Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk8d21ex.5                           8 END     2           0       25                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012837228 Xl3.1-xlk143o12ex.3.5 - 462 ESTs
                                                                       .....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-xlk143o12ex.3.5                GCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTACATTGGTACCTGCTGTGAAGAAGAGGCTGGCCCGGGTAGCAGGGAGCGCTCTCTGCACTATTGGAGTGTGTGTGGTGCAAAGTGTGGGTACAGAGCAACAACCCATGTACTGGGAATGTGAGCCAGAGAGCCAGAGACAAGTAGCATAGTAGTGCGCTGAGAAGGTGTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGACGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTTAGTTCCGATGATGTCGCTGTAGAGGAGAGTCGTTCAGAATACGTGGCACTACTAACAGCACCCAGCCATGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTAGATTCAACCTGCAGCGCTCAAATTTGCTCTTCTCGATCACTTATAAATGGATAGACAGACTTTCCCGAATCCGTTTCTCTGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGACCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGTTTACACTAAGTGACGTGGATGACAATCTGAACTTTATTCTTATGCTCAGAGGTCTACGTGGTGGAGAACGAGATTGGATTCCAATACTTGTGCAAATCTCTCATCAGAACCATGTGATACGGGAGATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTGGCCCAAGGTCAGCTAGAGATTTCAGTGCAGACAGAAGGGAGACGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAATGGAACTGTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGACACTGGAAACCTCGCCGAACAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGACTACCATGATGTGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTTCAATGTAGCGACAAAGGACTTCCCTTCCAGGAAGGTCAGGGGACAAATAACCCCTCTGCTCTGTTATACAGTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGTCTAGCTGGTCATGTCACCTCCCAACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCCACCTGCATTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTGTGTGAAGAAAAAAAAGAAATGAGAGAGGTGAAAAAACCAGAGAGAACTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCTGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATTTACACAGTGTCGGAGACAGGAGTGTACAGGAACTACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAATCAAGATGAAGATGAAAAAGTGAAATCAGACGAGACAAGGACTCCATGGAGTTTTTAGAGAGGAGAGCAACTCGGGCAATGGGACTGATTATCTAGGCTCACAAAAACATGTCCCAAGCTGAGACAACTGCCAGGACTGGATGGTCTGCACAATGTTTTGTTCCACTCTGATAACACTGCTACTGGATTTTACAGTATTTCCATTTGTTTAATTTGCTGCCTAAAGCAGTGGGATTCTGGAAGCAGCATTTGGAAGTAAAATACATTGCCACCTTGGATTCCCTTCAAACAATCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTCTGTAGAGTTTCGCAACAGGAGCACAGACACAGCATAGGCAGCTGTGCATATGTAGATATACTGACTAAACCTCTGTGGCTCTTCTACAGGACGGGAAGAAAAGTGCAAGAGACAGACAAAGACTACAGTGTTCTTGCTGGAAAGTCTGTATATATGTCTGCGTATGTGAGTGTGTGAACGCATGATTTTACTTTGGGGGTGTATGATCAGACATATATCAGTTCCTCTTGTCCAAGCACACACTTTTGGAAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTTTAATGATGGTCCGTATTTATTGAACTAAAATAAACTGAAGACATTTTCCCAAAAAAAAA
                                                  Xl3.1-CHK-1012721700                      CTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTxxxxxGGTACCTGCTGTGAAGAAGAGGCTGGCCCGGGTAGCAGGGAGCGCTCTCTGCACTATTGGAGTGTGTGTGGTGCAAAGTGTGGGTACAGAGCAACAACCCATGTACTGGGAATGTGAGCCAGAGAGCCAGAGACAAGTAGCATAGTAGTGCGCTGAGAAGGTGxxAAxGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGACGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTxAGTTCxGxxGxTGTxGxTGTAGAGGAGAGTCGTTCAGAATACGTGGCACTACTAACAGCACCCAGCCATGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTAGATTCAACCTGCAGCGCTCAAATTTGCTCTTCTCGATCACTTATAAATGGATAGACAGACTTTCCCGAATCCGTTTCTCTGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGACCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGTTTACACTAAGTGACGTGGATGACAATCTGAACTTTATTCTTATGCTCAGAGGTCTACGTGGTGGAGAACGAGATTGGATTCCAATACTTGTGCAAATCTCTCATCAGAACCATGTGATACGGGAGATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTxxxxxxAGxTxxGCTAGAGATTTCAGTGCAGACAGAAGGGAGACGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGACACTGGAxACxxxxCCxxxCAGGAAAACAAAGCGAAATATTTTGCATGAxxxxxGACTACCxTxxxxTGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTxxxCxTCAATGxAxxGxxxxAxxACTTCCxxxxxxGGAAGGxxAGxxxAxAxxxxAxxxxxCxxCTCTGTTATACAGTGxxxxCCAGATATGAGAxGxxCxxxxxxCCTCTAGxxxxxCTGGTCAxxTxxxCTCCCAxCxxxxCAGGACAGGTTCAGCAGGTCATGCxTxxxxTxxAxxGGATGAGCxxxxxxxxxTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTGTGTGAAGAAAAAAAAGAAATGAGAGAGGTGAAAAAACCAGAGAGAACTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCTGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCxxGxxxTTACACAGTGTCGGAGACAGGAGTGTACAGGAACTACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAATCAAGATGAAGATGAAAAAGTGAAATCAGACGAGACAAGGACTCCATGGAGTTTTTAGAGAGGAGAGCAACTCGGGCAATGGGACTGATTATCTAGGCTCACAAAAACATGTCCCAAGCTGAGACAACTGCCAGGACTGGATGGTCTGCACAATGTTTTGTTCCACTCTGATAACACTGCTACTGGATTTTACAGTATTTCCATTTGTTTAATTTxxxxCxTAAAGCAGTGGGATTCTGGAAGCAGCATTTGGAAGTAAAATACATTGCCACCTTGGATTCCCTTCAAACAATCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGxxxxxTCTGTAGAGTTTCGCAACAGGAGCACAGACACAGCATAGGCAGCTGTGCATATGTAGATATACTGAxxAxxxCTCTGTxGxxxxTCTACAGGACGGGAAGAAAAGTGCAAGAGACAGACAAAGACTACAGTGTTCTTGCTGGAAAGTCTGTATATATGTCTGCGTATGTGAGTGTGTGAACGCATGATTTTACTTTGGGGGTGTATGATCAGACATATATCAGTTCCTCTTGTCCAAGCACACACTTTTGGAAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTxTxATxxxxGxxCGTATTTATTGAACTAAAATAAACTGAAGACATTTTCCCAAA
                                                      consensus depths                    22    22    25    25    25    41    25    58    32    60    35    60    35    70    35    76    36    76    36    78    36    78    36    78    36    78    36    78    36    78    36    79    37    80    37    80    42    81    40    81    43    82    42    82    46    83    44    83    46    83    46    83    45    82    81    82    80    82    81    82    81    82    81    82    80    82    80    82    58    81    80    81    80    81    79    81    80    82    76    82    77    82    78    82    79    82    77    83    80    85    82    85    68    85    41    85    76    85    79    85    77    86    76    84    75    84    69    84    69    83    63    80    51    75    39    71    35    66    32    66    23    61    19    53    12    44    15    41    11    34     7    29     9    29     9    25     9    23     9    22     9    22     7    19     8    18     6    19     8    20     7    20    11    20    12    20    12    20    11    20    13    21    13    19    13    18    13    17    13    17    14    19    14    19    14    19    14    19    15    20    15    20    16    21    16    21    16    21    15    20    14    19    14    19    14    20    14    21    13    20    13    20    12    20    12    21    13    22    13    23    14    24    14    24    13    23    13    23    14    24    14    24    14    24    16    27    15    27    16    27    16    27    16    28    14    27    16    28    15    27    14    27    15    28    15    28    15    28    15    30    16    30    16    30    16    31    16    31    15    31    15    35    16    39    16    40    16    42    15    44    14    45    15    46    16    46    15    48    16    48    15    48    14    50    16    52    17    57    16    58    15    56    17    62    17    64    20    64    19    69    19    72    17    71    17    70    18    72    18    73    18    80    20    85    21    85    25    85    29    85    31    88    32    86    30    86    33    85    35    86    29    86    34    85    30    88    37    89    37    90    37    91    38    92    36    91    38    90    41    90    41    92    41    92    39    93    42    93    38    89    45    90    45    90    42    91    45    91    30    92    49    92    52    95    50    94    50    92    46    93    42    93    54    93    54    93    51    91    53    91    52    90    53    90    53    91    50    90    53    91    53    91    52    91    52    92    51    92    48    89    49    89    49    90    45    88    46    90    28    89    31    77    26    54    26    48    23    39    21    38    28    36    18    34    19    34    22    35    20    36    22    36    22    37    23    38    22    38    23    41    25    42    25    45    25    46    26    50    23    52    24    54    24    63    28    67    26    68    26    71    27    73    26    72    23    72    23    73    23    74    23    74    23    75    23    76    21    76    21    83    18    85    20    93    21    99    20   100    21   108    28   115    33   125    42   138    43   144    44   148    26   157    42   158    51   159    68   164    80   169    74   173    86   177    93   178    93   184    92   187    97   188    95   187    98   187    94   187    65   188    65   188    64   188    67   190    67   190    67   191    64   191   105   190   106   186   107   187   107   186   107   184   107   187   108   188   108   191   108   190   110   190   109   192   107   192    70   190    70   189    70   188    69   189    69   188    71   187    65   185   104   185   107   186   105   188   108   189   110   189   106   188   102   188   106   187   106   187   104   188   109   188   105   188   107   189   103   187   101   186   103   184   101   184    94   180    94   173    67   148    32    86    22    31    12    24     7    15
  5   1   2      en>5                              Xl3.1-xlk143o12ex.3                GCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTATCAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTCGCTCTTATCTTAGTTCCGATGATGTCGCTGTAGAGGAGAGTCGTTCAGAATACGTGGCACTACTAACAGCACCCAGCCATGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTAGATTCAACCTGCAGCGCTCAAATTTGCTCTTCTCGATCACTTATAAATGGATAGACAGACTTTCCCGAATCCGTTTCTCTGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGACCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGTTTACACTAAGTGACGTGGATGACAATCTGAACTTTATTCTTATGCTCAGAGGTCTACGTGGTGGAGAACGAGATTGGATTCCAATACTTGTGCAAATCTCTCATCAGAACCATGTGATACGGGAGATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTGGCCCAAGGTCAGCTAGAGATTTCAGTGCAGACAGAAGGGAGACGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAATGGAACTGTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGACACTGGAAACCTCGCCGAACAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGACTACCATGATGTGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTTCAATGTAGCGACAAAGGACTTCCCTTCCAGGAAGGTCAGGGGACAAATAACCCCTCTGCTCTGTTATACAGTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGTCTAGCTGGTCATGTCACCTCCCAACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCCACCTGCATTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTGTGTGAAGAAAAAAAAGAAATGAGAGAGGTGAAAAAACCAGAGAGAACTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCTGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATTTACACAGTGTCGGAGACAGGAGTGTACAGGAACTACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAATCAAGATGAAGATGAAAAAGTGAAATCAGACGAGACAAGGACTCCATGGAGTTTTTAGAGAGGAGAGCAACTCGGGCAATGGGACTGATTATCTAGGCTCACAAAAACATGTCCCAAGCTGAGACAACTGCCAGGACTGGATGGTCTGCACAATGTTTTGTTCCACTCTGATAACACTGCTACTGGATTTTACAGTATTTCCATTTGTTTAATTTGCTGCCTAAAGCAGTGGGATTCTGGAAGCAGCATTTGGAAGTAAAATACATTGCCACCTTGGATTCCCTTCAAACAATCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTCTGTAGAGTTTCGCAACAGGAGCACAGACACAGCATAGGCAGCTGTGCATATGTAGATATACTGACTAAACCTCTGTGGCTCTTCTACAGGACGGGAAGAAAAGTGCAAGAGACAGACAAAGACTACAGTGTTCTTGCTGGAAAGTCTGTATATATGTCTGCGTATGTGAGTGTGTGAACGCATGATTTTACTTTGGGGGTGTATGATCAGACATATATCAGTTCCTCTTGTCCAAGCACACACTTTTGGAAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTTTAATGATGGTCCGTATTTATTGAACTAAAATAAACTGAAGACATTTTCCCAAAAAAAAA
  5   1   2      en>5                            Xl3.1-IMAGE:5161617.5                                               AGAAGTGTCCCCTCCGGACATTGGTACCTGCTGTGAAGAAGAGGCTGGCCCGGGTAGCAGGGAGCGCTCTCTGCACTATTGGAGTGTGTGTGGTGCAAAGTGTGGGTACAGAGCAACAACCCATGTACTGGGAATGTGAGCCAGAGAGCCAGAGACAAGTAGCATAGTAGTGCGCTGAGAAGGTGGCAAAGTGACTGGCACAGGCAGACTGAAGGCTCATGGTCCATAGAAGAGTATAGTACAAAGCACAGACATTGTACGCTCACTATACGAGACAGAACGTTTGGAACCACAAAAATGCAGTGTCCCCCCATCCTACTTGTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCTTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCATGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGCGTACTATGCTATTGTGAGCCGCAGCGAAGTCGTCGGGGAAAACCATCTGGTAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTGCTAACCCTATACTGCTCCCAGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGACGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTGAGTTCTGATGATGTCGCTGTGGAGGAGAGTCGTTCAGAATATGTGGCACTACTAACAGCACCCAGC
                                                                   VAR                                        ACTGGATAGAAG
                                                                   VAR                                                    TGTCCCCTCCGG
                                                                   VAR                                                                CGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGAT
                                                                   VAR                                                                                                                                                                                                                                        GCAAAGTGACTGGCACAGGCAGACTGAAGGCTCATGGTCCATAGAAGAGTATAGTACAAAGCACAGACATTGTACGCTCACTATACGAGACAGAACGTTTGGAACCAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCTCCTATCAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTATCTTAGTTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGATGATGTCGCTGTAGAGGAGAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGTATCTCTGGTGACCACAACACTTTCAGAGCCGGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTATTTTCAGAGTCCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGAAACAGGAGGTGGAGGACTCGCAATGCTAACACTGAGTGATGTGGATGACAATCTGCACTTTATACTTATGCTCAGAGGTCTAAGTGGTGAAGAAGGAGATCAGATTCCAATACTTGTGCAAATCTCACATCAGAACCATGTGATACGGGAGCTATATGCCAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTATTGCCAGACCTTTCCAGTCGAGAAATGCTGTGGCTGGCTCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTCCGCAAAGCATGTCAGGCATAATCACAGTCAGAAAATCATGTGACACTTTGCAGAGTGTGTTATCGGGTGGTGACGCTTTAAATCCCACCAAAACTGGAGCCGTGGGATCTGCAAGCATCACACTTCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACAATGAGTACTGTGACAGCTGTGACACTGGAGACAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACTAAACCTCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATATTCTGCACGATATGAGCAAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGGACTACCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTCCTCAATGTAGCAACAAAGGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGAAGGGGAAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAGCTCAGAGGACAAATAACCCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATACAGTGGCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGCCTGTGGGCCAGATATGAGCAGCTCCCAGTTCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGGTCAGTTTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTTGTGTCACC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCACTGCCACCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGCCAGATCAGTGCTGTCCTGTGTGTGAAGAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGAGGTGAAAAAACCAGAGAGGGCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGCTCATGGAAGGCAGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATCCGTGCCAATCCTTCTGATTGCTGCAAGCAGTGCCCAGTAGAGGAGCGGAGTCCTATGGAACTGGCAGACAGTATGCAGTCAGATGGAGCAGGATCATGCAGATTTGGGCGTCACTGGTACCCAAATCATGAGCGTTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAATGTGTTACATGCACTTGTGCGGAGGGCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAGGGAGTTACACAGTGTCGGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTATCGGTTCAAAACGGGACAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAGTGCAAAGATGCCAATCAAGATGAAGAAGAAAAAGTGAAATCAGAGGAGACAAGAACTCCATGGAGTTTCTAGAGAGGAGTGCAACTGGGGTAATGGGATTGATTATCAAAGCTCATAGAGAGAGACATGTCTCAAGTTGAGACAACTGCCAGGACTTATGGATGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTAATGGATTTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATTTGCTGCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGAAGCAGTGGGATTCTGGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCCTTCCAACACCAAGTCAGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCCGGAGTTTTAACGTCTGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGAGCTTTGCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGAGCACAGACACAGCATAGGCAGCTGTGCATATGTAGATATATACTGACTAAAAGTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGCCTTGTGGC
                                                                   SNP                                                                                                                                                                                                                                                    --------C-C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                G------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                        -G----A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                    --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                -C--------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                            ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                        ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                        ------A--G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ------C---C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        G--G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ------A--C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -G--------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    T----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----A-A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        T---G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    T----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                A---------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------T-G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ------A-G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---------GA-
                                               BLH ATG     328    1052                
                                               BLH MIN     328     269                
                                               BLH MPR     151     269                
                                               BLH OVR     328     374                
                                               CDS MIN     328     269                
                                               EST CLI      18      48                
  5   1   2      en>5                              Xl3.1-xlk143o12ex.3                GCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTATCAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTCGCTCTTATCTTAGTTCCGATGATGTCGCTGTAGAGGAGAGTCGTTCAGAATACGTGGCACTACTAACAGCACCCAGCCATGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTAGATTCAACCTGCAGCGCTCAAATTTGCTCTTCTCGATCACTTATAAATGGATAGACAGACTTTCCCGAATCCGTTTCTCTGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGACCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGTTTACACTAAGTGACGTGGATGACAATCTGAACTTTATTCTTATGCTCAGAGGTCTACGTGGTGGAGAACGAGATTGGATTCCAATACTTGTGCAAATCTCTCATCAGAACCATGTGATACGGGAGATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTGGCCCAAGGTCAGCTAGAGATTTCAGTGCAGACAGAAGGGAGACGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAATGGAACTGTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGACACTGGAAACCTCGCCGAACAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGACTACCATGATGTGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTTCAATGTAGCGACAAAGGACTTCCCTTCCAGGAAGGTCAGGGGACAAATAACCCCTCTGCTCTGTTATACAGTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGTCTAGCTGGTCATGTCACCTCCCAACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCCACCTGCATTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTGTGTGAAGAAAAAAAAGAAATGAGAGAGGTGAAAAAACCAGAGAGAACTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCTGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATTTACACAGTGTCGGAGACAGGAGTGTACAGGAACTACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAATCAAGATGAAGATGAAAAAGTGAAATCAGACGAGACAAGGACTCCATGGAGTTTTTAGAGAGGAGAGCAACTCGGGCAATGGGACTGATTATCTAGGCTCACAAAAACATGTCCCAAGCTGAGACAACTGCCAGGACTGGATGGTCTGCACAATGTTTTGTTCCACTCTGATAACACTGCTACTGGATTTTACAGTATTTCCATTTGTTTAATTTGCTGCCTAAAGCAGTGGGATTCTGGAAGCAGCATTTGGAAGTAAAATACATTGCCACCTTGGATTCCCTTCAAACAATCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTCTGTAGAGTTTCGCAACAGGAGCACAGACACAGCATAGGCAGCTGTGCATATGTAGATATACTGACTAAACCTCTGTGGCTCTTCTACAGGACGGGAAGAAAAGTGCAAGAGACAGACAAAGACTACAGTGTTCTTGCTGGAAAGTCTGTATATATGTCTGCGTATGTGAGTGTGTGAACGCATGATTTTACTTTGGGGGTGTATGATCAGACATATATCAGTTCCTCTTGTCCAAGCACACACTTTTGGAAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTTTAATGATGGTCCGTATTTATTGAACTAAAATAAACTGAAGACATTTTCCCAAAAAAAAA
                                                  Xl3.1-CHK-1012685017                      CTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTATCAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAxxAxGAxxAxGATCTTTATAATGATCGCTCTxxxxxTTATCTTAGTTCxGxxGxTGTxGxTGTAGAGGAGAGTCGTTCAGAATACGTGGCACTACTAACAGCACCCAGCCATGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTAGATTCAACCTGCAGCGCTCAAATTTGCTCTTCTCGATCACTTATAAATGGATAGACAGACTTTCCCGAATCCGTTTCTCTGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGACCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGTTTACACTAAGTGACGTGGATGACAATCTGAACTTTATTCTTATGCTCAGAGGTCTACGTGGTGGAGAACGAGATTGGATTCCAATACTTGTGCAAATCTCTCATCAGAACCATGTGATACGGGAGATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTxxxxxxAGxTxxGCTAGAGATTTCAGTGCAGACAGAAGGGAGACGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGACACTGGAxACxxxxCCxxxCAGGAAAACAAAGCGAAATATTTTGCATGAxxxxxGACTACCxTxxxxTGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTxxxCxTCAATGxAxxGxxxxAxxACTTCCxxxxxxGGAAGGxxAGxxxAxAxxxxAxxxxxCxxCTCTGTTATACAGTGxxxxCCAGATATGAGAxGxxCxxxxxxCCTCTAGxxxxxCTGGTCAxxTxxxCTCCCAxCxxxxCAGGACAGGTTCAGCAGGTCATGCxTxxxxTxxAxxGGATGAGCxxxxxxxxxTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTGTGTGAAGAAAAAAAAGAAATGAGAGAGGTGAAAAAACCAGAGAGAACTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCTGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCxxGxxxTTACACAGTGTCGGAGACAGGAGTGTACAGGAACTACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAATCAAGATGAAGATGAAAAAGTGAAATCAGACGAGACAAGGACTCCATGGAGTTTTTAGAGAGGAGAGCAACTCGGGCAATGGGACTGATTATCTAGGCTCACAAAAACATGTCCCAAGCTGAGACAACTGCCAGGACTGGATGGTCTGCACAATGTTTTGTTCCACTCTGATAACACTGCTACTGGATTTTACAGTATTTCCATTTGTTTAATTTxxxxCxTAAAGCAGTGGGATTCTGGAAGCAGCATTTGGAAGTAAAATACATTGCCACCTTGGATTCCCTTCAAACAATCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGxxxxxTCTGTAGAGTTTCGCAACAGGAGCACAGACACAGCATAGGCAGCTGTGCATATGTAGATATACTGAxxAxxxCTCTGTxGxxxxTCTACAGGACGGGAAGAAAAGTGCAAGAGACAGACAAAGACTACAGTGTTCTTGCTGGAAAGTCTGTATATATGTCTGCGTATGTGAGTGTGTGAACGCATGATTTTACTTTGGGGGTGTATGATCAGACATATATCAGTTCCTCTTGTCCAAGCACACACTTTTGGAAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTxTxATxxxxGxxCGTATTTATTGAACTAAAATAAACTGAAGACATTTTCCCAAA
  5   1   2       bld Emb1                            IMAGE:6633351.5p TCATCGGACACTGGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTGAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCACCGAAGTCGTCGAGGAAAACCCATCTGGCAAAGTCAGCTGCAAAAACATCCAAACATGATTGCCCCTCCACCCTCCTGTACTAACCCTATCCTGCCTCCCTGGACATTGCTGCAAGACTTGTCCCNAAGCTCCTCCTCCTCCTATAAAGAAACCAGACTTTGTTTTTTGATGGATCTTGACTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCCTCTATTCTTAATCTCCGATGATGCCCGCCGGTAAAAGAAAAGTCCTTTCTCAAATACCGGGGCACTTACTAACCAGGCACCCCAGCTAATGTTGTGGGCCCCCCCACTTTACCAAGG
  5   1   2       bld DMZ       in                         xl338a13.5p    ATCGGACACTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGATTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTGAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCC
  5   1   2       bld Ga18      in                      xlk158d13ex.5p     ATCNNNNNTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGNTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGNTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCGTCGAGGAAAACCATCTGGCAAAGNCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTANCCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCGCNNNNNNCTCCTCCTCCTATNAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGNNGATGATCTTTATAATGATCGCTCTTATCTGAGTNCAGATGATGTCGCTGTAGAGGNGAGTCNNTCAGAATACGTGGCACTACTNACAGCACCCAGNCATGTGTGGNCCCCANNNCC
  5   1   2       bld Ga18      in                      xlk158e17ex.5p     ATCNNNNNTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGATTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTGAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTNAGNTCCGATGATGTCGCTGTAGAGGAGAGNCGTTCAGAATACGTGGCACTACTAACAGCACCCAGCCATGTGTGNCCCCAGT
  5   1   2       bld Ga18      in                        xlk3o16ex.5p     ATCNNNNNTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNNGTCGAGGAAAANCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACNNACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTNT
  5   1   2       bld Ga18      in                      xlk143o12ex.5p     ATCNGNNNTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCGCANNNNNCTCCTCCTCCTATAAAGAAATCAGANTTTGTTTTTGATGGATTTGAGNNTTTTCAAGAGAAGGNNGATGNNCTTTATNATGATCGCTCNTNTCTGAGTNNGA
  5   1   2       bld DMZ       in                         xl250b24.5p      CGGACACTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCGCA
  5   1   2       bld DMZ       in                         xl233e20.5p      CGGACACTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTG
  5   1   2       bld DMZ       in                         xl321l13.5p       GGACACTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGAC
  5   1   2       bld DMZ       in                         xl264p13.5p       GGACACTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCT
  5   1   2       bld Ga18      in                       xlk52n23ex.5p        GANACTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGNGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNNGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCNNCCTGGACATTGCTGCAAGANTTNTCGCANNNNNCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGANGGATTGAGNATTTTCNAGAGAAGGA
  5   1   2       bld Ga18      in                      xlk163h12ex.5p        GANACTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTGAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNNGTCGAGGAAAACCATCTGGCAAAGNCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATNCTGCTCCCTGGACATTGCTGCAAGNNTTGTCCCAAAGCTNCTCCTATNAAGAAATCAGACTTTGTTTTTGATGGATTTGAGNNTTTTCAAGAGAAGGNTGANGATCTTTNNAANGATCGCTC
  5   1   2       bld Ga18      in                      xlk159l20ex.5p         ACNCTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGNCTCATGGTTCATAGTTTAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTCCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCNTCGAGGAAAACCATCTGGCAAAGNCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGANTTGTCGCANNNNCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGATGGANTTGAGTNTTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTGAGTTCAGATGATGTCGCTGTAGAGNAGAGNCGTTCAGAATACGTGGCACTACTAACAGCNNCCAGCCATGTGTGGNCCCCAG
  5   1   2       bld Ga18      in                      xlk110j23ex.5p          CACTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGNNATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAANTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGNTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGNAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAGANTTGTCG
  5   1   2       bld Ga18      in                      xlk150n20ex.5p          CACTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGNNATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNNGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTNTCGCAAANNNCCTCCTCCTNCTATAAAGAAANCAGACTTTGTTTTTGATGGATTTGAGNNTTTTCAAGAGAAG
  5   1   2       bld Ga18      in                      xlk116i04ex.5p          CACTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGNCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTTGTGAACCTCAGCGAAGNNGTCGAGGAAAANCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGANTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACANTNCTNCNAGACTTNTCGCAAANNTCCTNCTC
  5   1   2       bld Ga18      in                      xlk102h17ex.5p          CACTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCGTCGAGGAAAACCATCTGGCAAAGNCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATNCTGCTCCCTGGACATTGCTGCANGACTTGTCGCAAANNTNNNCCTCCTCCTATAAAGAAANCAGANTTTGTTTTTGANGGNTTTGAGNNTTTTNNAGAGAAGGATGATG
  5   1   2       bld Ga18      ?                        xlk71p11ex.5p          CACTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGNTCATGGTTCATAGTTTAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGNTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGNNGTACATTTGGNGNAAAANTTTACTCTCTGGAGGATTCGTGGNATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTNTNNTGCTATTGTGAACCTCAGCGAAGNNGTCGAGGAAAACCATCTNGC
  5   1   2       bld Ga18      in                      xlk104m14ex.5p          CACTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCNAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACANTGCTNCANNACTTGTCGCAAANNTCCTCCTNCTCNTATAAAGAAATCAGACTTTGTTTTGATNG
  5   1   2       bld Ga18      in                       xlk62m20ex.5p          CACTGGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGNTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNNGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCANCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGANTTGTCGCAAANNNCNNCCTCCTNCTATAAAGAANTCAGACTTTGTTTTTGATGGNTTTGAGTNTTTNCA
  5   1   2       bld Ga18      in                        xlk1o23ex.5p              GGGCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCGTCGAGGAAAACCATCTGGCAAAGNCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCNNNACATTGCTGCAAGACTTGTCGCANNNNNCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGATGGNTTTGAGTNTTTTCAAGAGAAGGNNGANGNTCTTTATNATGA
  5   1   2       bld Ga18      in                       xlk60e05ex.5p                GCTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCANGANTTGTCGCAAANNNCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGNNGGNNTTGAGNATTTTCAAGAGAAGGNNGA
  5   1   2       bld DMZ       in                         xl313m18.5p                 CTGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCGCAAAGCTCCTCCTC
  5   1   2       bld DMZ       in                         xl235e16.5p                  TGAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCGAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCGCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGA
  5   1   2       bld Ga18      in                      xlk107c03ex.5p                   GAACTATAGCCTCCGGACATTGCTACCCGCTGTCAAGAAGTGGCTCGTCCNAATAGCAGGGACCACTCTATTCACTATTGGAGTGGGTGTATTGCAGTGTTGTGTGCTGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNNGTCGAGGAAAACCATCTGGCAAAGNCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACANTGCTNCAAGANTTGTCGCANNNNNCTCCTCCTCCNATAAAGAAANCAGACTTTGTTTTTGANGGATTTGAGNNTTTTCAAGAGAAGGNNNNNGATCTTTATA
  5   1   2       bld DMZ       in                         xl339a18.5p                                                                                  ATCGGACACTGGGACTGAACTGTATCTTCCGGACATTGGTACCTGCTGTGAAGAAGTGGAGTGTGTGTGTCGCAGATGTTGCTGGCTGAGGGTACAGAGCCATATATTCGGGATGTGACCCAGAGAGCCAGATTTAAGTAGTAGCAGAGTTGAAGGCTCATGGTTCATANCTCAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACGCTTGGACTCAACTGAGCTTGGTTCGGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCACCCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTATCAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTTAATT
  5   1   2       bld Gas6      in                    IMAGE:3437942.5p                                                                                     GACACTGGCACTGAACTGTATCCTTCCGGACATTGGTANCCTGCTGTGAAGAAGTGGAGTGTGTGTGTCGCAGTGTTGCTGGCTGAGGGTACAGAGCCATATATTCGGGATGTGACCCAGAGAGCCAGATTTAAGTAGTAGCAGAGTTGAAGGCTCATGGTTCATAGCTCAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACGCTTGGACTCAACTGAGCTTGGTTCGGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCACCCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCTGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCATAGCTCCTGCTTATCAGAAATCAGACTTTGGATTTGATGGATTTGAGTATTAT
  5   1   2       bld Ga18      in                      xlk145p08ex.5p                                                                                     ATCNNNNNTGGACTGAACTGTATCTTCCGGACATTGGTACCTGCTGTGAAGAAGTGGAGTGTGTGTGTCGCAGTGTTGCTGGCTGAGGGTACAGAGCCATATATTCGGGATGTGACCCAGAGAGCCAGATTTAAGTAGTAGCAGAGTTGAAGGCTCATGGTTCATAGCTCAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACGCTTGGACTCAACTGAGCTTGGTTCGGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCACCCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCGTCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGANTTGTCCCAAAGCTCCTCCTATCAAGAAATCAGACTTTGTTTTTGATGGANTTGAGNATTTTCAAGAGAAGGATGATGATCTTTATNATGATCGCTCTTATCTNGTTCCGATGATGTCGCTGTAGANGAGAGTCGTTCAGAATACGNGGCACTACTAANAGCACCCAGCCATGTNNGNCCCCNGNTACCAG
  5   1   2       bld Ga18      in                      xlk129a18ex.5p                                                                                     ATCNNNNNTGGACTGAACTGTATCTTCCGGACATTGGTACCTGCTGTGAAGAAGTGGAGTGTGTGTGTCGCAGTGTTGCTGGCTGAGGGTACAGAGCCATATATTCGGGATGTGACCCAGAGAGCCAGATTTAAGTAGTAGCAGAGTTGAAGGCTCATGGTTCATAGCTCAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACGCTTGGACTCAACTGAGCTTGGNTCGGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGNTTTCTTGCCCATTCACCCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAANTTTACTCCCTGGNGGNTTCGTGNCATCCAGATCTTGGGGAANCATTCGGNGTTATGCACTGTGTATTNTGCTATTGTGAANCTCAGCGAAGNNGTNGGGNAAAANCATCTNGCAAAGNCAGCTGCAAAANNNTCAAANNATGNTNCCCCT
  5   1   2       bld Ga18      ?                       xlk114g21ex.5p                                                                                     ATCNNNNNTGGACTGAACTGTATCTTCCGGACATTGGTACCTGCTGTGAAGAAGTGGAGTGTGTGTGTCGCAGTGTTGCTGGCTGAGGGTACAGAGCCATATATTCGGGATGTGACCCAGAGAGCCAGATTTAAGTAGTAGCAGAGTTGAAGGCTCATGGTTCATAGCTCAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACGCTTGGACTCAACTGAGCTTGGTTCGGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCACCCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGCGTCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGANTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTATCAAGNAANCAGANTTGTTTTNATGGANTTGAGTATTTCAAGAGAAGGNTGATGATCTTTATAATGANCGCTCTTATCTNAGTTCCGATGATGTCGCTNTAGANNNAGTCGTTC
  5   1   2       bld Ga18      in                      xlk150m19ex.5p                                                                                     ATCNNNNNTGGACTGAACTGTATCTTCCGGACATTGGTACCTGCTGTGAAGAAGTGGAGTGTGTGTGTCGCAGTGTTGCTGGCTGAGGGTACAGAGCCATATATTCGGGATGTGACCCAGAGAGCCAGATTTAAGTAGTAGCAGAGTTGAAGGCTCATGGTTCATAGCTCAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACGCTTGGACTCAACTGAGCTTGGTTCGGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCACCCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNNGTCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTATCAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTTNGTTCCGATGATGTCGCTGTAGAGGAGAGT
  5   1   2       bld Ga18      in                      xlk108b17ex.5p                                                                                      GNNNCACTGGACTGAACTGTATCTTCCGGACATTGGNACCTGCTGTGAAGAAGTGGAGTGTGTGTGTCGCAGTGTTGCTGGNTGAGGGTACAGAGCCATATATTCGGGATGTGACCCNGAGAGCCAGANTTAAGNAGTAGCAGAGTTGAAGGCTCATGGNTCATAGCTCAGNATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAANGCTTGGACTCAACTGAGCTTGGNTC
  5   1   2       bld Ga18      in                      xlk138n18ex.5p                                                                                        GANACTGGACTGAACTGTATCTTCCGGACATTGGTACCTGCTGTGAAGAAGTGGAGTGTGTGTGTCNCAGTGTTGCTGGCTGAGGGTACAGAGCCATATATTCGGGATGTGACCCAGAGAGCCAGATTTAAGTAGTAGCAGAGTTGAAGGCTCATGGTTCATAGCTCAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACGCTTGGACTCAACTGAGCTTGGTTCGGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCACCCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCGTCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTATCAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGNANGANGATCTTTATAATGATCGCTCT
  5   1   2       bld Ga18      in                      xlk155g15ex.5p                                                                                        GANACTGGACTGAACTGTATCTTCCGGACATTGGTACCTGCTGTGAAGAAGTGGAGTGTGTGTGTCGCAGTGTTGCTGGCTGAGGGTACAGAGCCATATATTCGGGATGTGACCCAGAGAGCCAGATTTAAGTAGTAGCAGAGTTGAAGGCTCATGGTTCATAGCTCAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACGCTTGGACTCAACTGAGCTTGGTTCGGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCACCCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCGTCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTATCAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTTAGTTCCGATGATGTCGCTGTAGAGGAGAGTCGNTCAGAATACGTGGCACTACTAACAGCACCCAGCCATGTGTNGNCCCCAGTTACCAGTGGAGTAGCCAAGGNTAGATTCAACCTGCAGNNNNAAATTTGCTCTTCTCAATCACTTATNAATGGATAGNCAGACTTTCCCGAATCCGTTCTCTGATCTNAAGGTTCTGTGCTGTTTGANNCCCAGNGCACAGAANGGGNNC
  5   1   2       bld Ga18      in                       xlk77i10ex.5p                                                                                        GANACTGGACTGAACTGTATCTTCCGGACATTGGTACCTGCTGTGAAGAAGTGGAGTGTGTGTGTCGCAGTGTTGCTGGCTGAGGGTACAGAGCCATATATTCGGGATGTGACCCAGAGAGCCAGATTTAAGTAGTAGCAGAGTTGAAGGCTCATGGTTCATAGCTCAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACGCTTGGACTCAACTGAGCTTGGTTCGGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCACCCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTNGNACATTGCTGCNAGACTTGTCCCAAAGCTCCTCCTATCAAGAAANCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCNCTCTTATCTTNGTTCCGATGATGTCGCTGTAGAGGNGAGTCGTTCAGA
  5   1   2       bld Ga18      in                       xlk53o01ex.5p                                                                                          CACTGGACTGAACTGTATCTTCCGGACATTGGTACCTGCTGTGAAGAAGTGGAGTGTGTGTGTCGCAGTGTTGCTGGCTGAGGGTACAGAGCCATATATTCGGGATGTGACCCAGAGAGCCAGATTTAAGTAGTAGCAGAGTTGAAGGCTCATGGTTCATAGCTCAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACGCTTGGACTCAACTGAGCTTGGNTCGGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCACCCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCGTCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTATCAAGAAATCAGACTTTGTTTTTGATGGANTTGAGTATTTTNNAGAGAAGGNNGATGATCTTTNTAATGATCGCTCTTNTCTTAGTTCCGATGANGTCGCTGTAGAGGAGAGNCGTTCAGAATACGTGGCACT
  5   1   2       bld Ga18      in                       xlk59e07ex.5p                                                                                          CACTGGACTGAACTGTATCTTCCGGACATTGGTACCTGCTGTGAAGAAGTGGAGTGTGTGTGTCGCAGTGTTGCTGGCTGAGGGTACAGAGCCATATATTCGGGATGTGACCCAGAGAGCCAGATTTAAGTAGTAGCAGAGTTGAAGGCTCATGGTTCATAGCTCAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACGCTTGGACTCAACTGAGCTTGGTTCGGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCACCCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCGTCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTATCAAGAAANCAGACTTTGNTTTTGATGGATTTGAGTATTTTCAAGAGAAGGNNGATGATCTTTATAATGATCGCTCTTNNCTTAGNTCCNATGATGTCGCTGTAGAGGAGANNCGNTCAGA
  5   1   2       bld Ga18                              xlk119h14ex.5p                                                                                          CACTGGACTGAACTGTATCTTCCGGACATTGGTACCTGCTGTGAAGAAGTGGAGTGTGTGTGTCGCAGTGTTGCTGGCTGAGGGTACAGAGCCATATATTCGGGATGTGACCCAGAGAGCCAGATTTAAGTAGTAGCAGAGTTGAAGGCTCATGGTTCATAGCTCAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACGCTTGGACTCAACTGAGCTTGGTTCGGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCACCCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCGTCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGANTTGTCCCAAAGCTCCTCCTATCAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTTAGTTCCNATGATGTCGCTGTAGAGGAGAGTCGTTCAGAATACGTNNNACTACTAACAGCACCCAGNCATGTGTGGNCCCCAGTTACCAGNGGNGTAGCCAAGGNTAGATTCAACCTGCAGNNNCAAANNNNCTCTNCTCAATCACTTAT
  5   1   2       bld Ga18      in                      xlk122k12ex.5p                                                                                          CACTGGACTGAACTGTATCTTCCGGACATTGGTACCTGCTGTGAAGAAGTGGAGTGTGTGTGTCGCAGTGTTGCTGGCTGAGGGTACAGAGCCATATATTCGGGATGTGACCCAGAGAGCCAGATTTAAGTAGTAGCAGAGTTGAAGGCTCATGGTTCATAGCTCAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACGCTTGGACTCAACTGAGCTTGGTTCGGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCACCCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNNNTCGGNGAAAANCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGANTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCNGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTATCAAGAAATCAGACTTTGTTTTTGATGGNTTTGAGTATTTTCAAGAGAAGGNNGATGATCTTTATAATGATCGCTCTTAT
  5   1   2       bld Ga18      out                      xlk75h09ex.5p                                                                                          CACTGGACTGAACTGTATCTTCCGGACATTGGTACCTGCTGTGAAGAAGTGGAGTGTGTGTGTCGCAGTGTTGCTGGCTGAGGGTACAGAGCCATATATTCGGGATGTGACCCAGAGAGCCAGATTTAAGTAGTAGCAGAGTTGAAGGCTCATGGTTCATAGCTCAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACGCTTGGACTCAACTGAGCTTGGTTCGGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCACCCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCGTCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTATCAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGNANGATGATCTTTATAATGATCGCTCTTNTCTTAGNTCCGATGATGTCGCTGTAGAGGAGAGNCGNTCAGAATACGTGGCACTACTAACA
  5   1   2       bld Ga18      in                       xlk60n21ex.5p                                                                                                                  AGTGTTGTGTGCTGGCTGAGGGTNCAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGNATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGNTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGNTTTCTTGCCCATTCAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGNTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAANCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCGCANNNNNCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCNTNTCTGAGTTCAGATGANGTCGCTGTAGAGGAGANTCGNTCAGAATACGTGGNACTACTAACAGCACCC
  5   1   2       bld Emb1                            IMAGE:5155474.5p                                                                                                                    GGACGCGTGGGGGCTGAGGGTACAGAGCCCTATACTGGGGATGTGACTCAGAGAGCCAGATTTAAGTAGTAGCAGAGTGCACTGGGATGGTGACAAAGTGACTTACACAGGCCGATTGAAGGCTCATGGTTCATAGTTTAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACACTTGGATTCAACTGAGCTTGGTTCAGGACTACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTGAACCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTTAGTTCCGATGATGTCGCTGTAGAGGAGAGTCGTTCAGAATACGTGGCACTACTAACAGCACCCAGCCATGGGTGGCCCCCAGTTACCAGTGGGAGTAGCCAAGGCTAGATTTCAACCTGCAGCGCTCCAATTT
  5   1   2       bld DMZ       in                         xl303k15.5p                                                                                                                                                                                           ATTCGGGATGTGACCCAGAGAGCCANATTTAAGTAGTAGCAGAGTTGAAGGCTCATGGTTCANAGCTCANTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATAGAACGCTTGGACTCAACTGAGCTTGGTTCGGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCACCCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTATCAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTTAGTTC
  5   1   2       bld Ga18      in                       xlk74l05ex.5p                                                                                                                                                                                                                                    AGAGTTGAAGGCTCATGGTTCATAGCTCAGTATAGTGCTAGGNTAGACACTGTACTCTCACTATACAATATAGAACGCTTGGACTCAACTGAGCTTGGTTCGGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCACCCGGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGNCGTCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTATCAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTTAGTTCCGATGATGTCGCTGTAGAGGAGAGTCGTTCAGAATACGTGGCACTACTAACAGCACCCAGCCATGTGTGGNCCCCAGTTACCAGTGGAGTAGCCAAGNNTAGATTCAACCTGCAGNNNCAAATTTNCTCTTCTCAATCACTTATAAATGGATAGACAGACTTTCCCGAATCCGTTTCTCTGATCNT
  5   1   2       bld Neu2      in                    IMAGE:2942746.5p                                                                                                                                                                                                                                                        TACGCTCAGTATAGTGCTAGGCATAGACACTGTACTCTCACTATACAATATATAACGCTTGGACTCAACTGAGCTTGGTTCGGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATTGCTCTCGCACAAAGGTTTTCTTGCCCATTCACCCGGAACAAGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATACGTGGCATCCAGATCTTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGGGAACCTCAGCGAAGTCGTCGGGGAAAACCATCTGGCAAAGTCAGCTGCAGAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGAACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTATCAAGAAATCAGACTATGTTGTTGATGGAGTTGAGTATTTTCAAGAGAAGGATGATGATCTGTATAATGATCGCTCTTATCTTAGTTCCGATGATGTCGCTGTAGAGGAGAGTCGTTCAGAATACGTGGCACTACTAACAGCACCCAGCCATGTGTGGCCCTCAGGTACCAGGTGAGTAGCCAAGGCTAGATTCAGCCTGCAGCGCTCGAAATTGCTCTTCTCAATCACTTATAAATAGATAGACAGACTTTGCGGAATGCAGTTCTCTGATCTGGAAGTTCTGTGCTGT
  5   1   2       add DMZ       in                         xl259f16.5p                                                                                                                                                                                                                                                                 TATAGTGCTAGGCATANACACTGTACTCTCACTATACAATATNNAACGCTTGGACTCAACTGAGCTTGGTTCGGGACAACCACAAAAATGCTGTGTTCCCCCCTCATACTTCTGTGGACCCTGTGGATTTTGGCTGTGGATNGCTCTCGCNCAANGGTTTTCTTGCNCAT
  5   1   2       bld DMZ       in                         xl320o18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTACATTTGGTGGAAAATTTTACTCTCTGGAGGATTCGTGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCGCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTGAGTTCAGATGATGTCGCTGTAGAGGAGAGTCGTTCAGAATACGTGGCACTACTAACAGCACCCAGCCATGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTAGATTCAACCTGCAGCGCTCAAATTTGCTCTTCTCGATCACTTATAAATGGATAGACAGACTTTCCCGAATCCGTTTCTCTGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGC
  5   1   2       bld DMZ       in                         xl334d09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACGAGGCGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTTAGTTCCGATGATGTCGCTGTAGAGGAGAGTCGTTCAGAATACGTGGCACTACTAACAGCACCCAGCCATGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTAGATTCAACCTGCAGCGCTCAAATTTGCTCTTCTCGATCGCTTATAAATGGATAGACAGACTTTCCCGAATCCGTTTCTCTGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGAAATATCAG
  5   1   2       bld DMZ       in                         xl334f11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTTAGTTCCGATGATGTCGCTGTAGAGGAGAGTCGTTCAGAATACGTGGCACTACTAACAGCACCCAGCCATGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTAGATTCAACCTGCAGCGCTCAAATTTGCTCTTCTCGATCGCTTATAAATGGATAGACAGACTTTCCCGAATCCGTTTCTCTGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGACCTTCAGTGCACTTCTTAC
  5   1   2       bld DMZ       in                         xl334j03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGAGTTATGCACTGTGTATTATGCTATTGTGAACCTCAGCGAAGTCGTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTTAGTTCCGATGATGTCGCTGTAGAGGAGAGTCGTTCAGAATACGTGGCACTACTAACAGCACCCAGCCATGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTAGATTCAACCTGCAGCGCTCAAATTTGCTCTTCTCGATCGCTTATAAATGGATAGACAGACTTTCCCGAATCCGTTTCTCTGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGACCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGA
  5   1   2       bld DMZ       in                         xl230g09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCGAGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCGCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTGAGTTCAGATGATGTCGCTGTAGAGGAGAGTCGTTCAGAATACGTGGCACTACTAACAGCACCCAGCCATGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTAGATTCAACCTGCAGCGCTCAAATTTGCTCTTCTCGATCACTTATAAATGGATAGACAGACTTTCCCGAATCCGTTTCTCTGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGACATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGACCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGTTTACACTAAGTGACGTGGATGACAATCTGCACTTTATTCTTATGCTCA
  5   1   2       bld Ga18      in                      xlk145b02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTACTAACCCTATCCTGCTCCCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTATCAAGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTTAGTTCCGATGATGTCGCTGTAGAGGAGAGTCGTTCAGAATACGTGGCACTACTAACAGCACCCAGCCATGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTAGATTCAACCTGCNGNNNCAAATTTGCTCTTCTCAATCACTTATAAATGGATAGACAGACTTTCCCGAATCCGTTTCTCTGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGAAATATCAGGNAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGANCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGANTCGCAATGTTTACACTAAGTGACGTGGATGACAATCTGAACTTTATTCTTATGCTCAGAGGNCTACGNGGTGGAGAACGAGATTGGATTCCAATACTTGTGCNAATCTCTCATCAGAACCATGTGATACGGG
  5   1   2       bld Ga18      in                      xlk162m06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAAATCAGACTTTGTTTTTGATGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTGAGTTCAGATGATGTCGCTGTAGAGGAGAGTCGTTCAGAATACGTGGCACTACTAACAGCACCCAGCCATGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTAGATTCAACCTGCNGNNNNAAATTTGCTCTTCTCGATCACTTATAAATGGATAGACAGACTTTCCCGAATCCGTTTCTCTGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGACATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGACCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGANTCGCAATGTTTACACTAAGTGACGTGGATGACAATCTGCACTTTATTCTTATGCTCAGAGGTCTACGTGGTGGAGAACGAGATTGGATTCCAATACTTTTGCAAATCTCTCATCAGAACCATGTGATACGGGAGATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTNNCCAGACCTTTCCAG
  5   1   2       bld Ga18      in                       xlk67f02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACTAACAGCACCCAGCCATGTGTNNCNCCAGTTACCAGTGGAGTAGCCAAGNNAGATTCAACCTGCNGNNNNAAATTTGCTCTTCTCGATCACTTATAAATGGATAGACAGACTTTCCCGAATCCGTTTCTCTGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGACATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGACCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGTTTACACTAAGTGACGTGGATGACAATCTGCACTTTATTCTTATGCTCAGAGGTCTACGTGGTGGAGAACGAGATTGGATTCCAATACTTTTGCAAATCTCTCATCAGAACCATGTGATACGGGAGATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGANGCTGTGGTTGNNCCAAGGTCAGCTAGAGATTTCAGTGCAGACAGAAGGGAGACGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGNGTGTTNTCTGGTGGTGATNCTTTAAATCCCANCAAAACTGGAGCTGTGGGNNC
  5  -1   2       chi Em10                            IMAGE:7979792.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTGTCGAAGTGCATCTACGCACAGCAGGTGCCCAGTACAGGATAGCAGGTAATTCACTGAGCGCTCAATTGTCTCTCATCACTATAATGATGACGACTTCCAGATCCGTTCTCCGATCTGACGGTCTGTGCTGTTGACACCCAGTGCACAGAATGGGACCCCACGGATGACACTATCTGGGCATTTGAGGTCCCTTAATCGGTCCACTCTACGTCTTCTCCGAATGGGTCACATTCTTGTATCTCTGGTGACCACAACACTTTCAGAGCCGGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTATTTTCAGAGTCCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGAAACAGGAGGTGGAGGACTCGCAATGCTAACACTGAGTGATGTGGATGACAATCTGCACTTTATACTTATGCTCAGAGGTCTAAGTGGTGAAGAAGGAGATCAGATTCCAATACTTGTGCAAATCTCACATCAGAACCATGTGATACGGGAGCTATATGCCAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTATTGCCAGACCTTTCCAGTCGAGAAATGCTGTGGCTGGCTCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTCCGCAAAGCATGTCAGGCATAATCACAGTCAGAAAATCATGTGACACTTTGCAGAGTGTGTTATCGGGTGGTGACGCTTTAAATCCCACCAAAACTGGAGCCGTGGGATCTGCTAGCATCACACTTCATGAAAATGGAACCGTGGGATCTGCAAGCATCACACTTCATGAAAATGGAACTCTGATATTCCAG
  5   1   2       bld DMZ  5g3  in                         xl306a01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCCAAGGCTAGATTCAACCTGCAGCGCTCCAATTTGCTCTTCTCAATCACTTATAAATGGATAGACAGACTTTCCAGAATCCGTTTCTCCGATCTTGACGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCCCACGGGATGACACTATCTGTGGCATTTGGAGGTCCCTTAATCGGTCCACTCTACGTCTTCTCCGAATGGGTCACATTCTTGTATCTCTGGTGACCACAACACTTTCAGAGCCGGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTATTTTCAGAGTCCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGAAACAGGAGGTGGAGGACTCGCAATGCTAACACTGAGTGATGTGGATGACAATCTGCACTTTATACTTATGCTCAGAGGTCTAAGTGGTGAAGAAGGAGATCAGATTCCAATACTTGTGCAAATCTCACATCAGAACCATGTGATACGGGAGCTATATGCCAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTATTGCCAGACCTTTCCAGTCGAGAAATGCTGTGGCTGGCTCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTCCGCAAAGCATGTCAGGCATAATCACAGTCAGAAAATCATGTGACACTTTGCAGAGTGTGTTATCGGGTGGTGACG
  5   1   2       bld Ga18      in                      xlk143m09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAGATTCAACCTGCNGNNTNAAATTTGCTCTTCTCGATCACTTATAAATGGATAGACAGACTTTCCCGAATCCGTTTCTCTGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGACATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGACCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGTTTACACTAAGTGACGTGGATGACAATCTGCACTTTATTCTTATGCTCAGAGGTCTACGTGGTGGAGAACGAGATTGGATTCCAATACTTTTGCAAATCTCTCATCAGAACCATGTGATACGGGAGATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTGGNCCAAGGNCAGCTAGAGATTTCAGTGCAGACAGAAGGGAGANGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGNGTGTTATCTGGNGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTNTTNCACTGCATGAAAACNGA
  5   1   2       bld Ga12                                 XL203m05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATTCAACCTGCAGCGCTCAAATTTGCTCTTCTCAATCACTTATAAATGGATAGACAGACTTTCCCGAATCCGTTTCTCTGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGACCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGTTTACACTAAGTGACGTGGATGACAATCTGAACTTTATTCTTATGCTCAGAGGTCTACGTGGTGGAGAACGAGATTGGATTCCAATACTTGTGCAAATCTCTCATCAGAACCATGTGATACGGGAGATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTGGCCCAAGGTCAGCTAGAGATTTCAGTGCAGACAGAAGGGAGACGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGGTGATGCTTTAAATCCCACCAAAACTGG
  5   1   2       bld Ga18      in                       xlk81e09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTGCTCTTCTCAATCACTTATAAATGGATAGACAGACTTTCCAGAATCCGTTTCTCCGATCTTGACGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCCCACGGATGACACTATCTGTGGCATTTGGAGGTCCCTTAATCGGTCCACTCTACGTCTTCTCCGAANNNNCACATTCTTGTATCTCTGGTGACCACAACACTTTCAGAGCCGGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTATTTTCAGAGTCCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGAAACAGGAGGTGGAGGACTCGCAATGCTAACACTGAGTGATGTGGATGACAATCTGCACTTTATACTTATGCTCAGAGGTCTAAGTGGTGAAGAAGGAGATCAGATTCCAATACTTGTGCAAATCTCACATCAGAACCATGTGANACGGGAGCTATATGCCAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTATTGCCAGACCTTTCCAGTCGAGAAANGCTGTGNNTGGCTCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTCCNNAAAGNATGTCAGGCATAATCACAGTCAGAAAATCATGTGACACTTTGCAGAGNGTGTTNTCG
  5   1   2       bld Ga12      in                         XL141e22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCTCGATCGCTTATAAATGGATAGACAGACTTTCCCGAATCCGTTTCTCTGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGACCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGTTTACACTAAGTGACGTGGATGACAATCTGCACTTTATTCTTATGCTCAGAGGTCTACGTGGTGGAGAACGAGATTGGATTCCAATACTTTTGCAAATCTCTCATCAGAACCATGTGATACGGGAGATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGA
  5   1   2       bld Ga18 5g3  out                       xlk7i01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCAGAATCCGTTTCTCCGATCTTGACGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCCCACGGNTGACACTATCTGTGGCATTTGGAGGTCCCTTAATCGGTCCACTCTACGTCTTCTCCGAATGGTCACATTCTTGTATCTCTGGTGACCACAACACTTTCAGAGCCGGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTATTTTCAGAGTCCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGAAACAGGAGGTGGAGGACTCGCAATGCTAACACTGAGTGATGTGGATGACAATCTGCACTTTATACTTATGCTCAGAGGTCTAAGTGGTGAAGAAGGAGATCAGATTCCAATACTTGTGCAAATCTCACATCAGAACCATGTGATACGGGAGCTATATNCCAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTATTGCCAGACCTTTCCAGTCGAGAAATGCTGTGGNTGGCTCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGNCCGCAAANNATGTCAGGCATAATCACAGTCAGAAAATCATGTGACACTTTGCAGAGTGTGTTATCGGNNGNNGACGCTTTAAATCCCACCNAAACTGGAGCCGTGNNNCTGCAAGCATCACACTTCATGAAAATGGAACTCTGGNATATCAGATTCAAATTNCTGGTACAATGAGNACTGTGACAGCTGTGA
  5   1   2       bld Ga12      in                         XL205k03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCGAATCCGTTTCTCTGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGACCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGTTTACACTAAGTGACGTGGATGACAATCTGAACTTTATTCTTATGCTCAGAGGTCTACGTGGTGGAGAACGAGATTGGATTCCAATACTTGTGCAAATCTCTCATCAGAACCATGTGATACGGGAGATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTGGCCCAAGGTCAGCTAGAGATTTCAGTGCAGACAGAAGGGAGACGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAATGGAACTCTGGA
  5   1   2       bld Ga18      in                       xlk62a15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTCTCTGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGACCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGTTTACACTAAGTGACGTGGATGACAATCTGAACTTTATTCTTATGCTCAGAGGTCTACGTGGTGGAGAACGAGATTGGATTCCAATACTTGTGCAAATCTCTCATCAGAACCATGTGATACGGGAGANATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTGGCCCAAGGTCAGCTAGAGATTTCAGTGCAGACAGAAGGGAGACGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTANCATGAGTACTGTGACAGCTGTGANNNTGGAGNNTAAACCTCGCAGGAAANAAAGCGAAANATTTTNCATGATTTGAGNA
  5   1   2       bld Ga18 5g3  in                      xlk146e23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCCCCACGATGACACTATCTGTGGCATTTGGAGGTCCCTTAATCGGTCCACTCTACGTCTTCTCCGAATGGTCACATTCTTGTATCTCTGGTGACCACAACACTTTCAGAGCCGGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTATTTTCAGAGTCCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGAAACAGGAGGTGGAGGACTCGCAATGCTAACACTGAGTGATGTGGATGACAATCTGCACTTTATACTTATGCTCAGAGGTCTAAGTGGTGAAGAAGGAGATCAGATTCCAATACTTGTGCAAATCTCACATCAGAACCATGTGATACGGGAGCTATATGCCAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTATTGCCAGACCTTTCCAGTCGAGAAATGCTGTGNNTGGCTCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTCCGCAAAGNATGTCAGGCATAATCACAGTCAGAAAATCATGTGACACTTTGCAGAGTGTGTTATCGGGTGGTGACGCTTTAAATCCCACCAAAACTGGAGCCGTGGGGATCTGCAAGCATCACACTTCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACAATGAGTACTGTGACAGCTGTGACACTNGAGACAAAACCTCGCCGAAAAACAAAGAGAAATATTCTGCACGATATGAGCNAGGACTACCATGATGGAAGGNNCTGGGGAT
  5   1   2       bld Ga18      in                        xlk6a21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCCACACGAGGTGACACTACCTGTGGTATTTGGAGGTCCCTTAATCGTTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGACCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGTTTACACTAAGTGACGTGGATGACAATCTGAACTTTATTCTTATGCTCAGAGGTCTACGTGGTGGAGAACGAGATTGGATTCCAATACTTGTGCAAATCTCTCATCAGAACCATGTGATACGGGAGATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTGGNCCAAGGTCAGCTAGAGATTTCAGTGCAGACAGAAGGGAGACGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGANACTGGAGACTAAANCTCGCAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGNAAGGACTAC
  5   1   2       bld Ga18      in                      xlk163l19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCCACTCTACGTCTTCTCCAAATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGACCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGTTTACACTAAGTGACGTGGATGACAATCTGAACTTTATTCTTATGCTCAGAGGTCTACGTGGTGGAGAACGAGATTGGATTCCAATACTTGTGCAAATCTCTCATCAGAACCATGTGATACGGGAGATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTGGCCCAAGGTCAGCTAGAGATTTCAGTGCAGACAGAAGGGAGACGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGACACTGGAGANTAANNCTCGCAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGCAAGGNCTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGANCTACNTNTGCTGTTA
  5   1   2       bld Ga18      in                      xlk153b20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGGGTCACATTGTTGTATCTCTAGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGACCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGTTTACACTAAGTGACGTGGATGACAATCTGAACTTTATTCTTATGCTCAGAGGTCTACGTGGTGGAGAACGAGATTGGATTCCAATACTTGTGCAAATCTCTCATCAGAACCATGTGATACGGGAGATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTGGCCCAAGGTCAGCTAGAGATTTCAGTGCAGACAGAAGGGAGACGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGACACTGGAGANTAAACCTCGCAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGNAAGGNCTACCATGATGGAAGGGTCTGGGGATNTTGGATAGATGCTAATGNCCGAGACCTACATATGCTGTTACAAAGNGAGNT
  5   1   2       bld Ga18      in                       xlk64e01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTATTTTCAGAGTCCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGAAACAGGAGGTGGAGGANTCGCAATGCTAACACTGAGTGATGTGGATGACAATCTGCACTTTATACTTATGCTCAGAGGTCTAAGTGGTGAAGAAGGAGATCAGATTCCAATACTTGTGCAAATCTCACATCAGAACCATGTGATACGGGAGCTATATGCCAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTATTGCCAGACCTTTCCAGTCGAGAAATGCTGTGGNTGGCTCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTCCGCAAAGNATGTCAGGCATAATCACAGTCAGAAAATCATGTGACACTTTGCAGAGTGTGTTATCGGGTGGTGACGCTTTAAATCCCACCAAAACTGGAGCCGTGGGATCTGCAAGCATCACACTTCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACAATGAGTACTGTGACAGCTGTGACACTGGAGACAAAACCTCGCCGAAAAACAAAGAGAAATATTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGANCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAANTCAGGGGNNAAATAACCCCTCTGCTATACAGNGGCCTGTGGNCAGATATGAGAAGNT
  5   1   2       bld Ga14                                Ga14-p3e6.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGAGTCCTTCAGTGAACTTCTTACCCCAGAAGACTCTGATGAAACAGGAGGTGGAGGACTCGCAATGCTAACACTGNAGTGATGTGGATGACAATCTGCACTTTATACTTATGCTCAGAGGTCTAAGTGGTGAAGAAGGAGATCAGATTCCAATACTTGTGCAAATCTCACATCAGAACCATGTGATACGGGAGCTATATGCCAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTATTGCCAGACCTTTCCAGTCGAGAAATGCTGTGGCTGGCTCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTCCGCAAAGCATGTCAGGCATAATCACAGTCAGAAAATCATGTGACACTTTGCAG
  5   1   2       bld Ga12      in                         XL168o23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGAGGGAAANAGGAGGTGGAGGACTCGCAATGCTAACACTGAGTGATGTGGATGACAATCTGCACTTTATACTTATGCTCAGAGGTCTAAGTGGTGAAGAAGGAGATCAGATTCCAATACTTGTGCAAATCTCACATCAGAACCATGTGATACGGGAGCTATATGCCAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTATTGCCAGACCTTTCCAGTCGAGAAATGCTGTGGCTGGCTCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTCCGCAAAGCATGTCAGGCATAATCACAGTCAGAAAATCATGTGACACTTTGCAGAGTGTGTTATCGGGTGGTGACGCTTTAAATCCCACCAAAACTGGAGCCGTGGGATCTGCAAGCATCACACTTCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACAATGAGTACTGTGACAGCTGTGACACTGGAGACAAAACCTCGCCGAAAAACAAAGAGAAATATTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAA
  5   1   2       bld Ga18      in                      xlk154e04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GANTCGCAATGNTAACACTGAGTGATGTGGATGACAATCTGCACTTTATACTTATGCTCAGAGGTCTAAGTGGTGAAGAAGGAGATCAGATTCCAATACTTGTGCAAATCTCACATCAGAACCATGTGATACGGGAGCTATATGCCAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTATTGCCAGACCTTTCCAGTCGAGAAATGCTGTGGNTGGCTCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTCCGCAAAGNATGTCAGGCATAATCACAGTCAGAAAATCATGTGACACTTTGCAGAGTGTGTTATCGGGTGGTGACGCTTTAAATCCCACCAAAACTGGAGCCGTGGGATCTGCAAGCATCACACTTCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACAATGAGTACTGTGACAGCTGTGACACTGGAGACAAAACCTCGCCGAAAAACAAAGAGAAATATTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAANTCAGGGGANAAATAACCCCTCTGCTATACAGTGGCCTGTGGNNANGATATGAGAAGNTCCCAGTTCCTCTAGCTGGNCAGTTTGTGTCANCTCCCATCAGGACAGGTNCAGCAGGNCATGCATGGGTTTCACTGG
  5   1   2       bld Ga18      in                      xlk111l14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAATGTTTACACTAAGTGACGTGGATGACAATCTGAACTTTATTCTTATGCTCAGAGGTCTACGTGGTGGAGAACGAGATTGGATTCCAATACTTGTGCAAATCTCTCATCAGAACCATGTGATACGGGAGATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTGGNCCAAGGTCAGCTAGAGATTTCAGTGCAGACAGAAGGGAGACGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGACACTGGAGACTAAACCTCGCAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGCNAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGNGAGCTCTTCCTCAATGTAGCAACAAAGGNCTTCCAGGAAGGGGNGNNCAGAGGNNAATTAACCCCTCTGTTATACAGTGGCCTGTGGCNGATATGAGCAGNTCCCAATTCCTCTAG
  5   1   2       bld Neu7      in                         XL007e05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTGATGTGGATGACAATCTGCACTTTATACTTATGCTCAGAGGTCTAAGTGGTGAAGAAGGAGATCAGATTCCAATACTTGTGCAAATCTCACATCAGAACCATGTGATACGGGAGCTATATGCCAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTATTGCCAGACCTTTCCAGTCGAGAAATGCTGTGGCTGGCTCAAGGTCAGCTGGAGATTTCAGTGCANACAGAAGGGAGACGTCCGCAAAGCATGTCAGGCATAATCACAGTCAGAAAATCATGTGACACTTTGCAGAGTGTGTTATCGGGTGGTGACGCTTTAAATCCCACCAAAACTGGAGCCGTGGGATCTGCAAGCATCACACTTCATGAAAATGGAACTCTGGAATATCANATTCAAATTGCTGGTACAATGAGTACTGNGACAGCTGTGACACTGGANACAAAACCTNNNCNAAAAACA
  5   1   2       bld Ga18      in                       xlk60k19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGATGACAATCTGAACTTTATTCTTATGCTCAGAGGTCTACGTGGTGGAGAACGAGATTGGATTCCAATACTTGTGCAAATCTCTCATCAGAACCATGTGATACGGGAGATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTGGCCCAAGGTCAGCTAGAGATTTCAGTGCAGACAGAAGGGAGACGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGACACTGGAGACTAAACCTCGCAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGANCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAATTAACCCCTCTGTTATACAGTGGCCTGTGGNCNNNATATGAGCAGCTCCCAATTCCTCTAGCTNGNCAGNTTGTGTCACCACCAATCAGGACAGGTNC
  5   1   2       bld DMZ       in                         xl261e11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAACGAGATTGGATTCCAATACTTTTGCAAATCTCTCATCAGAACCATGTGATACGGGAGATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTGGCCCAAGGTCAGCTAGAGATTTCAGTGCAGACAGAAGGGAGACGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAACGGAACTGTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGACACTGGAGACTAAACCTCGCAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAAATAACCCCTCTGTTATACAGTGGCCTGTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTG
  5   1   2       bld Tail      in                    IMAGE:8541519.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCATCAGAACCATGTGATACGGGAGCTATATGCCAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTATTGCCAGACCTTTCCAGTCGAGAAATGCTGTGGCTGGCTCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTCCGCAAAGCATGTCAGGCATAATCACAGTCAGAAAATCATGTGACACTTTGCAGAGTGTGTTATCGGGTGGTGACGCTTTAAATCCCACCAAAACTGGAGCCGTGGGATCTGCAAGCATCACACTTCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACAATGAGTACTGTGACAGCTGTGACACTGGAGACAAAACCTCGCCGAAAAACAAAGAGAAATATTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACAGTGGCCTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGG
  5   1   2       bld Ga18      in                       xlk55f21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCAGAACCATGTGATACGGGAGATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTGGCCCAAGGTCAGCTAGAGATTTCAGTGCAGACAGAAGGGAGACGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAACGGAACTGTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGACACTGGAGACTAAACCTCGCAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAAATAACCCCTCTGTTATACAGTGGCCTGTGGNCANNATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACNNATCAGGACAGGNTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTNNCACCTGCATTATCAGATTGTGGTGACTGGNCTGGGNAAGGCAGAGGNNGCTNCACTAAACGCACA
  5   1   2       bld Ga18      in                      xlk105e07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCAGAACCATGTGATACGGGAGANATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTGGCCCAAGGTCAGCTAGAGATTTCAGTGCAGACAGAAGGGAGACGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAACGGAACTGTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGACACTGGAGACTAAACCTCGCAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAAATAACCCCTCTGTTATACAGTGGCCTGTGGNNNNNTATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACNNNNNCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGNCACCTGCATTATCAGATTGTGGTGACTGGNCTGGGNAAGNCAGAGGNNGCTGCACTAAACGC
  5   1   2       bld Neu7      in                         XL019m06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGATACGGGAGNATATACGCCAACATCTCTGCACAGGAACAAGATTTTGCAGAGGTCTTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTGGCCCAAGGTCAGCTAGAGATTTCAGTGCAGACAGAAGGGAGACGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGACACTGGAGACTAAACCTCGCAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGG
  5   1   2       chi Emb1                            IMAGE:6631565.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACAGGAACAAGACTTTGCAGAGGTATTGCCAGACCTTTCCAGTCGAGAAATGCTGTGGCTGGCTCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTCCGCAAAGCATGTCAGGCATAATCACAGTCAGAAAATCATGTGACACTTTGCAGAGTGTGTTATCGGGTGGTGACGCTTTAAATCCCACCAAAACTGGAGCCGTGGGATCTGCAAGCATCACACTTCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACAATGAGTACTGTGACAGCTGTGACACTGGAGACAAAACCTCGCCGAAAAACAAAGAGAAATATTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACAGTGGCCTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTTGCTGAANCTTGGAAAAGGTCGGTGGAGAAGCTCCTCCTGGGACACCAAGAGGGGTGGTTAAAAGGGGCTTCCCTATTGGGGTCAGAAGGCCACAGGGGGAAAGTGGTAAAAAAGAACCTTTGAAACCTTTGAAAACTTATTTGGGGG
  5   1   2       bld Ga18      in                       xlk61o23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGCCAGACCTTTCCAGCCGTGAGATGCTGTGGTTGGNCCAAGGNCAGCTAGAGATTTCAGTGCAGACAGAAGGGAGANGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGNATTACACTGCATGAAAACNGAACTGTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGACACTGGAGACTAAACCTCGCAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGCNAGGACTACCATGATGGAAGGGNCTNGGGATATTGGATAGATGCTAATGCCCGAGANCTACATATGCTGTTACAAAGNGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAAATAACCCCTCTGTTATACAGNNNCCTGTGG
  5   1   2       bld DMZ       in                         xl332l18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTCCGCAAAGCATGTCAGGCATAATCACAGTCAGAAAATCATGTGACACTTTGCAGAGTGTGTTATCGGGTGGTGACGCTTTAAATCCCACCAAAACTGGAGCCGTGGGATCTGCAAGCATCACACTTCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACAATGAGTACTGTGACAGCTGTGACACTGGAGACAAAACCTCGCCGAAAAACAAAGAGAAATATTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACAGTGGCCTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGANG
  3   1   2       bld Ga18                             rxlk117i01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGNAGNCGNNNNNAAGCNNNNNNGNANANNANAGTCAGAAATCANNNNGNNNNTTTGCAGANTGNNTNTCGGNNNNGNNNCTTTNAATCCCACNAAAACNGNNNCNNNGGATCNNNAAGCATCANNCTTCATNNAAATGGANCTCTGGANTATCAGATTCAAATTGCTGGTACAATGAGTACTGTGACAGCTGTGACNCNGGAGACAAANCCTCGCCGAAAAACNNNGAGAAATNTTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATNCTAATGCCCGAGNNCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAACTCAGGGGACAAATANCCCCTCTGCTATACAGTGCCTGTGGNCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGANNACTNCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGNCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGNNCCCNCCTCTGAANNNNNCCA
  5   1   2       bld Ga18      in                        xlk6l10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGNNGTCAGCAATCAATGTCAGGCATCATCACAGTCAGAAGATCATGTGACACTTTGCAGAGTGTGTTATCTGGTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAACGGAACTGTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGACACTGGAGACTAAACCTCGCAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAAATAACCCCTCTGTTATACAGTGGCCTGTGGNCANANATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGNTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGNCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGNCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGNNNCAGGGTAGTGTAAAAGACCTTGACCTTGANCTTTTGGGANATCTGAGCCGGGGNACAG
  3   1   2       bld Ga18      in                       xlk81e09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTCAGNAAATCATNNNNNNTTNCAGAGTNNNTNATCGGGTGGNNNNCTTTAAATCCCNCCAAACNGNNNCCGTGGGATCTNNAANNNTCACNCTTCNTGAAAATGGANTNNNNATNTNAGNTTCAANNNCTNNNNNATGAGTACTGTGACAGNTGTGACNCTGNAGACAAACCTCGCCGAAAAACAAAGAGAAANNTTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGNTCTGGGGATATTGNATAGATNCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGNCTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACANTGCCTGTGGGCCAGATATGAGAAGCTCCCANTTCCTCTAGCTGGTCAGTTTGTGTCNCCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGNTTCACTGGATGAGNACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGANCCGGGNNACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGnnnnnnnnCTCTGAA
  5   1   2       bld DMZ       in                         xl319p02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTTGCAGAGTGTGTTATCGGGTGGTGACGCTTTAAATCCCACCAAAACTGGAGCCGTGGGATCTGCAAGCATCACACTTCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACAATGAGTACTGTGACAGCTGTGACACTGGAGACAAAACCTCGCCGAAAAACAAAGAGAAATATTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACAGTGGCCTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGG
  3   1   2       bld Ga18                              rxlk66b18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TNNAGANTGNNTNTNNGGTGGTGNCGnnnnnnnnCNCCAAANCTGGAGCNGTGGGNTCTGNAAGCATCANNCTTCATGAAAANGNACTCTGGAATATCAGNTTCAAATTGCTGGTACAATGAGTACTGTGACAGCTGTGACNCNGGAGACAAAACCTCGCCGAAAAACAAAGAGAAATATTCTGCACGATATGAGCAAGGACTNCCATGATGNNAGGNTCTGGGGATATTGGATAGATGCTAATGCCCGAGNCCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGNNCTCAGGGGACAAATAACCCCGCTGCTATACAGTGCCTGTGGNCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGANNACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATNCCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCNCGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGANCCTATTNNNNNNCNCCTCTGAA
  3   1   2       bld Ga18      in                      xlk118l10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TNTCGGGNGGTGNCGCTTTANNNNNNNCCAAANCNGGAGCGTGGNNTCTGCAANNATCANCNNTCATGAAAATGGAACTCTGGANTATNAGNTTCAANTNGCTGGTACAATGAGTACTGTNACAGCTGTGANNCTGGAGANAAAACCTCGCNGAAAACAAAGAGAAATNTTCTGCNCGATATGAGCAANGNCTACCATGATGGAAGGNTCTGGGGATATTGGATAGATGCTAATGCCCGAGNNCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGANCTCAGGGGACAAATANNCCCTCTGCTATACNGTGCCTGTGGNNCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCNCCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGANNCTNCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCNCTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTNNNCCCNCCTCTGAANNCTCCCANNC
  3   1   2       bld Ga18      in                      xlk154a22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TNGGGNGGTGNCGCTTTAAANCCCNCCAAAACTGGAGCNGTGGGATCTGNAAGCATCNNNCTTCATGAAAANNGNNCTCTGGANTATCAGATTCAANTTGCTGGTANAATGANTACTGTGACAGCTGTGACNCTGGAGANAAANCTCGNCGAAAAACAAAGAGAAATATTCTGCACGATATGAGCAAGGACTACCATGATGGNAGGNTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGNNGNACTCAGGGGACAAATAACCCCTCTGCTATACAGTGCCTGTGGNCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCNCCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGANNACTNCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATNCCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGNCGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATNNNNNNCNCCTCTGAANNCTCCCA
  3   1   2       bld Ga18      in                      xlk145b02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATCTGNTNGTNNTGCTNTNNNNNNCNNCAAAACTGGAGCTGTGGGNNCNGCNAGTNTTACNCNGCATGAAAATNNNNNTCTGGANNNTNAGATTCAANTTGCTGGTNCCATGAGTACTGTGACAGCTGTGACNCNNGAGACTAANNCTCGCAGNAAAACAANGCGAAATATTTTGCATGATTTGAGCAAGGACTACCATGATNNNANNGTCTGGGGATATTGGATAGATGCTAATGCCCGAGANCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAATTANCCCCTCTGTTATACAGTGNCTGTGGGCCAGATATGAGCAGCTCCCAATTCCTCTAGCTGGTCAGTTTGTGTCNCCNCCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCNCTGGATGAGNACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCNCTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCACAGGCACAGGGTAGTGTAAAAGACCTTGNCCTTGACCTTTTGGGACATCTAAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGGGGACAGATACACATNCCTAACAGCTGTGAATCTGGAGGAGTTTCTCTANCCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGNCGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGANNGTACCGTGATCTGTGATCCTATTGTGNCCNNCCTCTGAANNNNNCCA
  5   1   2       bld Ga12      in                         XL160g05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGAGCCTTTTACATACAAGTTCACAAGTGGTGCATTATAATATTAACACTTATATGTAAATGTGCAGCAAAGAACAACAAGAAATTGATGAGAACAATCAGTGCCATGAAGAAATCAAAACCAGAATGTATGATTCCTTGGTTAGAGAGGCCCCCTGGTCATAAATGCTTAAGGAGAGCAGGGATATCTAACATGTGCTCCCCAGCTACTGTTTAATCACAGGTCCAGGTTTCCAAAGGTTGCACGGAACTGTAGTTCAATGTGGTACTGATTAGTAAAGCTAAACTAAAGATATAATTTAGCAATTAATTATAATCTTGTCTTTGTTGTTATAGTGTATACTTCATTGTACTATATAGAAGTGGTTAGCCTTAGTTCTTAATATGCTATATTCTTGCTACTGGAAAGTACCATATTAAACatgtttctgtctttttgtctcctttcctccttctcttttgctgtctcattgtcctcttCTTATAATGACCACCTTTGTCTACTCGCTCCTTTCGCATCTTTTATTTTTTATCATAACTTCATATTATTTACTTTGTCTTCCTTGACCTATTGCTCCTCTTCCACTTCCTTACTTGTTCCTGCAGGCA
  5   1   2       chi Ga18      in                      xlk166b20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGGTGATGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAACGGAACTGTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGACACTGGAGACTAAACCTCGCAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAAATAACCCCTCTGTTATACAGTGGCCTGTGGNNNGNTATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTNNCACCTGCATTATCAGATTGTGGTGACTGGNCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGNTTGGNGAGGNCGGGGAGAGCTCTCCTGGACACAAGAGGNTNTTGAAGGNNTTCTATGGGTCAGAGGNAAGAGANATTAAAAAAGAGATGGTTTCTGGACAAATCTTTAGCAGACACGTAAANNNGGAANTTTCCTGGNAATTTNTNCAGCAGTCTCCCAGCAGAGT
  3   1   2       bld Ga18      in                      xlk143o12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GNGNGATGNNNNAANCCCNNNAAACNGANNTGTGGNNCNGCAAGNNTNNNCTGCATGAAAACGGANCTGTGNATNTNAGATTCAAANNGCTGGTNCCATGANNACTGTGACAGCTGTGACNCNGGAGNNTNANCCTCGCAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGCAAGGACTACCATGATGGAAGGNTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAAATAACCCCTCTGTTATACAGTGCCTGTGGNCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGNTTTCACTGGATGAGNACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGNNNCCNCCTCTGAACNCTNCCANNC
  5  -1   2       bld DMZ                                  xl254i05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAATCCCACCAAAACTGGAGCCGTGGGATCTGCAAGCATCACACTTCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACAATGAGTACTGTGACAGCTGTGACACTGGAGACAAAACCTCGCCGAAAAACAAAGAGAAATATTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACAGTGGCCTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATAC
  5   1   2       add DMZ       in                         xl320p02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCCCACCAATACTGGAGCCGTGGGATCTGCAANCATCACACTTCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACAATGAGTACTGTGACAGCTGTGACACTGGAGACAAAACCTCGCCGAAAAACAAAGAGAANTATTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGANACCTACATATGCTGTTACNAANTGAGCTCTTCCTCAATGTAGCGACAAANGACTTCCAGGANGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACAGTGGCCTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCACGACA
  3   1   2       bld Ga18      in                      xlk154e04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ANNCCCNCNNANCNGNAGCGNGGNATCTGNAAGCATCACNNTTCATGAAAATGGNNCTCTGGAATATNAGATTCAAATTGCTGGTACAATGANTACTGTGACAGCTGTGACNCTGGAGANAAAACNTCGCCGAAAAACAAAGAGAAATATTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGNTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGNNGAACTCAGGGGACAAATAACCCCTCTGCTATACAGTGCCTGTGGNCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCNCCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGNTTTCACTGGATGAGNACTNCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCNCTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTNNNCCCNCCTCTGAANNNNNCCANCC
  5   1   2       bld Ga18      in                      xlk129l22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAACTGGAGCCGTGGGATCTGCAAGCATCACACTTCATGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACAATGAGTACTGTGACAGCTGTGACACTGGAGACAAAACCTCGCCGAAAAACAAAGAGAAATATTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACAGTGGCCTGTGNNNNANATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGNTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGANTGTGGTGACTGGNCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGNTTTGCTGANNTTNGGAGAGNNCGGTGAGANCTCTCCTGGACACNAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGNGTAAAAGA
  3   1   2       bld Ga18      in                       xlk75j21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ANCTGNAGCNGTGGNATCTGNAANNNTNNNNCTCATGAAANNGNNCTCTGNNNNATCAGATTCAANNNCTGGTACNATGAGTACTGTNANAGCTGNGACNCNGGAGANAAAACNNNGCCGAAAANNAAAGAGAAANNTTCTGCACGATATGAGCAAGGACTACNATGATGGAAGGGTCTNGGGATATTGGATAGATNCTAATGCCCGAGNNCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCNAGGAAGGGGNACTCNNNNACAAATAACCCCTCTGCTATACANTGCCTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCNCCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGANNACTNCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGNACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGANGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTNNNCCCNNCTCTGAACNCTNCCAnnnnnnnnnTNNCAGA
  3   1   2       bld Ga18      in                      xlk104m14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGNAGNTGNNGGNNTCTGCNAGTATTACNCNGCANGAAAACGGAACTNNGNANNNNAGATTCANATTGCTGNNNCCATGAGNNNTGTGACAGCTGTGNCNCNGGAGNCTAACCTCGNAGGAAAANAAAANNNAANTATTTTGCNTGATTNGANNNANGACTACCNTGATGGAAGGNTCNGGGGATATNGGATAGATGCTAATNNCCGAGNCCTNCCATANGCTGTTACAAAGTGAGCTCTNNCTCAATGTAGCAACAAAGGNCTTCCAGGAAGGGGAGCTCAGAGGACAANNANNNNNTCTGTTATACNGNGCCTGTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCNCCNCCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGNACTNCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGNCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAANCGTACCGTGATCTGTGNTCCTATTGNGNNNNNCNCTGANCNNNNCCANCC
  5   1   2       bld Ga18      in                      xlk115o04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCTGTGGGATCTGCAAGTATTACACTGCATGAAAACGGAACTGTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGACACTGGAGACTAAACCTCGCAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAAATAACCCCTCTGTTATACAGTGGCCTGTGGCNNANATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACANGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGANCTTGACCTTGACCTTTTGGGANATCTGAGCCGGGGCACNGCNTTTATNCAAGTGAGCNCCAAACTGAATCCTCGTGGTNNAATTCGAGGACAGATACNCATACCNNNA
  3   1   2       bld Ga18      in                       xlk77i10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ANCTGNNNNTGTGGGATCNGCAAGTATTACCCNNCANNAAANNGNACTCTGNANNNNGATTCAANNNCNGGTNCCATGAGTACTGTGACAGCTGNGACACNGGAGNNTNNNNNNGCNNNAAAANAAANCGAAATNTTTTGCATGATTTGAGNAAGGACTACCATGATGGAAGGGTCNGGGGATNTNGGATANNTGCTAATNCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAATTANNCCCTCTGTTATACANNGCCTGTGGNCNAGATATGAGCAGCTCCCAATTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGNNTTCACTGGATGANNACTNCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCNCTAANCGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCACAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGNCCTTTTGGGACATCTAAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGGGGANAGATACNCATNCCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAANCGTACCGTGATCTGTGATCCTATTGTGNNCCCNCCTCTGAACNCTCCCA
  3   1   2       bld Ga18      in                      xlk135m07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGCATCNCCCTTCATGAAAATGGNACTCTGGAATATCAGATTCAAATTGCTGGTACAATGAGTACTGTGACAGCTGTGACNCNGGAGACAAAACCTCGCCGAAAAACAAAGAGAAANNTTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGNTCTGGGGATATTGGATAGATGCTAATGCCCGAGNNCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACAGTGCCTGTGGNCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCNCCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGNTTTCACTGGATGAGNACTNCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGNACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTNTNNNNCCNCCTCTGAACNNNNCCA
  3   1   2       bld Ga18      in                      xlk159l20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGTATTANNCTGCATGAAAACNNNNCTGTGGAATATCAGNTCAAATTGCTGGTACCATGANTACTGTGACAGCTGTGACNCTGGAGNCTNANNCTCGCAGNNAAACAAAGCGAAATNTTTTGCATGATTTGANCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGNNCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAAATAACCCCTCTGTTATACAGTGCCTGTGGNCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGNTTTCACTGGATGAGNACTNCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGNACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAANCGTACCGTGATCTGTGATCCTATTGTGNNNCCNCCTCTGAANNNNNCCANCNNNNNAANCANCAG
  5   1   2       bld Ga18      in                      xlk123m22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAAAATGGAACTCTGGAATATCAGATTCAAATTGCTGGTACAATGAGTACTGTGACAGCTGTGACACTGGAGACAAAACCTCGCCGAAAAACAAAGAGAAATATTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACAGTGGCCTGTNNNNNNTATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGNCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGNTTTGCTGAGCTTGGAGAGGNCGGTGAGAGCTCTCCTGGACACAAGANGNTNTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGNNCAGCATTTNTTCAAGTGAGNNCCAAACTGAATCCTCGTGGGGNANTTCGAGNNC
  3   1   2       bld Ga18      in                       xlk74l05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCATGAAAATGNNNTCTGGAATATNAGNTTCAANNNCTGGTACCATGAGTACTGTGACAGCTGNGACNCTGGAGNCTAANCCTCGCAGGAAAACAAAGCGAANNNNTTTGCATGATTTGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGNCCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGNNGAGCTCAGAGGACAATTANCCCCTCTGTTATACANTGCCTGTGGNCCAGATATGAGCAGCTCCCAATTCCTCTAGCTGGTCAGTTTGTGTCNCCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGNNTTCNCTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCNCTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGNCCTTTTGGGACATCTAAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGGGGACAGATACACATNCCTAACAGCTGTGAATCTGGAGGAGTTTCTCTANCCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAANCGTACCGTGATCTGTGATCCTATTGTGNCCCNCCTCTGAACNCTNCCA
  5   1   2       bld Ga15      in                       XL486l02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAAACGGAACTGTGGAATATCAGATTCAAATTGCTGGTACCATGAGTACTGTGACAGCTGTGACACTGGAGACTAAACCTCGCAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAAATAACCCCTCTGTTATACAGTGGCCTGTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCNAG
  5   1   2       bld Ga15      in                       XL449f15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCGCTGGAATATCAGATTCNAATTGCTGGTACAATGAGTACTGTGACAGCTGTGACACTGGAGACAAAACCTCNCCGAAAAACAAAGAGAAATATTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACAGTGGCCTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAG
  5   1   2       bld Neu7      in                         XL046c22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATTGCTGGTACCATGNAGTACTGTGACAGCTGTGNACACTGGCANACTAAACCTCGCAGGTAAAACAAAGCGAAATATTTTGCATGATTTGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAATTAACCCCTCTGTTATACAGTGGCCTGTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACT
  5   1   2       bld Tbd7      in                         XL072j15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCTGGTACCATGGNTACTGTGCACAGCTGTGACACTGGTANACTAAACCTCGCAGGGAAAACAAAGCGAAATATTTTGCATGATTTGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAATTAACCCCTCTGTTATACAGTGGCCTGTGGGCCAGATATGAGCAGCTTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTNCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGG
  5   1   2       bld Ga18      in                        xlk3l16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAGTACTGTGACAGCTGTGACACTGGAGACAAAACCTCGCCGAAAAACAAAGAGAAATATTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACAGTGGCCTGTGGnnnnnnnnTGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGNGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGNTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGANCTTGACCTTGAACTATTGGGACATCTGAGCCGNGCACAGCATTTATNCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTNACAGCTGTGAATCTGGAGGAGNTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCNNNACCCTNACGATCTTCNGAAAGACCCCAGAGCAT
  5   1   2       bld Gas5                            IMAGE:3749550.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTACTGTGACAGCTGTGACACTGGAGACTAAACCTCGCAGGAAAACAAAGCGAAATATTTTGCATGATTTGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCANAGGACAAATAACCCCTCTGTTATACAGTGGCCTGTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTNCATGGTTNTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTTGAATCC
  5   1   2       bld Ga18      in                      xlk161m19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAACCTCGCCGAAAAACAAAGAGAAATATTCTGCACGATATGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACAGTGGCCTGTGGNNNANATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTTATCAGANTNTGGNGACTGGNC
  3   1   2       chi Ga18                             rxlk114j14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GNNNANAANNNNNNCGAAANNNAANAGAAANNTCTGCNNNNATATGNNNAANGACTACNTGANNNNGGGTCNGGGGATNNNNATAGATNNTAATGCCCNAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCANNGTAGCGACAAAGGNCTTCCAGGNAGGGGANCTCAGGGGACAAATAACCCCTCTGCTATACAGNGNCTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCNCCTCCCATCAGGACAGGTTCAGCAGNTCATGCATGGGTTTCACTGGATGANNACTNCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGNNACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGNNCCCNCCTCTGANNNNNNCCA
  3   1   2       chi Ga18      in                      xlk114n20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGAAAAACAAANNNNAAATNNTNTGCNCNANNNGAGCAANNNCTNCCATGATNGAANGGNTCTGNGGATNNTNGNATAGATNCTAATGCCCGAGACCTANATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTNCNNGGAANGGGAACTCAGGGGACAAANACCCCTCTGCTATACAGTGCCTGTGGNCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGNTCATGCATGGNTTTCACTGGATGAGCACTNCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGANCCGGGNNACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGNNNNCCNCCTCTGAAC
  3   1   2       bld Ga18      in                      xlk162j11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCGNCGAAAANNAANGAGAANNNTCTGNNNGATATGAGNAAGGACTACCATGATGNANGGGTCTGGGGATATTGGATAGATNNTAATGCCCGAGNCCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACAGNGCCTGTGGNCCAGATATGAGAAGCTCCCANTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGNTTTCACTGGATGANNACTNCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGANNCGGGNNACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGNNCCCNCCTCTGAANNNNNCCANNNNNCNNTTNNCA
  3   1   2       chi Ga18                               rxlk3i13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CNNNANCNAANNNNAANNTTCTGCNCGATATGANNNNGNCTACNATGANGNNNGGTCTGGGGATNNGNATAGATNNTAATGCCCGAGNCCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGANCTCAGGGGACAAATANCCCNTCTGCTATACANGTGCCTGTGGGCCAGATATGAGAAGCTCCCANTTCCTCTAGCTGGTCAGTTTGTGTCNCCTCCCATCAGGACAGGTTCAGCAGNTCATGCATGGNTTTCACTGGATGANNACTNCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGANNCGGGNNACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGNAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGNTCCTATTGNNNNCCNCCTCTGAA
  5   1   2       bld FaBN                            IMAGE:8076304.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAAAGAGAAATATTCTGCACGATATGTTGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACAGTGGCCTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAGACCCCAGAGCATGCTCTTTCGAAAGTCAACTAAAGGCCAATGGTTCACGATGGGCTTCAA
  3   1   2       bld Ga18      in                      xlk162m06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CNNNGAAAACAAANCNAANNNTTTGCNNGATTNNNNNANGGACTNCNTGATGGAAGNGTCNNGGGANNTNGNANAGATNNTAATGCCCGAGACCTACANATGNTGTTACAAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGNNTTCCAGGAAGGGGAGCTCAGAGGACAAATAACCCCTCTGTTATACNGNGNCTGTGGNCCAGATATGAGCAGCTCCCANTTCCTCTAGCTGGTCAGTTTGTNTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGNNTTCACTGGATGNNNACTNCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGANNCGGGNNACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAANCGTACCGTGATCTGTGATCCTATTGTGNNCCNCCTCTGAA
  3   1   2       bld Ga18      in                        xlk6l10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AANAAAANCGAANNNTTTTNCATGATTTGANNAANGACTACCATGANGNNNGNTCTGNGGATNTTGNNNNNNNGCTAATGCCCGANNCTACNNATGCTGTTNNAAAGTGNNNTCTNCCTCAATGTAGCAACAANGGACTTCNANGAAGGGGAGCTCAGAGGACAAATAACCCCTCTNNTATACAGNGNCTGTNGGNNAGATATGAGCAGCTCCCANTTCCTCTAGCTGGTCAGTTTGTNTCACCACCAATCAGGACAGGTTCAGCAGNTCATGCATGGGTTTCACTGGATGANNACTNCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGANNCGGGGNACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAANCGTACCGTGATCTGTGATCCTATTGTNNNCCNCCTCTGAA
  3   1   2       bld Ga18      in                       xlk67f02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAGCGAAAATATTTNNNNTGATTTGANCAAGGNCTNCCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTNATNNCCGAGACCTACATANGCTGTTACAAAGTGAGCTCTTCCTNNNNGTAGCAACAANGGNCTTCCAGGAAGGGGAGCTCAGAGGACAAATAACCCCTCTGTTATACANNNNCTGTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCNCTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCNCTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGNACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAANCGTACCGTGATCTGTGATCCTATTGNNNNCCNCCTCTGAANNNNNCCA
  3   1   2       bld Ga18      in                      xlk163h12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAANNNNAATNTTTNNNTGATTNNNNNANGGACTACCATGATGGNAGGNNCTNNGGATATTGGANAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGNNCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGNGCTCAGAGGACAAATANNCCNTCTGTTATACAGNGNCTGTGGNCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCNNCNCCAATCAGGACAGGTTCAGCAGGTCATGCATGGNTTTCACTGGATGANNACTNCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCNCTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGANNCGGGNCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAANCGTACCGTGATCTGTGATCCTATTGTGNNCCCNCCTCTGAA
  3   1   2       bld DMZ       in                         xl318p20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACGATATGAGCAAGGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACAGTGGCCTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGC
  3   1   2       bld Ga18      in                      xlk129l22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ANGNACTACCATGANNNNNGTCNGGGGANNNNNANNGANNNTAATGCCCGAGACCTACATATGCTGTTACAANGTGNGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGNNTCAGGGGACAAATAACCCCTCTGCTATACAGNGCCTGTNGNCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGNNTTCACTGGATGANNACTNCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGANNCGGGNNACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTNNNNCCNCCTCTGAA
  5   1   2       bld Emb1                            IMAGE:6863834.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGACTACCATGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAATTAACCCCTCTGTTATACAGTGGCCTGTGGGCCAGATATGAGCAGCTCCCAATTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTAAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGGGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGAAGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCCTGGGTTCACAATGGGGCTCCAGAAGTATGACAGGGAAATGCTTCTATGGGGTAGCCTGTCACAAAACCGTACCGTGGATCTGTGAATCCTATTGTGGGCCCCGCCCTCTGAACATGCCTCCCAGCCTGGTCCCAAACATTCAAATCAGNTGTTTGTCCCTGTATGCCGAAAGAATAAAAAAGGAAATGGAGAAG
  3   1   2       add Ga18      in                      xlk150m19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ANGGACTACCANGATGNNNGGNNCNGGGGANATNNNATANANNCTNATGNCCGAGNCCTANANATGCTGTTNCAANGTGAGCTCNTNCTCAATGTAGCAACAAAGGACTNCCANGAAGNGGAGCTCAGAGGACAATTANCCCCTCTGTTATANANNNNCTGTGGNCCAGATATGANCAGCTCCNNNTTCCTCTAGCTGGTCAGTNTGTNTCACCACCAATCAGGACAGGTTCAGCAGNTCATGNATGGNNTTCNCTGGATGANNACTNCCNCCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCNCTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCACAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTNNNNNNGGNNACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGGGGACAGATACACATNCCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGNNANTNCCGTGATCTGTGATCCTATTGTGNNCCCNCCTCTGA
  3   1   2       bld Ga18      in                       xlk60e05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCANGGACTNCCATGATGNAGGGTCNNGGGATNTNNATAGANNCTNNTNCCGAGACTACATANGCTGTTACAAAGTGAGNTCTTCCTCANNGTAGCANCAAAGGACTTNNANGAAGGGGNGCTNNGNGGACAAATNACCCNTCTGTTATACANNGCCTGTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTNTGTGTNNNCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCNCTGGATGANNACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGNACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAANCGTACCGTGATCTGTGATCCTATTGTGNNCCCNCCTCTGAACNNNNNCA
  5   1   2       add Ga18      in                       xlk54h05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GANTACCATGATGGAAGGGNCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAATTAACCCCTCTGTTATACAGTGGCCTGTGGNNNATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGNGACTGGNCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGNTTTGCTGAGCTTGGNGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGNTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGANCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACCGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGNGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCNAGAGCATGNTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTC
  5   1   2       add Ga18      in                       xlk51b23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAATTAACCCCTCTGTTATACAGTGGCCTGTGGGNNNNNTGAGCAGCTCCCAATTCCTCTAGCTGGNCAGTTTGTGTCACCACCAATCAGGACAGGNTCAGCAGGNCATGCATGG
  5   1   2       bld DMZ       in                         xl295d02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGGAAGGGTCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAATTAACCCCTCTGTTATACAGTGGCCTGTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGANCACTGCCACCTGCATTATCANATTGTGGTGACTGGTCTGGGTAAGGCANAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAANAGGTTGTTGAAGGGCTTCTATGGGTCANAGGCACAGGGNAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCTAGTGAGCACCAGACTGAATCCTCGTGGTGAAATTCNAGGACAGATACGCATACCTNACCGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTA
  3   1   2       bld Ga18      in                       xlk51c16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGNTCTGGGGNNNNNGATAGATNCTAATGCCCGAGACCTACATATGCTGNTACAAAGTGAGCTCTTCCTCAATGTAGCGANAAGNNNTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACAGNGNCTGTGGNCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGNACTNCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGANNCGGGNNACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTNNNCCCNCCTCTGAACNNNNCCA
  3   1   2       bld DMZ       in                         xl261j19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACAGTGGCCTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCA
  5   1   2       bld FaBN                            IMAGE:8076355.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGGGATATTGGATAGATGCTAATGCCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAATTAACCCCTCTGTTATACAGTGGCCTGTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACCGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAAGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTA
  5   1   2       add Ga18      in                       xlk64o09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAGATGCTAATGNCCGAGACCTACATATGCTGTTACAAAGTGAGCTCTTCCTCAATGTAGCAACAAAGGACTTCCAGGAAGGGGAGCTCAGAGGACAAATAACCCCTCTGTTATACAGTGGCCTGTNNNNNATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTNTGGTGACTGGNCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGNTTTTCTGAGNTTGGNGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGNTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGANCTTGACCTTGANCTTTTGGGANATCTGAGCCGGGGCACAGCATTTATCCNAGTGAGCACCAAACTGAATCCTCGTGGTGAAANTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGNCTNAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTNACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGNNCACAATGGGCTCCAGANTATGACANGNAANNGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGT
  3   1   2       bld Ga18      in                        xlk3l16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAATGCCCGAGNNCTACNNATGCTGTTACAAAGTNNNCTCTTCCTCAATGTAGCGACAAAGGACTTCCAGGAAGGGGNACTCNGGGGACAAATAACCCCTCTGCTATANAGTGCNTGTGGNCNAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGNTTTCACTGGATGANNACTNCCNCCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGNCGGGNNACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTNNNNCCNCCTCTGAA
  3   1   2       bld Ga18      in                       xlk53o01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTNATNNCGAGNCCTNNNNANGCTGNTACAAAGTNNNNNCTTCCNCAATGTAGNACAAAGGACTNNCANGAAGGGGNGCTCAGAGGACAATTANCCCNNNTNTTATACAANNGCNTGTGGNCCAGATATGAGCAGNNNCNAGTTCCTCTAGCTGGTCAGTNTGTNTCNCCNCCAATCAGGACAGGTTCAGCAGGTCATGCATGGNTTTCNCNGGATGNNNCTNCCACCTGCATTATCAGATTGTGGTGNCTGGTCTGGGTAAGGCAGAGGACGCTGCACTANNCGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGNCCTTTTGGGACATCTAANCCGGGNNACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGGGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAANCGTACCGTGATCTGTGATCCTATTGTNNNCCNNCTCTGA
  3   1   2       bld Ga18      in                        xlk1o23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTAATGCCCGAGNCNACATANGNNGTTNCAAAGTNNNCTNTTNCTCAATGTANNAACAAAGGANTTNNAGGAAGGGGAGCTCAGAGGACAAANAACCCCTCTGTTATACANNNNNNGTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTNTCACCACCANTCAGGACAGGTTCAGCAGGTCATGCATGGNNTTCACTGGATGANNACTNCCNCCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGANNCGNNNNCAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAANCGTACCGTGATCTGTGATCCTATTGTGNNNCCNCCTCTGAACNC
  3   1   2       bld Ga18      in                       xlk59e07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATNCCCGAGACTACATANGCTGTTACNAAAGTGAGCTCTTCCTNNNTGTNGCANCAAANGACTTCCAGGANGGGGAGCTCAGAGGACAATTANNNCCTCTGTTATACANTGNCTGTGGNCCAGANATGAGCAGCTCCCANTTCCTCTAGCTGGTCAGTTTGNNTCNCCNCCAATCAGGACAGGTTCAGCAGNTCATGCATGGNNTTCACTGGATGANNACTNCCNNCTGCATTATCAGATTGTGGTGNCTGGTCTGGGTAAGGCAGNNGNCGCTGCNCTANNNNNACATCTNCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCANAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTAAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGGGGACAGATACACATNCCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGANCATGNTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCNCCAGAGTATGACANGAAATGCTCNNNNNGTAGNT
  3   1   2       bld Ga18      in                      xlk110j23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TNNCGAGACCTACNNATGCTGTTACAAAGTGAGCTCTTCCNCAATGTAGCAACAAAGGACTTCNNGGANGNNGNGCTCAGAGGACAAATAACCCNTCTGTTATACANNGCCTGTGGNCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCNCCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGNNTTCACTGGATGANNACTNCCNCCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGNNACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAANCGTACCGTGATCTGTGATCCTATTGTGNNCCCNCCTCTGAA
  3   1   2       bld Ga12                                 XL161g05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGTTGCACGGAACTGTAGTTCAATGTGGTACTGATTAGTAAAGCTAAACTAAAGATATAATTTAGCAATTAATTATAATCTNGTCTTNGTTGTTATAGNGTATACTTCATTGTACTATATAGAAGTGGTTAGCCTTAGTTCTTAATATGCTATATTCTTGCTACTGGAAAGTACCATATTAAACATGTTTCTGTCTTTTTGTCTCCTTTCCTCCTTCTCTTTTGCTGTCTCATTGTCCTCTTCTTATAATGACCACCTTTGTCTACTCGCTCCTTTCGCATCTTTTATTTTTTATCATAACTTCATATTATTTACTTTGTCTTCCTTGACCTATTGCTCCTCTTCCACTTCCTTACTTGTTCCTGCAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACCGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATC
  3   1   2       chi Ga18      in                       xlk62m20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTACATATGNTGTTACNNNNTGANNNNTTCCTNNNTGTAGCANCAAAGGNCTNCCANGAANGNGNNNTCAGAGGACAAATAACCCCTCTGTTATACNNNGCCTGTGGNCCAGATATGAGCAGCTCCNAGTTCCTCTANCTGGTCAGTTTTGTGTCNCCNCCANTCAGGACAGGTTCAGCAGNTCATGCATGGNTTTCACTGGATGANNACTNCCNCCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGANNCGGGNNACAGCATTTATCCAAGTGAGCACCAANCTGANNCCTCGTGGTGAAATTCGAGGACAGATACACATNCCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAANCGTACCGTGATCTGTGATCCTATTGTGNNNCCNCCTCTGAACNNNNCCANCC
  5   1   2       bld Ga12      in                         XL161f20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTCAATGTAGCAACAAAGGACTTCCANGAAGGGGAGCTCAGAGGACAATTAACCCCTCTGTTATACAGTGGCCTGTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTC
  3   1   2       bld Ga12      in                         XL207p23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTAGCGACAAAGGACTTCCAGGAAGGGGAACTCAGGGGACAAATAACCCCTCTGCTATACAGTGGCCAGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGCCAGATCAG
  5  -1   2       bld Bla2                            IMAGE:7296303.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTAGCAACAANGGACTTCCAGGAAGGGGAGCTCAGAGACAAATTAACCCTTCTGTTATACAGTGGCCTGTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTGTGTGaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCATTCGCCTAAGAGT
  5   1   2       bld Ga18      in                       xlk77d05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ANNNTNCCAGGAAGGGGANCTCAGGGGANAAATAACCCCTCTGCTATACAGTGGCCTGTnnnnnnnnnTGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGANGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGNTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGANCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGNACAGNATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGNAATATATGAGGAGGGAAGGNAGNNNNCCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGCCAGATCAGTGCTGTCCTNTGTGTGAAGaaaaaaaaGNAANGAGAGANGNGAAAAANCAG
  3   1   2       bld Gas6      in                    IMAGE:3437942.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAGCACAATATTCAACCCCTATNTAGTTATATCCAGGGAGCCTGTGGACACAGAATATTAGCAAGCTCCCATATTCCTCTAGACAGGTCAGTTTTGTGTCACCACCAATCAGGCCAGGTACAGCAGGTCATGCATGGGTTTCACTGTATGAGCACTGCCACATGCAATATCAGATTGTGGTGACTGGTCTGGGTAGGCAGAGCACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCATGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTAAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGGGGACAGATACACATACCTACCAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTATGCGAAA
  3   1   2       bld Ga12      in                         XL161f20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGAAGGGGAGCTCAGAGGACAATTAACCCCTCTGTTATACAGTGGCCTGTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCAGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTAAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGGGGACAGATACACATACNTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATC
  5   1   2       bld Tbd7      in                         XL103h02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGAGCTCAGAGGACAAATAACCCCTCTGTTATACAGTGGCCTGTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCA
  3   1   2       bld Ga18      in                      xlk104d03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGGGAGCTCAGAGGACAAATAACCCCTCTGTTATACAGTGCCTGTGGNCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTNTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCNCTGGATGAGNACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGANAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAANCGTACCGTGATCTGTGATCCTATTGTGnnnnnCCTCTGAAnnnnnnCAnnnnnnCAANCATCAGA
  3   1   2       bld Ga12                                 XL164j14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCAGGGGACAAATAACCCCTCTGCTATACAGTGGCCTGTGGNCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTGCCAGATC
  5  -1   2       bld Bla2                            IMAGE:7298122.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCACAGATGATCGATCGTCATGTGTCAGGTTGGCAGGGCATGGATACTGCAGAACAGGAATTTCAGTTGGCAGATACAGATGAGAGTCCAATCCTTAGTGTCGTTGGTCACACATCAGGACAGTTCACAGTCAGCAGGGTTCATGGAGAGCATCCACCGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTAAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGGGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTATGCGaaaaaaaaaaaaaaaaaCTCGAGGGGGCCCGTACCCATCGCCTAAGATA
  5   1   2       bld Ga18      in                      xlk104d03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGGGAGNTCAGAGGNCAAATAACCCCTCTGTTATACAGTGGCCTGNGNCNNATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGNTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGNCACAGNATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGNCCGCCTCTGAACTGCTCCCAGCCTGTCCNAACATCAGATCAGTGTTGTCCTGTGTGTGAAGaaaaaaaaaa
  3   1   2       bld Ga12      in                         XL141e22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTCAGAGGACAAATAACCCCTCTGTTATACAGTGGCCTGTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACATACCGTGATNCTGTGATCCTATTGTGTGCCCGCCNCTGAACTGGCNCCCAGNCCTGTNCCAAAC
  3   1   2       bld Neu7      in                         XL007e05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACAAATAACCCCTTCTGCTATACAGTGGCCTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGACAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGCCAGNATCAGTGC
  3   1   2       bld Ga12      in                         XL168o23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGACAAATAACCCCTNTGCTATACAGTGGCCTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTGCCAGATC
  5   1   2       bld Ga15      in                       XL449f23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATAACCCCTCTGCTATACAGTGGCCTGTGGGCCAGATATGAGAAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCA
  3   1   2       add Ga18      in                        xlk6a21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGAGGNNANNANCCCTCNNTTATANAGNGCNNNGGNNAGATATGANCAGCTCCCAATNCNNCTANCTGGTCAGTNNNTNTCACCNCNNATCAGNACAGGTTCAGCAGNTCATGCATGNNTTTCNCTGGATGANNNCTNCCNCCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTANNCGCACNTCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCACAGGCACAGGGTAGTGTAAAAGACCTTGNCCTTGNCCTTTTGGGACATCTAANCCGGGNNACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGGGGANAGATACACATNCCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAANCGTACCGTGATCTGTGATCCTATTGTGNNCCCNCCTCTGAAC
  3   1   2       bld Neu2      in                    IMAGE:2942746.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATCAGTGGCTTGTGGGCAAGATATGACCAGCTTCCAATTCTTCAGGCTGGTCAGTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTAAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGGGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCAAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTATGCGAAGAAAA
  5   1   2       bld Ga18      in                      xlk109n24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGCCAGATATGAGCAGCTCCCAATTCCTCTAGCTGGTCAGTTTGTGTCACCACCAATCAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTAAGCCGGGNNACAGNATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGGGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGNCTGTCCNAACATCAGATCAGTGTTGTCCTGTATGCGAAGaaaaaaaagaaatgagagaggtgaaaaaaacagagagaaCTCGCACAA
  3   1   2       bld Ga18      in                       xlk52n23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGATATGANNAGCNNCNAGTNNCNCTAGCNGGTCAGTNTGTNNCNNCNCCAATCAGGACAGGTTCAGCAGGTCATGCATNNNNTTCACTGGATGNNNCTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGNTAAGGCAGAGGACGCTGCNCTANACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACNAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGNCGGGNNACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAANCGTACCGTGATCTGTGATCCTATTGTGNNCCCNNCTCTGAACNCNNCCANCNNNNNAAAC
  5   1   2       add Ga18      in                      xlk124n20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGAAGNTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCTCCCATCAGNACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGNCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGNTTTGCTGAGNTTGGAGAGGNCGGTGAGAGCTCTCCTGGACACAAGAGGNTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGANCTTGANCTTGAACTATTGGGACATCTGAGCCGGGNNACAGNATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGNTTCTCTAACCCCTGAAGAGNCTGAGTATGAATNTGAAATATATGAGGAGGGAAGGNNGNNNNCCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGNCAACTAAGGGCCATGGNTCACGATGGGNTCCAGACTATGACAGGAAANGCTCTGTGTNCAGNTNTCAGAAGCGTACCGTGNTTTGNNATCCTNTTGTGTNCCCNCCTCTGAACTNCTCCCAGCCTGTCCNTTTNCA
  3   1   2       add Ga18      in                       xlk56p24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGANANNNNCNANNNCNCTAGCTGNTCANNTNNNNNCNCCNCCCATCAGGACAGNTTCAGCAGGTCATGCATNGNNTTCACTGGATNNNNNTNCNNNCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAANGCAGAAGATGCTGCNCTGNACGCACATCTACATGNTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACNAGAGGTTGTTAAAGGGCTTCTATGGNTCAGAGGCACAGGGTAGTGTAAAAGNCCTTGACCTTGAACTATTGGGACATCTGNNNNGGNNACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTNTNNNNCCNCCTCTGAACNNNNNCANC
  3   1   0       chi Ga18      in                       xlk51b23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCANTNCNNNCTAGCNGNTCAGTnnnnnnnnCCACCAATNAGGANNGGTNCANCAGNTCATGCATGGGNTNCACNGGANGANNACTNCNNCCTGCANTATCAGATTGTGGTGACTGGTCTGGNTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTNCTGGACACNAGAGGTTGTTGAAGGGCTTCTATNGNTNACAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGNCCTTTTGGGACATCTAANNCGNGNNACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGGGGANAGATACACATNCCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAANCGTACCGTGATCTGTGATCCTATTGTGNNNCCNCCTCTGAAC
  5   1   2       bld Ga15                               XL403l16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTCCCTCTTTCTCCTGACATTATCTTTCTTTTGCAACCTGCCTGCTGTGTTAATTGACTACCTTGGGATATTCACTCATTTCACATCttttttttCTCAACATTATATTATTTACTTCCTGTCTTAACCTCTGTCACATTCTTTTTCTCTTCCTCGACCTATTGCTCCTCTTTTACTTCCTTGCTCATTCCTGCAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGCCAGATCAGTGCTGTCCTGTGTGTGAAGaaaaaaaagaaatgagagaggtgaaaaaaCCAGAGAGGGCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGCTCATGGAAGGCAGCTGGNACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCAT
  3   1   2       bld Neu7      in                         XL019m06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGACAGGTTCAGCAGGTCATGCATGGGTTTCACTGGATGAGCACTGCCACCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTAAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGGGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCA
  5   1   2       bld Ga12      in                         XL202h07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGCTTTCTTTTGCCCCTGCCTGCTGTGTTAATTGACTACCTTGGGATATTCACTCATTTCACATCttttttttCTCAACATTATATTATTTACTTCCTGTCTTAACCTCTGTCACATTCTTTTTCTCTTCCTCGACCTATTGCTCCTCTTTTACTTCCTTGCTCATTCCTGCAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAA
  5   1   2       bld Ga12      in                         XL203h07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCTTTCTTTTGCACCCTGCCTGCTGTGTTAATTGACTACCTTGGGATATTCACTCATTTCACATCttttttttCTCAACATTATATTATTTACTTCCTGTCTTAACCTCTGTCACATTCTTTTTCTCTTCCTCGACCTATTGCTCCTCTTTTACTTCCTTGCTCATTCCTGCAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGCCAGATCAGTGCTGTCCTGTGTGTGAAGaaaaaaaaaGAAATGAGAG
  3   1   2       bld Ga12      in                         XL160g05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCTCCTTTCCTCCTTCTCTTTTGCTGTCTCATTGTCCTCTTCTTATAATGACCACCTTTGTCTACTCGCTCCTTTCGCATCTTTTATTTTTTATCATAACTTCATATTATTTACTTTGTCTTCCTTGACCTATTGCTCCTCTTCCACTTCCTTACTTGTTCCTGCAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACCGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTAT
  5   1   2       bld Tbd7      in                         XL102n20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTGTGTTAATTGACTACCTTGGGGATATTCACTNCATTTAACATACttttttttCTCAACATTATATTATTTACTTCCTGTCTTAACCTCTGTCACATTCTTTTTCTCTTCCTCGACCTATTGCTCCTCTTTTACTTCCTTGCTCATTCCTGCAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGNTGNCAGAAGCGNAC
  5   1   2       bld Ga18      in                       xlk63d01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCACTGNCACCTGCATTATCAGATTGTGGTGNCTGGTCTGGGTAAGGCAGAAGATGCTGCACTGAACGCACATCTACATGGTTTTGCTGAGCTTGGAGAGGTCGGTGAGAGCTCTCCTGGACACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGNNNNNAGCATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGNNNNCCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTNTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGCCAGATCAGTGCTGTCCTGTGTgtgaagaaaaaaaagaaatgagagaggtgaaaaaaCCAGAGAGGGCTCGCACAAGTGAAGNCTGCTTTTTTGATGGAGATCGCTCATGGAAGGNAGCTGGNACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATNTGCCATTTNCACCTGCAAGGGTTCC
  5   1   2       bld Tbd7      in                         XL084g08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCACGAGGGATNGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACCGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTGTGTGAagaaaaaaaagaaatgagagaggtgaaaaaaccagagagaACTCGCACAAGTGA
  5   1   2       bld Ga14                               Ga14-p10e2.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGATTGTGGTGANTGGTCTGGGTAAGGCAGAGGACGCTGCACTAAACNCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGA
  5   1   2       bld Ga12      in                         XL193j20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCTTATAATGACCACCTTTGTCTACTCGCTCCTTTCGCATCTTTTATTTTTTATCATAACTTCATATTATTTACTTTGTCTTCCTTGACCTATTGCTCCTCTTCCACTTCCTTACTTGTTCCTGCAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACCGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCA
  5   1   2       bld Ga18      in                      xlk124l12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTCTTATAATGACCACCTTTGTCTACTCGCTCCTTTCGCATCTTTTATTTTTTATCATAACTTCATATTATTTACTTTGTCTTCCTTGACCTATTGCTCCTCTTCCACTTCCTTACTTGTTCCTGCAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGNNNNCAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACCGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTGNGTGAAGnaaaaaaagaaatgagagangngaaaaaaccagagagaACTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCNNTCATGGAAGGCGNNTGGNACACGNTGGCATCCTTTCGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTNCAGGGGTNCGACTNGAGAAGNNNACTGTGAGAAGGNNACCTGTCNAAAACTTTCCTGTACCANCCCNANTCGTGCCNNTNCATCTGATNC
  5   1   2       bld Ga18      in                      xlk151l18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTGGGTAAGGNAGAGGNNNCTGCACTAAACGCACATCTCCATGGTTTTGCTGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGNNNNCAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTGTgtgaagaaaaaaaagaaatgagagaggtgaaaaaaCCAGAGAGAACTCGCACAAGTGAAGNCTGCTTTTTTGATGGAGATCGTTCATGGAAGGNGGCTGGTACACGTTGGCATCCTTTTGTNCCTCCATTTNGTCTAATTNAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGNNNACTGTGAGANNNGACCTGTCCAAAACTTTNCTG
  3   1   2       add Ga18      in                       xlk78a09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAGCTTGGTGAGGTCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGAGAGANANACATNCCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGANGATCTTCGGAAAGACCNAAGAGCATGCTTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGNAGGAAATGCTCTATGTGTAGCTGNNGAAACGTACCGTGATCTTGATCCTATTGTNNNCNNCCTCTGAACNNNNCCA
  5   1   2       bld Ga18      in                       xlk78a09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAGCTTGGTGAGGNCGGGGAGAGCTCTCCTGGACACAAGAGGTTGTTGAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGGNNNNAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCANNNNNNGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTGTGTGAAGaaaaaaaaaa
  5   1   2       bld Ga18      in                      xlk111l23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGAGANCTCTCCTGGACACAAGAGGNTGTTAAAGGGCTTCTATGGGTCAGAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGNNNNCAGNATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGNNNNCCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGCCAGATCAGTGCTGTCCTGTGTGTGAAGaaaaaaaagaaatgagagaggtgaaaaaaCCAGAGAGGGCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGCTCATGGAAGGCAGCTGGNACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAAGGGTTCCACTGGAGAAGNGCACTGTGAGAANNGANCTGTCCAAAACTTTCCTGTACCAACCCAATCCGTGCCNATCCTTCTGATTNCTGNNNNNGNNNCCAGTANNG
  5   1   2       bld DMZ       in                         xl236g05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACTTCCTTACTTGTTCCTGCAGGCACAGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTAAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGGGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTATGCGAAGaaaaaaaagaaatgagagaggtgaaaaaaacagagagaaCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAAAG
  5   1   2       bld Ga18      in                       xlk65d11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAGGGTAGTGTAAAAGACCTTGACCTTGAACTATTGGGACATCTGAGCCGNNNNNAGNATTTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGNCNNCCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGCCAGATCAGTGCTGTCCTGTGTgtgaagaaaaaaaagaaatgagagaggtgaaaaaaCCAGAGAGGGCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGCTCATGGAAGGCAGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGNCTAATTAAATGTGCCATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCACTGTGAGANGNNGACCTGTCCAAAACTTTCCTGTACCAACCCAATCCGTGCCAATCCTTCTGATTGCTGCAANNNGTGNCCAGTAGAGGAGCGGAGNNNTATGGAACTGGCAGANAGTATGCAGTCAGATGGNGCAGGNTCATGCAGATTTGGGNNTC
  5   1   2       bld Ga18      in                      xlk123g16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGGTAGTGTAAAAGACCTTGACCTTGACCTTTTGGGACATCTGAGCCGNNNNCAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTGTgtgaagaaaaaaaagaaatgagagaggtgaaaaaaCCAGAGAGAACTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGNNCACTGTGAGAAGGTGANCTGTNNNAAAANTT
  5   1   2       bld Gas5      in                    IMAGE:3749426.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTTGACCTTGACCTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACCGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGAT
  3   1   2       bld Ga18      in                       xlk62a15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACATCTNAGCnnnnnnnnGCATTTNNCNAAGTGANNNNNAANCTGAANCCTCGTGGTGAAATNNGGGGNNAGANACANATNCCTNNCAGCTGTGAATCTGGAGGAGTTTCTCTANCCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAANCGTACCGTGATCTGTGATCCTATTGTGNNCCCNCCTCTGAAC
  3   1   2       bld Gas5      in                    IMAGE:3749426.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGAGGACAGATACACATACCTAACCGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGNGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTGTGTGAAA
  5   1   2       bld Ga18      in                      xlk135c23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTATTCAAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGNNNNCCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGNNTCCAGACTATGACAGGAAANGCTCTGTGTGCAGCTGTCAGAAGCGTANCGTGNNTTGTGATCCTATTGTGTGCCCNCCTCTGAACTGCTCCCAGCCTGTNCATTTGCNAGATCAGTGCTGTCCTGTGTGTGANGNaaaaaaaaGNAANG
  5   1   2       bld Ga18      in                      xlk148h09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTATTNNAGTGAGCACCAAACTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCNNNCCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGCCAGATCAGTGCTGTCCTGTGTGTGAAGaaaaaaaagaaatgagagaggtgaaaaaaCCAGAGAGGGCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGCTCATGGAAGGNAGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATCCGTGCCAATCCTTCTGATTGCTGCNNNNNTGCCCAGTAGAGGAGCGGAGNNCTATGGAACTGGCAGACAGTATGCAGNCAGATGGAGCAGGATCATGCAGNNTTGGGCGTCACTGGTACCCAAATCATGAGCGNTGGNATCCAACTNTNCCACCCTTTGGAGAGANGAAATNNG
  5   1   2       bld Ga18      in                      xlk162b21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTATCCAAGTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGGGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTATGCGAAGaaaaaaaagaaatgagagaggtgaaaaaaacagagagaaCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGAGGAGCTGAGTNCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTNNCCAAATAATGAGCNCTGGCATCCNACTGTGCNACCCTTT
  5   1   2       bld DMZ       in                         xl249c17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCGATTCGCTGAATCCTCGTGGGGAAATTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAANAGCCTGAGTATGAATATGAAATAAATGAGGAGGGAAGACAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGCCAGATCAGTGCTGTCCTGTGTgtgaagaaaaaaaagaaatgagagaggtgaaaaaaCCAGAGAGGGCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGCTCATGGAAGGCAGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATCCGTGCCAATCCTTCTGATTGCTGCAAGCAGTGCCCAGTAGAGGAGCGGAGTCCTATGGAACTGGCAGACAGTATGCAGTCAGATGGAGCAGGATCATGCAGATTTGGGCGTCACTGGTACCCAAATCATGAGCGTTGGCATCCAACTGTGCCACCCTTTGGAGAGAT
  5   1   2       bld Ga18      in                        xlk7a14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGAGCACCAAACTGAATCCTCGTGGTGAAATTCGGGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTATGCgaagaaaaaaaagaaatgagagaggtgaaaaaaacagagagaACTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCTGAGTTCTTTGGAGCTGGNAGACAGTATGCAGTCAGATGGATCANCACGATCATGCAGATTTGGCCGTCAGNGGNACCNAAATAATGAGCNCTGGCATCCAACTGTGNNANCNTTTGGAGAGNNG
  5   1   2       bld Ga18      in                      xlk142b08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGAAATTCGGGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAGTTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTATGCGAAGaaaaaaaagaaatgagagaggtgaaaaaaacagagagaaCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGNGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCTGAGTTCTTTGGAGCTGGNAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGNNATCCAACTGTGCCACCCTTTGGAGAGNNGAAGNNNNTTNCATGCTCTTNCATGGAGGGAGT
  5   1   2       bld Ga12      in                         XL189j01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCGAGGACAGATACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCTGAAGAGCCTGAGTATGAATATGAAATATATGAGGAGGGAAGGCAGCGCGACCCTGACGATCTTCGGAAAGACCCCAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGCCAGATCAGTGCTGTCCTGTGTgtgaagaaaaaaaagaaatgagagaggtgaaaaaaccagagagGGCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGCTCATGGAAGGCAGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATCCGTGCCAATCCTTCTGATTGCTGCAAGCAGTGCCCAGTAGAGGAGCGGAGTCCTATGGAACTGGCAGACAGTATGCAGTCAGATGGAGCAGGATCATGCANATTTGGGCGTCACTGG
  5   1   2       bld Ga18      in                       xlk63p16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACACATACCTAACAGCTGTGAATCTGGAGGAGTTTCTCTAACCCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGTGACCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTGTGTGAAGaaaaaaaagaaatgagagaggtgaaaaaaccagagagaaCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGGAGNTCTTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGNNCGTCAGTGGTACCCAAATAATGAGCGCTGNNATCCAACTGTGCCACCCTTTGGAGAGNNGAAGNGTGTTNCATGCTCTTNCATGNNGGGAGNT
  5   1   2       bld Ga18      in                       xlk70p10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAAGNNAGCGTGNCCCTGACGATCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTGTGTgaagaaaaaaaagaaatgagagaggngaaaaaaCCAGAGAGAACTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGNNGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGNGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGGAGNTCTTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTNGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGNATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGNTNCATGCTCNTNGCATNNNGGGAGTTACACAGTGTCGGNNNNNNGAGTNTACAGGAACTACATGTGG
  5   1   2       bld Emb1                            IMAGE:6634751.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTTCGGAAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGAGTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTATGCGAAGaaaaaaaagaaatgagagaggtgaaaaaaacagagagaaCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTCGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCTGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATGGAGGGAGTTACACAGTGTCGGAAACAGGAGTGTACAGGAACTACATGTGGTATCGGTTCANAACGGGACAAATGTTGCACCAAGTGCAAAGATACCGATGAAGAAGAANAAGTGCAATCAGAGGAGACAAGAACTCCATGGAGTTTCTAGAGAGGAGTGCAACCTGGGGTAATGGGGATTGATTTATCAAAGCTTCATTAGAGACATGTCTTCAAGTTTGAAACAACCGCCCAAGAACTTATTGGATGTCTTGCACCAATGTTTTTGGTCCCACCTCCTGATGACACCTGCCTAT
  5   1   2       bld Em10                            IMAGE:8317956.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTCGGAAGACCCAAGAGCATGCTCTTTCGAAGGTCAACTAAGGGCCCATGGTTCACAATGGGCTCCAGATTATGACAGGAAATGCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTGTGTGAAGaaaaaaaagaaatgagagaggtgaaaaaaccagagagaaCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATGGAGGGAGTTACACAGTGTCGGAGACAGGAGTGTACAGGAACTACATGTGGTATTGGTTCAAAGAGGGACAGATGTTGCACCAAG
  5   1   2       bld Ga12      in                         XL183c14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTCAACTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGCCAGATCAGTGCTGTCCTGTGTGTGAAGaaaaaaaagaaatgagagaggtgaaaaaaCCAGAGAGGGCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGCTCATGGAAGGCAGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATCCGTGCCAATCCTTCTGATTGCTGCAAGCAGTGCCCAGTAGAGGAGCGGAGTCCTATGGAACTGGCAGACAGTATGCAGTCAGATGGAGCAGGATCATGCAGATTTGGGCGTCACTGGTACCCAAATCATGAGCGTTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAATGTGTTACATGCACTTGTGCGGAGGGCATTACACAGTGTCGGAGACAGGAGTGTACAGGAACTACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCA
  5   1   2       bld Ga12      in                         XL182c14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTAAGGGCCCATGGTTCACGATGGGCTCCAGACTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAGCGTACCGTGATTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGCCAGATCAGTGCTGTCCTGTGTgtgaagaaaaaaaagaaatgagagaggtgaaaaaaCCAGAGAGGGCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGCTCATGGAAGGCAGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATCCGTGCCAATCCTTCTGATTGCTGCAAGCAGTGCCCAGTAGAGGAGCGGAGTCCTATGGAACTGGCAGACAGTATGCAGTCAGATGGAGCAGGATCATGCAGATTTGGGCGTCACTGGTACCCAAATCATGAGCGTTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAATGTGTTACATGCACTTGTGCGGAGGGCATTACACAGTGTCGGAGACAGGAGTGTACAGGAACTACATGTGGTACTGGTTCAAAGCGGGAC
  3   1   2       chi Tbd7      in                         XL102n20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTNTGTGTGCAGCTGTCAGAAGCGTNCCGTGATTTGTGATCNTATTGTGTGCCCACCTNTGAACTGCTCCCAGCCTGTCCATTTGCCAGATCAGTGCTGTCCTGTGTGTGAAGAAAAAAAAGAAATGAGAGAGGTGAAAAAACCAGAGAGGGCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGCTCATGGAAGGCAGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAANCTTTCCTGTACCAACCCAATCCGTGCCAATCCTTCTGATTGCTGCAAGCAGTGCCCAGTAGAGGAGCGGAGTCCTATGGAACTGGCAGACAGTATGCAGTCAGATGGAGTCTATGAAAGCCTTTCTATAATTTGGAGCTTTCTGGATAACTGGTTTCCGGATAATGGATCCCATACTTATATGTGGGTG
  5   1   2       bld Gas5                            IMAGE:3749025.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTCTATGTGTAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTGTGTGAAGaaaaaaaagaaatgagagaggtgaaaaaaccagagagaaCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGG
  5   1   2       bld Em10                            IMAGE:7982187.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAACGTACCGTGATCTGTGATCCTATTGTGTGCCCGCCTCTGATCTGCTCCCAGCCTGTCCAAACTTCAGATCAGTGTTGTCCTGTATGCgaagaaaaaaaagaaatgagagaggtgaaaaaaacagagagaACTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTCGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCTGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATGGAGGGAGTTACACAGTGTCGGAAACAGGAGTGTACAGGAACTACATGTGGTATCGGTTCAAAACGGGACAAATGTTGCACCAAGTGCAAAGATCCGATGAAGAAGAAAAAGTGAATTCAGAGGAGACAAAATCTCCTGGAGTTTCTAGAAAGGAGTGCAACTGGGGTATTGGGATGTATTTCAAACCCCAAAAGACATGCC
  5   1   2       bld Ga18      in                       xlk69m09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGCCAGATCAGTGCTGTCCTGTGTGTGAAGaaaaaaaagaaatgagagaggtgaaaaaaCCAGAGAGGGCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGCTCATGGAAGGCAGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAAGGTTCCACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATCCGTGCCAATCCTTCTGATTGCTGNNNNNNTGCCCAGTAGAGGAGCGGAGNCCTATGGAACTGGCAGACAGTATGCAGTCAGATGGAGCAGGATCATGCAGATTTGGGCGTCACTGGNACCCAAATCATGAGCGTTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAATGTGTTACATGCACTTNNNNNNAGGGGNATTACACAGTGTCGNNNNNNGAGTGTACAGGAACTACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCANGNTGCCAATCAAGATGAAGATGAAAAAGTGAAATCAGACGAGACAAGGNCTCCATGGAGNTTTTAGAGAGGAGAGCAANTCGGGCAATGGNNNTNATTNTCTAGNCTCACAAAAACATGTCCCNAGCTGAG
  3  -1   2       bld Bla2                            IMAGE:7296428.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCCTCTGAACTGCTCCCAGCCTGTCCAAACATCAGATCAGTGTTGTCCTGTGTGTGAAGAAAAAAAAGAAATGAGAGAGGTGAAAAAACCAGAGAGAACTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTCGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCAGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATGGAGGGAGTTACACAGTGTCGGAGACAGGAGTGTACAGGAACTACATGTGGTATTGGTTCAAAGAGGGACAGATGTTGCACCAAGTGCAAAGATGCCAATCAAGATGAAGAAGAAAAAGTGAAATCAGAGGAGACAAGAACTCCATGGAGTTTCTAGAGAGGAGTGCAACTTGGGTTGGATTCTGGAAGCAGCATTTGGAAGTAAATACATTGCCACCTTGGATTCCTTCAAAC
  5  -1   2       bld Bla2                            IMAGE:7299191.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTTCAAGAAAGTGTTGGTTTGCGGGTGAATCCTCCTAAGGaaaagggggttcccgggggcctcttaaattggttccccggggcggtttcaaaaatgggggggaaaaccggggggTTCCACATGAGGGTTCTTTTATGGGTTTGTTCAGAAGGGAGTTGTACCGTGGCATCCTTTGTCCTCCATTGGTTAAATAAAGGTCCCCTTGCCCCGCAGGGTTCCATGGAGAAGTGCCCTGGAGAAGGTGACTTGTCAAAACTTTCTGTACCAACCCATCCGTGCCAATCTTTTGATGNTGCAAGCAGTGCCCAGTAGAGAGCGGAGTCTTATGAACTGGCAGACAGTATGCAGTCAGATGGAGCAGGATCATGCAGATTGGGCGTCACTGGTACCCAAATCATGAGCGTTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAATGTGTTACATGCACTTGTGCGGAGGGCATTACACAGTGTCGGAGACAGGAGTGTACAGGAACTACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAATCAAGATGAAGATGAAAAAGTGAAATCAGACGAGACAAGGACTCCATGGAGTTTTTAGAGAGGAGAGCAACTCGGGCAATGGGACTGATTATCTAGGCTCACAAAAACATGTCCCAAGCTGAGACAACTGCCAGGACTGGATGGTCTGCACAATGTTTTGTTCCACTCTGATAACACTGCTACTGGATTTTACAGTATTTCCATTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTGGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCCTTCCAACACCAAGTCAGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCCGGAGTTTTAACGTCTGATCTGTAGAGTTTCGCAACAGGAGCACAGACACAGCATAGGCAGCTGTGCATATGTAGATATACTGACTAAACGTGCCTTGTGGCTCTACAGGACGGGAAGAAAAGTGCAAGAGACAGACAAAGACTACAGTGTTCTTGCTGGAAAGTCTGTATATATGTCTGCGTATGTGAGTGTGTGAACGCATGATTTTACTTTGGGGGTGTATGATCAGACATATATCAGTTCCTCTTGTCCAAGCACACACTTTTGGAAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTATTGATGGTCGTATTTATTGAACTAAAATAAACTGAAGACATTTTCCCaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGACCCAATCGCCCAAGAATGGG
  5   1   2       bld Ga18      in                      xlk110l12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCAGTGTTGTCCTGTGTGtgaagaaaaaaaagaaatgagagaggtgaaaaaaccagagagaaCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTCGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATNGAGGGAGTTACACAGTGTCGGAGNNNGAGTGTACAGGAACTACATGTGGTATTGGTTCAAAGAGGGACAGATGTTGCACCAAGNNNNNGATGCCAATCAAGATGAAGAAGAAAAAGTGAAATCAGAGGAGANAAGAACTCCATGGAGTTTCTAGAGAGGAGTGCAANTGGGGTAATGGGATTGANTATCAAAGCTCATAGAGAGAGANATGTCTCAAGNTGAGACNNTGCCAGGACTTNTGGNNGTCTNNNCAATGTTTTGTCCCNNTCTGATGACACTGCTAANGGATTTTNATNCTTTTGTTTCATTTNCTGCCATNAAGCAGT
  5   1   2       bld Ga18      in                      xlk123i04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTgaagaaaaaaaagaaatgagagaggngaaaaaaccagagagaaCTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATGGAGGGAGTTACACAGTGTCGGAGANNGAGTGTACAGGAACTACATGTGGTATTGGTTCAAAGAGGGACAGATGTTGCACCAAGTNNAAAGATGCCAATCAAGATGAAGAAGAAAAAGTGAAATCAGAGGAGACAAGAACTCCATGGAGTTTCTAGAGAGGAGTGCAACTGGGGTAATGGGATTGATTATCAAAGCTCATAGAGAGAGACATGTCTCAAGNTGAGACAACTGCCAGGACTTATGGNNGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTAATGGATTTTTATTCTTTTNNTTCATTTNCTGCCATAAAGCA
  5   1   2       bld Ga18      in                       xlk68c24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     aaaaaaagaaatgagagaggngaaaaaaaaaCAGAGAGAACTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCTGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATNGAGGGAGTTACACAGTGTCGGAAACAGGAGTGTACAGGAACTACATGTGGTATCGGTTCAAAACGGGACAAATGTTGCACCAANNNNNNGATACCGATGAAGAAGAAAAAGTGAAATCAGAGGAGANAAGAACTCCATGGAGTTTCTAGAGAGGAGTGCAANTNGGGTAATGGGATTGATTATCAAAGCTCATAGAGACATGTCTCAAGTTGAGA
  5   1   2       bld Ga18      in                       xlk70l08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      aaaaaaaagaaatgagagaggtgaaaaaaaCAGAGAGAACTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCTGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATGGAGGGAGTTACACAGTGTCGGAAACAGGAGTGTACAGGAACTACATGTGGTATCGGTTCAAAACGGGACAAATGTTGCACCAAGTGCAAAGATACCGATGAAGAAGAAAAAGTGAAATCAGAGGAGACAAGAACTCCATGGAGTTTCTAGAGAGGAGTGCAACTGGGGTAATGGGATTGATTATCAAAGCTCATAGAGACATGTCTCAAGTTGAGACNACCCGCCAGNCTTATGGATATCTGCACAATGTTTTGTCCCACTCTGATGACACTNCTAATGGNNTTTTATTCTTTTGTTNCATTTGCTGCTNNCATAAAGCAGTGGGNTTCTNGNAGCAGCNTTTNGNAAGNAAATACATTGCCANCNTNG
  5   1   2       bld Ga18      in                      xlk131l21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGGTGAAAAAACCAGAGAGGGCTCNNACAAGTGAAGGCTGCTTTTTTGATGGAGATCGCTCATGGAAGGCAGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCANNNNTCCACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATCCGTGCCAATCCTTCTGATTGCTGCNANNGTGCCCAGTAGAGGAGCGGAGNNCTATGGAACTGGCAGACAGTATGCAGTCAGATGGAGCAGGATCATGCAGATTTGGGCGTCACTGGTACCCAAATCATGAGCGTTGGNATCCAACTGTGCCACCCTTTGGAGAGATGAAATGTGTTACATGCACTTNNNNNAGGGCATTACACAGTGTCGGNGANNGAGTGTACAGGAACTACATGTGGTACTGGTTCAAAGCGGGACAGANGTTGCACCAAGTNNNAAGATGCCAATCAAGATGAAGATGAAAAAGTGAAATCAGACGAGACAAGGNCTCCATGGAGNTTTTAGAGAGGAGAGCAACTCGGGCAATGGGACTGANTATCTAGGCTCACAAAAACATGTCCCAAGCTGAGAC
  5   1   2       bld Ga18      in                      xlk114n06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAGAACTCGCACAAGTGAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGNACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGNGTGTTACATGCTCTTGCATNGAGGGAGTTACACAGTGTCGNAGANNGNGTGTACAGGAACTACATGTGGTATTGGTNCAAAGAGGGACAGATGTTGCACCAAGTGCNAAGATGCCAATCAAGATGAAGAAGAAAAAGTGAAATCAGAGGAGACAAGAACTCCATGGAGNNTCTAGAGAGGAGTNNAACTGGNNAATGGGGANTNATTATCAAAGCTCATAGAGAGAGANATGTCTCAAGTTGAGACAACTGCCAGGACTTATGGATGTCTGCACAATGTTTNTCCCACTCNGATGACACTNCTAANNNATTTTNNTCTTTTGTTTCANTTGCTNNNNNAAGCANTNG
  5   1   2       bld Ga18      in                      xlk110p07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAGAACTCGCACAAGTGAAGNCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGNATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATNGAGGGAGTTACACAGTGTCGGNGANNGAGTGTACAGGAACTACATGTGGTATTGGTTCAAAGAGGGACAGATGTTGCACCAANNNNNNGATGCCAATCAAGATGAAGAAGAAAAAGTGAAATCAGAGGAGACAAGAACTCCATGGAGTTTCTAGAGAGGAGTGCAACTGGGNNAATGGGANTGATTATCAAAGCTCATAGAGAGAGANATGTCTCAAGNTGAGACNNTGCCAGGACTTATGGNNGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTAATGGATTTTTANTNNTTNTNNATTTGCTGCCATAAAGCAGTNGGATTCTGANNCAGCATTTGGNNTAAATACATTGC
  5   1   2       bld Emb1                            IMAGE:6862481.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCCCAGTAAAGGCTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTCGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCTGAGTTCTTTGGAGCTGGCAGACAGTATGTTGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATGGAGGGAGTTACACAGTGTCGGAAACAGGAGTGTACAGGAACTACATGTGGTATCGGTTCAAAACGGGACAAATGTTGCACCAAGTGCAAAGATACCGATGAAGAAGAAAAAGTGAAATCAGAGGAGACAAGAACTCCATGGAGTTTCTAGAGAGGAGTGCAACTGGGGTAATGGGATTGATTATCAAAGCTCATAGAGACATGTCTCAAGTTGAGACAACCGCCAGGACTTATGGATATCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTAATGGATTTTTATTCTTTTGTTTCATTTGCTGCTGCCATANAGCAGTGGGATTCTGGAAGCAGCATTTTGGAAGTAAAATACATTGCCACCCTTGGGATTCCCTTCAAACAAATCAGTCTGTCTTTTCTGAACAGAAAGCAACTCTAAATCCCTGCCCTAAAACAGGACCCTGGGAGTTTTTAACCCGTCTG
  5   1   2       bld Ga18      in                       xlk63o01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAAGTGAAGNNTGCTTTTTTGATGGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCTGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATGGAGGGAGTTACACAGTGTCGGAAACAGGAGTGTACAGGAACTACATGTGGTATCGGTTCAAAACGGGACAAATGTTGCACCAANNNNNAGATACCGATGAAGAAGAAAAAGTGAAATCAGAGGAGACAAGAACTCCATGGAGTTTCTAGAGAGGAGTGCAACTGGGGTAATGGGATTGATTATCAAAGCTCATAGAGACATGTCTCAAGTTGAGACNNCCGCCANNCTTATGGATATCTGCACAATGTTTTGTCCCACTCTGATGACACTNCTAATGGATTTTTATTCTTTTGTTTCATTTGCTGCTNNCATAAAGCAGTGGGATTCTNGNAAGCAGCATTTGGGAAGNAAAATACATTGC
  5   1   2       bld Ga18      in                      xlk128l15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGTGAAGNCTGCTTTTTTGATGGAGATCGCTCATGGAAGGNAGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCANNNNTCCACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATCCGTGCCAATCCTTCTGATTGCTGCAAGNGTGCCCAGTAGAGGAGCGGAGNCCTATGGAACTGGCAGACAGTATGCAGTCAGATGGAGCAGGATCATGCAGATTTGGGCGTCACTGGTACCCAAATCATGAGCGTTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAATGTGTTACATGCACTTNNNNNAGGGCATTACACAGTGTCGGAGANNGAGTGTACAGGAACTACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTNNNAAGATGCCAATCAAGATGAAGATGAAAAAGTGAAATCAGACGAGACANGGACTCCATGGAGNTTTTAGAGAGGAGAGCAACTCGGGCAATGGGACTGATTATCTAGGCTCACAAAAACATGTCCCAAGCTGAGACAACTGCCAGGNCTGGATGGTCTGCACAATGTTTTGTTCCACTCTGATAACACTGCTACTGGNTTTTACAGTATTTCCATTTGTTTAATTTNCTGCCATGANGNAGTGGGNTT
  3  -1   2       bld Bla2      in                    IMAGE:7297018.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGATCGTTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCTGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATGGAGGGAGTTACACAGTGTCGGAAACAGGAGTGTACAGGAACTACATGTGGTATCGGTTCAAAACGGGACAAATGTTGCACCAAGTGCAAAGATACCGATGAAGAAGAAAAAGTGAAATCAGAGGAGACAAGAACTCCATGGAGTTTCTAGAGAGGAGTGCAACTGGGGTAATGGGATTGATTTATCAAGCTCATAGAGACATGTCTCAAGTTGAGACACCCGCCCAGACTATGGATGTCTGCACATGGTTTGTCCACTCTGAGACCTGCTATGGATTTTTATCTTTGTTCATTGCTGCGCATAAGCAGTGGATCTGAACACATTNGAGTAATACATGCACTGATCCTCACATCATCGTCTCGACGAGCATTATCGCTACNG
  5   1   2       bld Ga18      in                      xlk126l18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCATGGAAGGNGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATGGAGGGAGTTACACAGTGTCGGAGANNGAGTGTACAGGAACTACATGTGGTATTGGTTCAAAGAGGGACAGATGTTGCACCAAGTGCNAAGATGCCAATCAAGATGAAGAAGAAAAAGTGAAATCAGAGGAGACAAGAACTCCATGGAGTTTCTAGAGAGGAGTGCAACTGGGGTAATGGGANTGANTATCAAAGCTCATAGAGACATGTCTCAAGTTGAGACAACTGCCAGGACTTATGGATGTCTNCACAATGTTTTGTCCCACTCTGATGACACTGCTAATGGATTTTTATTNNTTTNNTTCATTTNCTGCCANNAAGCAGNGGGATTCTGGAAGCAGCATTNNGGAAGNAAAANA
  5   1   2       bld Ga18      in                        xlk4g12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTGGCATCCTTTTGTTCNTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCTGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATGGAGGGAGTTACACAGTGTCGGAAACAGGAGTGTACAGGAACTACATGTGGTATCGGTTCAAAACGGGACAAATGTTGCACCAAGTGCAAAGATACCGATGAAGAAGAAAAAGTGAAATCAGAGGAGACAAGAACTCCATGGAGTTTCTAGAGAGGAGTGCAACTGGGGTAATGGGATTGATTATCAAAGCTCATAGAGACATGTCTCAAGTTGAGACAACCGCCANNCTTATGGATATCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTAATGGATTTTTATTCTTTTGTTTCATTTGCTGCTGCCATAAAGCAGTGGGATTCTGGAAGCAGCNTTTGGGAAGTAAAATACATTGCCACCTTGNATTCCCTTCAAACAATCAGNCTGTCTNNCTGACAGAANNANCTCTAAATCCTGCCTAANNGGACCTNGNGTTTTNACGNCTGATCTGTAGAGCTTT
  5   1   2       bld Ga18      in                      xlk161k12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCTGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGNATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATGGAGGGAGTTACACAGTGTCGGAAACAGGAGTGTACAGGAACTACATGTGGTATCGGTTCAAAACGGGACAAATGTTGCACCAAGTNCAAAGATACCGATGAAGAAGAAAAAGTGAAATCAGAGGAGACAAGAACTCCATGGAGTTTCTAGAGAGGAGTGCAACTGGGGTAATGGGATTGATTATCAAAGCTCATAGAGACATGTCTCAAGTTGAGACAACCGCCANNCTTATGGATATCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTAATGGATTTTTATTCTTTTGTTTCATTTGCTGCTGNCATAAAGCAGTGGGATTCTGGAAGCAGCATTTGGAAGTAAAATACATTGCCACCTTNGNTTCCCTNCAAACAATCAGTCTGTCTTTCTGACAGAAGCAACTCTNAATCCTGCCTAAACAGGACCTGGAGTTTNACNNCTGATCTGTAGAGCTTTNNAAC
  5   1   2       bld Ga18      in                        xlk5d13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCTGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATGGAGGGAGTTACACAGTGTCGGAAACAGGAGTGTACAGGAACTACATGTGGTATCGGTTCAAAACGGGACAAATGTTGCACCAAGTNCAAAGATACCGATGAAGAAGAAAAAGTGAAATCAGAGGAGACAAGAACTCCATGGAGTTTCTAGAGAGGAGTGCAACTGGGGTAATGGGATTGATTATCAAAGCTCATAGAGACATGTCTCAAGTTGAGACAACCGCCANNCTTATGGATATCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTAATGGATTTTTATTCTTTTGTTTCATTTGCTGCTGNCATAAAGCAGTGGGATTCTGGAAGCAGCATTTGGAAGTAAAATACATTGCCACCTTGGATTCCCTTCAAACAATCAGTCTGTCTTTCTGACAGAAGNAACTCTAAATCCTGCCTAAACAG
  5   1   2       bld Ga15      in                       XL518i24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTCCTCCATTTGGTCTAATTAAATGTGCCATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATCCGTGCCAATCCTTCTGATTGCTGCAAGCAGTGCCCAGTAGAGGAGCGGAGTCCTATGGAACTGGCAGACAGTATGCAGTCAGATGGAGCAGGATCATGCAGATTTGGGCGTCACTGGTACCCAAATCATGAGCGTTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAATGTGTTACATGCACTTGTGCGGAGGGCATTACACAGTGTCGGAGACAGGAGTGTACAGGAACTACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAATCAAGATGAAGATGAAAAAGTGAAATCAGACGAGACAAGGACTCCATGGAGTTTTTAGAGAGGAGAGCAACTCGGGCAATGGGACTGATTATCTAGGCTCACAAAAACATGTCCCAAGCTGAGACAACTGCCAGGACTGGATGGTCTGCACAATGTTTTGTTCCACTCTGATAACACTGCTACTGGATTTTACAGTATTTCCATTTGTTTAATTTGCTGCCATGAAGCAGTGGGGATTCTGGAGGCAGCATTTGGAACTAAAATACCCTTGCCACCTTGGGATTCATCCCTTCCAACACCAAGTTCAGTCCTTTCTGACAGAA
  3   1   2       bld Ga18      in                      xlk102h17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATTNNNCNNNNANNTNCCATTNNNNCTGNNGGGGNTCGNNNGNAGNANTGCACTNNNNNNAGNTGNCCTNNNCAAANCTTTNNNGTNCCANCCNANTNGTGCNAANCCATNNGATTGCTNNAAACANNNNCAGTAGNNAGNGGAGTTCTTTGGAGCTGNCAGACAGTATGCAGTCAGATGGATCNCCACGATCATGCAGNTTTGGCCGTCAGTGGTACCCAAATAATGAGNGCTGGCATCCNAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCNTGCATGGAGGGAGTTACACAGTNTCGGAGACAGGAGTGTACAGGANCTACATGTGGTATTGGTTCAAAGAGGGACAGATGNNNNCCAAGTGCAAAGATNCCAATCAAGATGAAGAAGAAAAAGTGAAATCAGAGGAGACAAGAACTCCATGGAGTTTCTAGAGAGGAGTGCAACTGGGGTAATGGGATTGATTATCAAAGCTCATAGAGAGAGACATGTCTCAAGTTGAGACAACTGCCAGGACTTATGGATGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTAATGGATTTTTATTCTTTTGTTTCATTTGCTGCCATAAAGCAGTTGGATTCTGGAAGCAGCATTTGGAAGTAAAATACATTGCCACCTTGGATTCCCTTCAAACAATCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTANNNNNTGCAACAGGAGCACAGACACAGCATAGGCAGCTGTGCATATGTAGATATATACTGACTAAAAGTGCTCTGTGGCTCTCTACAGGACGGAAAGAAAAGTACAAGCGACAGACAAAGATTACAGTGTTCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAGTGTGTGAACGCATGTTGTTACTTTGGGGGTGTATGATCAGACATATATCAATTCCTCTTGTCCAAGCACACACTATGGGAAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCGTATTTATGAACNNA
  3   1   2       bld Ga18                              rxlk70g22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TNCATTNGNNNNNNAANNNGCCNTTNNNNCCTGCANGGNNCCNNNGAGAANTGNACNNNNNGAAGNNGACCTGTNNAAANTTTCCTNTNCCANCCAATCCGNNCNANNCCTTCTGATTGNNGNAANCAGTGCCCAGTANNNAGNGNAGTCCTATGNNACTGGCAGACAGTATGCAGTCAGATGGAGCAGGATCATGCAGATTTGGGCGTCACTGGTACCCAAATCATGANCGTTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAATGTGTTACATGNACTTGTGCGGAGGGCATTACACAGTGTCGGAGACAGGAGTGTACAGGAACTACATGTGGTACTGGTTCAAAGCGGGACAGATNNNNNCCAAGTGCAAAGATGCCAATCAAGATGAAGATGAAAAAGTGAAATCAGACGAGACAAGGACTCCATGGAGTTTTTAGAGAGGAGAGCAACTCGGGCAATGGGACTGATTATCTAGGCTCACAAAAACATGTCCCAAGCTGAGACAACTGCCAGGACTGGATGGTCTGCACAATGTTTTGTTCCACTCTGATAACACTGCTACTGGATTTTACAGTATTTCCATTTGTTTAATTTGCTGCCATGAAGCAGTGGGATTCTGGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCCTTCCAACACCAAGTCAGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCCGGAGTTTTAACGTCTGATCTGTAGAGTTTCGCAACAGGAGCACAGACACAGCATAGGCAGCTGTGCATATGTAGATATACTGACTAAACGTNCCTTGTGGCTCTACAGGACGGGAAGAAAAGTGCAAGAGACAGACAAAGACTACAGTGTTCTTGCTGGAAAGTCTGTATATATGTCTGCGTATGTGAGTGTGTGAACGCATGATTTTACTTTGGGGGTGTATGATCAGACATATATCAGTTCCTCTTGTCCAAGCACACACTTTTGGAAACTTTGTCTTGTATTATTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTATTGATGGTCGTATT
  3   1   2       bld Ga18      in                       xlk69m09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CNTTNGTCNANNAANNNNCNATTNNNNCTGNANNGNTNCNCNGANANNGCACTNTNAGAAGNTGNCNTGTCCAAANTTTCNTNTACCANNCNNTCCNNNCCAATCCTTCTGATTNNNGCAAGCAGTGCCCAGTAGAGGAGNGGAGTCCTATGGAACTGGNAGACAGTATGNAGTCAGATGGAGCAGGATCATGCAGATTTGGGCNTCACTGGNACCCAAATCATGAGCGTTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAATGTNNNCATGNACTTGTGCGGAGGGCATTACACAGTNTCGGAGACAGGAGTGTACAGGAACTACATGTGGTACTGGTTCAAAGCGGGACAGATNNNNNCCAAGTGCAAAGATGCCAATCAAGATGAAGATGAAAAAGTGAAATCAGACGAGACAAGGACTCCATGGAGTTTTTAGAGAGGAGAGCAACTCGGGCAATGGGACTGATTATCTAGGCTCACAAAAACATGTCCCAAGCTGAGACAACTGCCAGGACTGGATGGTCTGCACAATGTTTTNTTCCACTCTGATAACACTGCTACTGGATTTTACAGTATTTCCATTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTGGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCCTTCCAACACCAAGTCAGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCCGGAGTTTTAACGTCTGATCTGTAGAGTTTCGCAACAGGAGCACAGACACAGCATAGGCAGCTGTGCATATGTAGATATACTGACTAAACNNNCTTGTGGCTCTACAGGACGGGAAGAAAAGTGCAAGAGACAGACAAAGACTACAGTGTTCTTGCTGGAAAGTCTGTATATATGTCTGCGTATGTGAGTGTGTGAACGCATGATTTTACTTTGGGGGTGTATGATCAGACATATATCAGTTCCTCTTGTCCAAGCACACACTTTTGGAAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTATTGATGGTCGTATTT
  3   1   2       bld Ga18      in                      xlk135c23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CNATNAANNNGCCNTTNNNACCTGCANNNNTNCNCTGNAGNANTGCACTGTGAGAAGTGNCCTNNCNAAACTTTCCTNNACCAACCCAATCCGTGCNANNCCTTCTGATTGCNNNAANCAGTGCCCAGTAGAGGANNGNAGTCCTATGGAACTGGCAGACAGTATGNAGTCAGATGGAGCAGGATCATGNAGATTTGGGCGTCACTGGTACCCAAATCATGANCGTTGGCATCCAACTGTNCCACCCTTTGGAGAGATGAAATGTGTTACATGNACTTGTGCGGAGGGCATTACACAGTGTCGGAGACAGGAGTGTACAGGANCTACATGTGGTACTGGTTCAAAGCGGGACAGATNNNNNCCAAGTGCAAAGATGCCAATCAAGATGAAGATGAAAAAGTGAAATCAGACGAGACAAGGACTCCATGGAGTTTTTAGAGAGGAGAGCAACTCGGGCAATGGGACTGATTATCTAGGCTCACAAAAACATGTCCCAAGCTGAGACAACTGCCAGGACTGGATGGTCTGCACAATGTTTTGTTCCACTCTGATAACACTGCTACTGGATTTTACAGTATTTCCATTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTGGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCCTTCCAACACCAAGTCAGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCCGGAGTTTTAACGTCTGATCTGTAGAGTTTCGCAACAGGAGCACAGACACAGCATAGGCAGCTGTGCATATGTAGATATACTGACTAAACGNNNNTGTGGCTCTACAGGACGGGAAGAAAAGTGCAAGAGACAGACAAAGACTACAGTGTTCTTGCTGGAAAGTCTGTATATATGTCTGCGTATGTGAGTGTGTGAACGCATGATTTTACTTTGGGGGTGTATGATCAGACATATATCAGTTCCTCTTGTCCAAGCACACACTTTTGGAAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTATTGATGGTCGTATTTATGAAC
  3   1   2       bld Ga18      in                      xlk145p08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCATTNNNNCCTGNNGGGGTTCGNCNGAGAANTGCNNTGNNAGNAGNNGNCCTGTCCAAAACTTTCCTGTACCANNNAATTCGTGCCAATCCNTCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCTGAGTTCTTTGNAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTNGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGNTCTTGCATGGAGGGAGTTACACAGTGTCGGAAACAGGAGTGTACAGGAACTACATGTGGTATCGGTTCAAAACGGGACAAATNNNNNCCAAGTGCAAAGATACCGATGAAGAAGAAAAAGTGAAATCAGAGGAGACAAGAACTCCATGGAGTTTCTAGAGAGGAGTGCAACTGGGGTAATGGGATTGATTATCAAAGCTCATAGAGACATGTCTCAAGTTGAGACAACCGCCAGGACTTATGGATATCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTAATGGATTTTTATTCTTTTGTTTCATTTGCTGCTGCCATAAAGCAGTGGGATTCTGGAAGCAGCATTTGGAAGTAAAATACATTGCCACCTTGGATTCCCTTCAAACAATCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTANNNNTTGCAACAGTAGTACAGACACAGCATAGGCAGCTGTGCATATGTAGATATATACTGACTAAAAGTGCTCTGTGGCTCTCTACAGGACGGAAAGAAAAGTACAAGCGACAGACAAAGATTACAGTGTTCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAGTGTGTGAACGCATGTTGTTACTTTGGGGGTGTATGATCAGACATATATCAATTCCTCTTGTCCAAGCACACACTATGGGAAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCGTATTTANNGAACNAAAA
  5   1   2       bld Ga18      in                       xlk78c20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTTGCACCTNCAGGGGTTCGACTGGAGAAGTGCACTGTGAGAAGGTGACCTGTCCAAAACTTTCCTGTACCAACCCAATTCGTGCCAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGGAGTTCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGATCACCACGATCATGCAGATTTGGCCGTCAGTGGTACCCAAATAATGAGCGCTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAGTGTGTTACATGCTCTTGCATGGAGGGAGTTACACAGTGTCGGAGANNGAGTGTACAGGAACTACATGTGGTATTGGTTCAAAGAGGGACAGATGTTGCACCAAGTGNAAAGATGCCAATCAAGATGAAGAAGAAAAAGTGAAATCAGAGGAGACAAGAACTCCATGGAGTTTCTAGAGAGGAGTGCAACTGGGGTAATGGGATTGATTATCAAAGCTCATAGAGAGAGACATGTCTCAAGTTGAGACNNNTGCCAGGACTTATGGATGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTAATGGATTTTTATTCTTTTGTTTCATTTGCTGCCATAAAGCAGTTGGATTCTGGAAGCAGCATTTGGAAGTAAAATACATTGCCACCTTGGATTCCCTTCAAACAATCAGNCTGTCTTTCTNACNNNNGCAACTCTNAATCCTGCCTAAACAGGACCTGGNNTTTTAACGTCTGATCTGTAGAGCTTTNNAACAGGAGCACAGACACAGCATAGGCAGCTGTNNAT
  3   1   2       bld Ga18      in                       xlk65d11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTGCNANGGNTNCNNCNGGNNNNNNNCNCTGTGAGAAGGTGACNNNTCNAAACTTTCNNGTACCAANCCNATCCGTNNCAANCCTTCTGATTGCNGCAAGCAGNGCCCAGTAGNGNANNGGAGTCCTATGGAACTGCAGACAGTATGNAGTCAGATGGAGCAGGATCATGCAGATTTGGGCGTCACTGGNNNCCAANTCATGAGCGTTGGCATCCANCTGTGCCACCCTTNGGAGAGATGAAATGTGTTACATGCACTTGTGCGGAGGGCATTACACAGTGTCGGAGACAGGAGTGTACAGGANCTACATGTGGTACTGGTTCAAAGCGGGACAGATNNNNNNCAAGTGCAAAGATGCCAATCAAGATGAAGATGAAAAAGTGAAATCAGACGAGACAAGGACTCCATGGAGTTTTTAGAGAGGAGAGCAACTCGGGCAATGGGACTGATTATCTAGGCTCACAAAAACATGTCCCAAGCTGAGACAACTGCCAGGACTGGATGGTCTGCACAATGTTTTGTTCCACTCTGATAACACTGCTACTGGATTTTACAGTATTTCCATTTGTTTAATTTGCTGCCATGAAGCAGTGGGATTCTGGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCCTTCCAACACCAAGTCAGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCCGGAGTTTTAACGTCTGATCTGTAGAGTTTCGCAACAGGAGCACAGACACAGCATAGGCAGCTGTGCATATGTAGATATACTGACTAAACGTNCCTTGTGGCTCTACAGGACGGGAAGAAAAGTGCAAGAGACAGACAAAGACTACAGTGTTCTTGCTGGAAAGTCTGTATATATGTCTGCGTATGTGAGTGTGTGAACGCATGATTTTACTTTGGGGGTGTATGATCAGACATATATCAGTTCCTCTTGTCCAAGCACACACTTTTGGAAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTATTGATGGTCGTATTTATNAACNAA
  3   1   2       bld Ga18      in                       xlk64e01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCANGGNTNCNNCNGAGNANNGCNCTGTGAGAAGNNGNCCTNNNCAAAACTTTCCTNTNCCNACCCANTCCGTGCCANNCCTTCTGATTGNNGCAANNAGTGCCCAGTAGAGGAGNGGAGTCCTATGGAACTGGCAGACAGTATGCAGTCAGATGGAGCAGGATCATGCAGATTTGGGCNTCACTGGTACCCAAATCATGAGCGTTGGCATCCAACTGTGCCACCCTTTGGAGAGATGAAATGTGTTACATGNACTTGTGCGGAGGGCATTACACAGTGTCGGAGACAGGAGTGTACAGGAACTACATGTGGTACTGGTTCAAAGCGGGACAGATNNNNNNCCAAGTGCAAAGATGCCAATCAAGATGAAGATGAAAAAGTGAAATCAGACGAGACAAGGACTCCATGGAGTTTTTAGAGAGGAGAGCAACTCGGGCAATGGGACTGATTATCTAGGCTCACAAAAACATGTCCCAAGCTGAGACAACTGCCAGGACTGGATGGTCTGCACAATGTTTTGTTCCACTCTGATAACACTGCTACTGGATTTTACAGTATTTCCATTTGTTTAATTTGCTGCCATGAAGCAGTGGGATTCTGGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCCTTCCAACACCAAGTCAGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCCGGAGTTTTAACGTCTGATCTGTAGAGTTTCGCAACAGGAGCACAGACACAGCATAGGCAGCTGTGCATATGTAGATATACTGACTAAACNNNCTTGTGGCTCTACAGGACGGGAAGAAAAGTGCAAGAGACAGACAAAGACTACAGTGTTCTTGCTGGAAAGTCTGTATATATGTCTGCGTATGTGAGTGTGTGAACGCATGATTTTACTTTGGGGGTGTATGATCAGACATATATCAGTTCCTCTTGTCCAAGCACACACTTTTGGAAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTATTGATGGTCGTATT
  3   1   2       bld Ga18                             rxlk157p05ex.3p