGTA
  3   1   2       bld Ga15                               XL511f16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCAAATATTTGTCAAGGNCCTTNANTTGGNAAGAACAAATTACTCTTGAAGTTGAACCAAGTGACACAATNGAAAANGTAAAAGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGTAAGCAACTAGAAGATGGCAGAACCCTGTCTGACTACAATATTCAGAAAGAGTCAACCTTGCACTTAGTTCTTCGTCTGAGAGGTGGGATGCAGATATTTGTGAAAACACTGACCGGGAAGACAATTACTCTAGAAGTTGAACCAAGTGACACCATTGAGAATGTTAAGGCAAAAATCCAAGACAAAGAAGGCATTCCCCCTGATCAACAGAGATTGATTTTTGCTGGGAAGCAGCTGGAAGATGGCCGCACTCTTTCTGATTACAACATTCAAAAAGAGTCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCTTAACTGGGAAGACCATTACTCTTGAAGTTGAACCAAGTGACACCATTGAGAATGTAAAGGCAAAAATCCAGGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATATTTGCTGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGACTACAACATTCAGAAAGAATCCACCCTCCACCTGGTCCTGCGTTTGAGGGGTGGGATTTAAGACAATCCTTTTATGCATCTGCTCTGCATTACTTGCTGTGCACT
  5   1   2       add Ga18      in                        xlk5a21ex.5p