Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL466i07ex.3                          2 PI      96       1638     1908                (no blast hit)

 This cluster: approximate FL confidence score = 91%

 1012837230 Xl3.1-xl327f01.3.5 - 157 ESTs
                                                                       .....-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xl327f01.3.5                                                                                                                                                                                                                                                                                                        GAAACCCCGTAGTCTTGCGCCCTGTTACCGTTGGCTGGGTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTAACTCCTTGCTTCTAAATAAAAAAAAAAAGGGGGNAAAAAAAACAAAAAAAAAAGCTTTATTTTTTTTTTTTTTAATATTATTTTGGAGGGAATGGGGAGAAGGGTTGTTGGGTGCAGTTGGTCGGCATCTCGGTGTTCCTCACAGACTTCCTACTGAGTAATTGATTTTGTTACTTGAGATTAGAGTGGCTGGAAATGCCATCTGCTCCGAGGTTACCAATGGAAAGACTTTGTCCCCAAGCCTGTGACATCATATCTGCAACATTTCTGGGGTAGCAGAGCCATTTCTAGATGTAATTTCCTCAGGATAAAGGTG
                                                  Xl3.1-CHK-1012722155                                                                                                                                                                                                                                                                                                              CCGTAGTCTTGCGCCxTxTTACCGTTGGCTGGCTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCxxxxCTxxxGxxxxxxxxxTxxGxxxxxCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTAACTCCTTGCTTCTAAAAAAAAAAAAAAAxGxGxGAAAAAAAACAAAAAAAAAAGCTTTTTTTTTTTTTTTTTTAATATTATTTTGGAGGGAATGGGGAGAAGGGTTGTTGGGTGCAGTTGGTCGGCATCTCGGTGTTCCTCACAGACTTCCTACTGAGTAATTGATTTTGTTACTTGAGATTAGAGTGGCTGGAAATGCCATCTGCTCCGAGGTTACCAATGGAAAGACTTTGTCCCCAAGCCTGTGACATCATATCTGCAACATTTCTGGGGTAGCAGAGCCATTTCTAGATGTAATTTCCTCAGGATAAAGGTGTACAGT
                                                      consensus depths                                                                                                                                                                                                                                                                                                             4     6     6    13    11    17    16    25    27    35    29    40    29    41    32    44    32    44    34    45    35    45    35    45    35    46    35    46    35    47    35    47    36    47    43    47    43    48    42    48    42    51    46    51    46    51    45    51    44    51    47    52    47    52    48    53    49    54    49    54    45    57    47    57    43    57    47    61    48    62    49    64    48    62    48    62    48    63    47    64    47    65    47    66    46    66    45    68    42    66    39    66    41    67    40    67    35    68    39    68    41    69    40    69    38    70    38    70    38    69    38    69    37    70    30    68    30    63    25    59    21    62    21    60    17    60    16    64    14    60    11    59    15    58    21    61    19    61    21    63    21    66    22    70    22    70    24    70    25    69    25    70    26    71    26    71    24    68    49    68    53    68    51    68    51    66    53    66    54    66    54    66    54    66    47    63    56    63    57    63    57    62    54    63    63    67    62    67    60    65    61    64    62    65    62    66    63    66    63    66    63    66    58    66    58    64    60    65    60    65    62    67    63    67    63    67    63    67    64    68    66    70    66    71    65    71    66    73    65    72    66    71    64    70    63    69    62    70    61    69    63    67    61    65    59    65    57    62    53    60    52    60    49    58    46    56    33    47    25    36    12    30    11    23    11    17     9    14     5     8     4     9     4     9     2     9     7    11     7    11     8    11     8    11     9    12     9    12     9    12     9    11     8    11     9    11    10    11     9    10     9    10     8    10     8     9     7     9     6     9     5     8     4     8     3     8     3     8
  5   1   2       e50                                 Xl3.1-xl327f01.3                                                                                                                                                                                                                                                                                                        GAAACCCCGTAGTCTTGCGCCCTGTTACCGTTGGCTGGGTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTAACTCCTTGCTTCTAAA
  5   1   2       e50                              Xl3.1-xlk114c21ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTTTTTTTTTTTGGTTTTTTTTTTGTTTCTTGTTCTTTATATTTAGTTTTTTGTTTTGGGAGGGAAATTTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAACAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGG------------------------------------AAAAAAAAAAAGAGAGAAAAAAAACAAAAAAAAAAGCTTTATTTTTTTTTTTTTTAATATTATTTTGGAGGGAATGGGGAGAAGGGTTGTTGGGTGCAGTTGGTCGGCATCTCGGTGTTCCTCACAGACTTCCTACTGAGTAATTGATTTTGTTACTTGAGATTAGAGTGGCTGGAAATGCCATCTGCTCCGAGGTTACCAATGGAAAGACTTTGTCCCCAAGCCTGTGACATCATATCTGCAACATTTCTGGGGTAGCAGAGCCATTTCTAGATGTAATTTCCTCAGGATAAAGGTGTACAGTGCATTTTG------------TATACCTCTTGTTTGAATAAAGGAAAATAATCCTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                            GCTGGCTTGGTAGGAGAAGCTGCAGAGACCGGAGAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTGGATTTAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAAAAAGAACC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGCTATGGCTATGGGCCACC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAAAATGAATTTTCTACTATGTATTCAGGTTTATT
                                                                   SNP                                                                                                                                                                                                                                                                                                                    ---A-------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                            --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                C-------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                            ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                        G--A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---T---C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                G----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---C-------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        T--------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---G------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TA----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---G-------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------C
                                               BLH ATG      82     586                                                                                                                                                                                                                                                                                                        
                                               BLH MIN      82     173                                                                                                                                                                                                                                                                                                        
                                               BLH OVR      82      58                                                                                                                                                                                                                                                                                                        
                                               EST CLI      29      22                                                                                                                                                                                                                                                                                                        
                                               ORF LNG      82       1                                                                                                                                                                                                                                                                                                        
  5   1   2       e50                                 Xl3.1-xl327f01.3                                                                                                                                                                                                                                                                                                        GAAACCCCGTAGTCTTGCGCCCTGTTACCGTTGGCTGGGTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTAACTCCTTGCTTCTAAA
                                                  Xl3.1-CHK-1012685336                                                                                                                                                                                                                                                                                                              CCGTAGTCTTGCGCCxTxTTACCGTTGGCTGGCTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCxxxxCTxxxGxxxxxxxxxTxxGxxxxxCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTAACTCCTTGCTTCTAAAAAAAAA
  5   1   2       add Ga18      in                      xlk139c24ex.5p ACTTCACACCTCCAGAAATGTAACTACAGCTCCAAGTTAACCCACCACAGCCCGGCTATTGGGGAATTTCTAGAAGTCCCAGTTTTATACACGTGGCTCGTCTAAATTTCAGCTCCTTTAAATTAGCTTTTGTATTTTTCGCTACACCAGCAAATAATCTTCAACGTCAGNTTGACGTCAGATTAGAACTACGCTAGCGTAGATCAGAACGTGAAANCAGAACGAGTTGTACTACATTTCCCGTCGTACATTGCAGCTTTCCGCGTACGTGATGACGTTCCGTTCCACCCCCTGTATGGAAACCCCGTAGTCTAGCGCCGTCTTACCGTTGGCTGGCTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGTGACGNNNNNTGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGNCTTGACTGGAGCACAACGCAGGAAACCCTGCNCNGTNTTTTTCTCAGTATGGAGAAGTCGNNNNNNTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGNTTTGGNTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGNCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGNCGGCCACGAGAAGGCTGGCAGNAAAAGACNNGAACTGAAAACAGTAGGNCCAACAAANTTTTNNNGGA
  5   1   2       bld Int2      in                    IMAGE:8822118.5p                                                                                                                                                                                                                                                                                TATTTATTTGTATGGTTTTCTTCTTATATTAATATCGTCCCCGCCGTCTTACCGTTGGCTGGCTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGCTGTCACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAGCCAAACTCCAGGACCTCCTGGATCAACCAATGGGGAAGCCGAGCAATGCAAGCACAGCTATGGATGGACAGGCAACTACTCAACATGGCAGGGCTACAGTCCACATGAT
  5   1   2       bld Kid  5g                         IMAGE:4031611.5p                                                                                                                                                                                                                                                                                 CGTTGTGTTCCGCCCCCTGTCTGGAAACCCCGTAGTCTTGCGCCCTGTTACCGTTGGCTGGGTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGCGACGGAGATATGAATAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTCGGTGGCCTTGACTGGAGCACGACACAGGAAACCCTGCGCAGTTACTTTTCTCAGTATGGAGAAGTTGTAGACTGCGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAATGATCCCAATTGTGTAGGAACTGTCCTAGCCAGCAGACCGCATACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAACCTGAGAGAACCCGGCCACGAGAAGACTGGCACCAAAAAGGAACCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAGGGAATATTTTAACAGATTTGGAGTGGTAACTGAAGTGGTTATGATTTATGATGCTGAAAAACAAAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCGCGTGATAGCAAAAGCCAAACTTCCAGGACCTCCTGGATCAAACCAGTGGGGAGGTAGAACCAATGCAAAGTACAGCTAAAGGGATGGACAGCGCAGCCCTCCTCCAACATGGCAAGGGCCTACAATCCAACAAGGGGATGTGGGATGCCCAACAAGGACAAACCATTTGGGGGGGTT
  5   1   2       bld Oo1  5g                         IMAGE:5078760.5p                                                                                                                                                                                                                                                                                                 CTGTCTGGAAACCCCGTAGTCTTGCGCCCTGTTACCGTTGGCTGGGTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGCGACGGAGATATGAATAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTCGGTGGCCTTGACTGGAGCACGACACAGGAAACCCTGCGCAGTTACTTTTCTCAGTATGGAGAAGTTGTAGACTGCGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAATGATCCCAATTGTGTAGGAACTGTCCTAGCCAGCAGACCGCATACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAACCTGAGAGAACCCGGCCACGAGAAGACTGGCACCAAAAAGGAACCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAGGGAATATTTTAACAGATTTGGAGTGGTAACTGAAGTGGTTATGATTTATGATGCTGAAAAACAAAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCGCGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAACCCAGTGGGGAGGTAGAGCAATGCAAAGTACAGCTAATGGATGGACAGCGCAGCCTCCTCCAACATGGGCAGGGCTACAGTCCACAAGGGGATGTGGGATGCCAACAGGGACAAACCATTTGTCTTCTCCACAGGGCGGGTTATGGGGCACCTGCCAAGGCCGGGGAAAGGTCCTTCCTTCAACCTCCTCCCCTTTTGCGCC
  5   1   2       bld DMZ  5g                              xl267d12.5p                                                                                                                                                                                                                                                                                                      TGGAAACCCCGTAGTCTTGCGCCCTGTTACCGTTGGCTGGGTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGCGACGGAGATATGAATAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTCGGTGGCCTTGACTGGAGCACGACACAGGAAACCCTGCGCAGTTACTTTTCTCAGTATGGAGAAGTTGTAGACTGCGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAATGATCCCAATTGTGTAGGAACTGTCCTAGCCAGCAGACCGCATACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAACCTGAGAGAACCCGGCCACGAGAAGACTGGCACCAAAAAGGAACCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAGGGAATATTTTAACAGATTTGGAGTGGTAACTGAAGTGGTTATGATTTATGATGCTGAAAAACAAAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCGCGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGG
  5   1   2       bld DMZ  5g3  in                         xl286l23.5p                                                                                                                                                                                                                                                                                                       GGAAACCCCGTAGTCTAGCGCCGTCTTACCGTTGGCTGGCTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCG
  5   1   2       bld Emb4 5g3  in                    IMAGE:4960326.5p                                                                                                                                                                                                                                                                                                         AAACCCCGTAGTCTAGCGCCGTCTTACCGTTGGCTGGCTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGAC
  5   1   2       add Ga18 5g                           xlk108o13ex.5p                                                                                                                                                                                                                                                                                                           GAAANCCCGTAGTCTAGCGCCGTCTTACCGTTGGCTGGCTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGTGACNNANNNTGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCNCNGTNTTTTTCTCAGTATGGAGAAGTCGNANNNNTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGNCGGCCACGAGAAGGCTGGCAGNAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTANCTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGANGGTTTGGATTTATAACTTTCGAGGACGAACAATCAGNGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGNAAAAANTGAAGNCAAACGGGNNGAACCACGTGATAGCNAAAGNCAAACTNCAGGNCCTCCTGATCAAANCAANNGGNAAG
  5   1   2       bld Int2 5g3  in                    IMAGE:8820842.5p                                                                                                                                                                                                                                                                                                              TTGGAATATCTAATGTTCACATCGTTTCGTATTCGTCCCGGAGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGCAACCTCCTCAAACATGGCAGGCTACAGTCACAAGTATGTGGATGCCAACAGACAGACGATTGCGGGTATGGGCACTGCAGCCGGGGGGGTCTCTCACACTCTTTGCGCATCTAGTGTCACACCCTGAACTCCACACGCAGCCTTCCTCTGAATGCAACGCTCATGGCTTGGCTAGCAAGCTTCGTTCTGATACAGTG
  5   1   2       bld Sp1  5g                         IMAGE:4963115.5p                                                                                                                                                                                                                                                                                                                GTAGTCTAGCGCCGTCTTACCGTTGGCTGGCTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGT
  5   1   2       bld Ga15 5g3  in                       XL421b23ex.5p                                                                                                                                                                                                                                                                                                                   TCCGGCGCCGCTCTTACCGTTGGCTGGCTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCANGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAGCACAGCTAATGGAT
  5   1   2       chi DMZ       in                         xl236f04.5p                                                                                                                                                                                                                                                                                                                    ATTGGGAGGCGTCTGCCTTTCCATTTTAAGTGCTTTCATTGTATTGTAGGGAATAGTCTTAAACCATAAAACTAGGTGGGGAATGGTTGCTCTGTGATGCAGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGA
  5   1   2       chi DMZ       in                         xl242o14.5p                                                                                                                                                                                                                                                                                                                    ATTGGGAGGCGTCTGCCTTTCCATTTTAAGTGCTTTCATTGTATTGTAGGGAATAGTCTTAAACCATAAAACTAGGTGGGGAATGGTTGCTCTGTGATGCAGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGA
  5   1   2       bld DMZ  5g3  in                         xl319n08.5p                                                                                                                                                                                                                                                                                                                        CGCCGCTCTTACCGTTGGCTGGCTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCANTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGANCAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCNAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCANACCAATGGGGAAGCCG
  5   1   2       bld Ga15 5g                            XL424k21ex.5p                                                                                                                                                                                                                                                                                                                         CGCCGTCTTACCGTTGGCTGGCTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGG
  5   1   2       bld Ov1  5g                         IMAGE:6317458.5p                                                                                                                                                                                                                                                                                                                          GCCCTGTTACCGTTGGCTGGGTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGCGACGGAGATATGAATAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTCGGTGGCCTTGACTGGAGCACGACACAGGAAACCCTGCGCAGTTACTTTTCTCAGTATGGAGAAGTTGTAGACTGCGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAATGATCCCAATTGTGTAGGAACTGTCCTAGCCAGCAGACCGCATACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAACCTGAGAGAACCCGGCCACGAGAAGACTGGCACCAAAAAGGAACCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAGGGAATATTTTAACAGATTTGGAGTGGTAACTGAAGTGGTTATGATTTATGATGCTGAAAAACAAAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCGCGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAGTGGGGAGGTAGAGCAATGCAAAGTACAGCTAATGGATGGACAGCGCAGCCTCCCTCAACATGGCAGGCCTACAGTCCACAAAGGGATGTGGATGGCCAACAGGACAAAACCATTGGGCGGGTAATGGGGCAACCCTGCAGGCCCGGGGAAGGTNCTTCCCTTCCACCTCCCTCCCCTTTTGGCGCCATA
  5   1   2       bld Lmb1 5g3  in                    IMAGE:8533151.5p                                                                                                                                                                                                                                                                                                                               GANAAGTACTAAATAAATTCGTCCCGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAACCCGGCCACGAGAAGACTGGCAGCAAAAAGAAGCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCATGGGGAAGCGAGCATGCAAACACAGCTAATGGAGGACGGGGCACTTCTCAACATGGCAGCTACATCCACAGTTGTGATGCCACAGACGACATGTCTCTCCAGCGGTAGGGCACTCGGCGGGGGTCTCTC
  5   1   2       bld Emb4 5x                         IMAGE:5515425.5p                                                                                                                                                                                                                                                                                                                                 ACCGTTGGCTGGCTCCCATTTGAGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTACGTTCAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAACCAATGGGGAAGCGAGCATGCAAGCACAGCTATGGATGACAGGCAACCTCTCAACATGCAGGCTACGTCANCAGTATGTGAGCAACAGACGACATTGCGGTAG
  5   1   2       bld Ga18 5g3  in                      xlk114c21ex.5p                                                                                                                                                                                                                                                                                                                                  ACCGTTGGCTGGGTTGGTAGGAGAAGNTGCAGAGACCGGAGAGGGGCGACGGAGATATGAATAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTCGGTGGCCTTGACTGGAGCACGACACAGGAAACCCTGCGCAGTTACTTTTCTCAGTATGGAGAAGTTGTAGACTGCGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGNNTTTGTCAAATTTAATGATCCCAATTGTGTAGGAACTGTCCTAGCCAGCAGACCGCATACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAACCTGAGAGAACCCGGCCACGAGAAGACTGGCACCAAAAAGGAACCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAGGGAATATTTTAACAGANTNNNGAGTGGTANCTGAAGTGGTTATGATTTATGATGCTGAAAAACAAAGGCCAAGAGGTTTTGGANTTATAACTTTCGAGGACGAACAATCAGNGGANCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTNGAAGTCNAACGGGCAGAACCGCGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAGTGGGNGGTAGAGCAATNNAAGNACAGCTAANGGNNG
  5   1   2       add DMZ  5g3  in                         xl258e18.5p                                                                                                                                                                                                                                                                                                                                     GTTGGCTGGGTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGCGACGGAGATATGAATAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTCGGTGGCCTTGACTGGAGCACGACACANGAAACCCTGCGCAGTTACTTTTCTCAGTATGGAGAAGTTGTAGACTGCGTAATAATGAANGATAAAACAACAAATCANTCAAGAGGCTTTGGCTTTGTCAAATTTAATGATCCCAATTGTGTAGGAACTGTCCTANCCNGCAGACCGCATACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAACCTGAGAGAACCCGGCCACGANAANACTGGCACCANNAAGGAACCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAANCTGAACTGAGGGAATATTTTAACAGATTTGGAGTGGTAACTGAAGTGGTTATGATTTATGATGCTGANAAACAAAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACNATCNTGTGGACCAGGCTGTCAACATGCATTTTCACGACATCNTGGGCCAAAAAGTTGAAGTCNAACGGGCAG
  5   1   2       bld DMZ  5g3  in                         xl331i01.5p                                                                                                                                                                                                                                                                                                                                     GTTGGCTGGGTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGCGACGGAGATATGAATAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTCGGTGGCCTTGACTGGAGCACGACACAGGAAACCCTGCGCAGTTACTTTTCTCAGTATGGAGAAGTTGTAGACTGCGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAATGATCCCAATTGTGTAGGAACTGTCCTAGCCAGCAGACCGCATACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAACCTGANAGAACCCGGCCACGAGAAGACTGGCACCAAAAAGGAACCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAGGGAATATTTTAACAGATTTGGAGTGGTAACTGAAGTGGTTATGATTTATGATGCTGAAAAACAAAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCNGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCGCGTGATAGCAAAAGCCANACTCCNNGACCTCCTGNATCANACCAGTGGGGAG
  5   1   2       bld Ga15 5g                            XL430c20ex.5p                                                                                                                                                                                                                                                                                                                                         GCTGGGTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGCGACGGAGATATGAATAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTCGGTGGCCTTGACTGGAGCACGACACAGGAAACCCTGCGCAGTTACTTTTCTCAGTATGGAGAAGTTGTAGACTGCGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAATGATCCCAATTGTGTAGGAACTGTCCTAGCCAGCAGACCGCATACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAACCTGAGAGAACCCGGCCACGAGAAGACTGGCACCAAAAAGGAACCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAGGGAATATTTTAACAGATTTGGAGTGGTAACTGAAGTGGTTATGATTTATGATGCTGAAAAACAAAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCGCGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGGATCAAA
  5   1   2       chi Ga18                               xlk66i16ex.5p                                                                                                                                                                                                                                                                                                                                         GCTGGGTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGCGACGGAGATATGAATAACCAAGGCGGGGNCGAGATCGGAAAGCTCTTTGTCGGTGGCCTTGACTGGAGCACGACACAGGAAACCCTGCGCAGTTACTTTTCTCAGTATGGAGAAGTTGTAGACTGCGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGNTTTGTCAAATTTAATGATCCCAATTGTGTAGGAACTGTCCTAGCCAGCAGACCGCATACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAACCTGAGAGAACCCGGCCACGAGAAGACTGGCACCAAAAAGGAACCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAGGGAATATTTTAACAGATTTGGAGTGGTANCTGAAGTGGTTATGATTTATGATGCTGAAAAACAAAGGCCAAGAGGTAAATGAAGGCTAATCCAATGTGCTGCTGNTTTACCATTATTTCTCTGTTTAGATGGCAAATGATTTTACNATATATAGAAAAGCTCTNNACATTACCTGACTGCGCATTTCCTGGGGCATAAACCTTCGTATCATTTTGCACTGGACAGGTTTATGATTTNCCACTGAGAGCAACTGNNNCCATATTAAAAATATCTGAATTCCCATACCTGNGCCCATGTCCTTCTACAGGTNCAATTTNA
  5   1   2       bld Ga18 5g3  in                      xlk120p20ex.5p                                                                                                                                                                                                                                                                                                                                         TTGGCTGGCTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGTGNCGNNNNNTGAACAACCAAGGCGGGGNCGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCNGNNTTTTTCTCAGTATGGAGAAGTCGNANNNGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGNNTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCNAAAAACAGAGGCCAAGANGNTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGNCCANGCTGTCAACATGCATTTTCACGACATCATGGNCAAAAAAGTTGAAGTCAAANGNNNGAACCACGTGATAGCAAANCCAAACTNCAG
  5   1   2       chi Kid                             IMAGE:7009290.5p                                                                                                                                                                                                                                                                                                                                            CCCACGCGTCCGATGAGGTGAACACTAACTGGACTTGACTTTTTACAGACAGAACAAGGGCAAAGTATGCATCTGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAAGTCAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGNATCAACCAATGNGGAAGCCCGAGCATGCAAGCACAGCTAATGGATGGACAGGGCACCCTCTCAACATGGCAGGCTACGTCACAAGTA
  5   1   2       bld Emb9 5g                         IMAGE:7978360.5p                                                                                                                                                                                                                                                                                                                                              CTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAAGTCAAACTGGGCAGAACCACGTGATAGCAAAAGCCCAAACTCCAGGATCTCCTGGATCAAACCCATGGGGAAGCCGAGCAATGCAAAGCACATCTAATGGGATGGACGGGTCAACCTCCTCAAACATGGCTTGGCTTACAGTTCCACAAGGTATGTGGATGCCAA
  5   1   2       bld DMZ  5g3  in                         xl313m06.5p                                                                                                                                                                                                                                                                                                                                              CTTGGTAGGAGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCT
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073336.5p                                                                                                                                                                                                                                                                                                                                                ccacgcgtccgcggacgcgtgggcggacgcgtgggcggaGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGC
  5   1   2       chi Emb9                            IMAGE:7977169.5p                                                                                                                                                                                                                                                                                                                                                 AAGTTTTTCCGGTTCCGGGAATTCCCGGGATCGGAGTTATGAACAACCAAGGCGGGGACTTATGTATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTATGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCATGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAATAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACTCAACTGTGGAGAAACTGAACTGAAGGAACATTTTAATAGATTTGGAGTGGTAACCGAGGTGGTTATGATATATGATGTCGAAAAAACAGACGCCAAGAGGTTGAAGCCAATCGGGCAGAACCACGTTGATAGCATAAAGCCAAACTCCAGGACTCCCTGGATCATAACTAATGGGGAAGCCGAGCAATGCTAAATCACAGCTAATGTATGGACAGGAGAGTCTCTTTAAACATGGTCCGGGCTACAATCCACAAGGTATGTGGAATGCATACAGTCATG
  5   1   2       bld Oo1  5g                         IMAGE:5079258.5p                                                                                                                                                                                                                                                                                                                                                  GTAGGAGAAGCTGCAGAGACTGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCCTCCTCANACATGGCAGGGGCTACAGTCCCCCAGGGTATGGGGGATGCCCAACAGGGACAGACCGATTTGGCCGGGTAATGGGGCAAACCTGGCAGGCCCgggggggggTTCCTTCCTTCCACCAACCTTTCCCTTTTGGCGCCCAATTCCTATAGTGGTCCAACAAAACCCCCTGGGAACCCTTTTccccccccccACCGGCCAGGGGGGCCTTTC
  5   1   2       bld DMZ  5g3  in                         xl330e23.5p                                                                                                                                                                                                                                                                                                                                                  GTAGGAGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAG
  5   1   2       bld DMZ  5g3  in                         xl294a09.5p                                                                                                                                                                                                                                                                                                                                                    AGGAGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAA
  5   1   2       bld Emb4 5g                         IMAGE:5537448.5p                                                                                                                                                                                                                                                                                                                                                       AGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCCTGGATCAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCCCAAGGGAATGTGGATGCCCAACGGGAAAACGATTTGCCGGGTATTGGGCAACCTGCAAGGCCgggggggggTCCTCCTCCACCACCTTCCCTTTGGCGCCATTTCCTAAGGTCAAACACCCCCTGGGACCTTTTCCCCACCACCCGCAGGGGCTTTCCCTCCTGGGAAATTTCCCCCCACCCGCGCCTCCCCTTTGGGG
  5   1   2       chi Emb1                            IMAGE:6864417.5p                                                                                                                                                                                                                                                                                                                                                       AGAAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTAAATAAAGGCTAATCCAATGTGCTGCTGAGCTACTTTACCGTTATTTTTCTGTTTAGATGGCAAAGAATTTTACAAATATATAGAAAAGCTCTGCACATTTCCTGACTGCACATTTCCTGGGGCATAAGCCTTCGTACCATTTTGCACTGAACAGGTTTATGATTCACAATGAGAGCAACTGTAAAGCATATTAAAAATATCAACTCCCATAGCAGGAGCCCATGTCCTTCTACTGGTGCAATTTTAATAATTTAAAACGGTGTCTTANAAGCATGGTCTGTAAATgtttttgtttttattttatttttatcatccttttgggttttcttttGAACAC
  5   1   2       bld Ga15 5g                            XL442a08ex.5p                                                                                                                                                                                                                                                                                                                                                        GAAGCTGCAGAGACCGGAGAGGGGCGACGGAGATATGAATAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTCGGTGGCCTTGACTGGAGCACGACACAGGAAACCCTGCGCAGTTACTTTTCTCAGTATGGAGAAGTTGTAGACTGCGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAATGATCCCAATTGTGTAGGAACTGTCCTAGCCAGCAGACCGCATACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAACCTGAGAGAACCCGGCCACGAGAAGACTGGCACCAAAAAGGAACCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAGGGAATATTTTAACAGATTTGGAGTGGTAACTGAAGTGGTTATGATTTATGATGCTGAAAAACAAAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCACTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCGCGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAGTGGGGAGGTAGAGCAATGCAAAAGTACAGCTAATGGATGGACAG
  5   1   2       bld Ga15 5g3  in                       XL478c14ex.5p                                                                                                                                                                                                                                                                                                                                                         AAGCTGCAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAAGGTATGTGGATGCCAACAG
  5   1   2       chi Ga18      in                      xlk153b19ex.5p                                                                                                                                                                                                                                                                                                                                                         GAGAAGNTGCAGAGNCCGGAGAGGGGNGNCNGNNTATGAACAACCAAGGCGGGGNCGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCNCNGTNTTTTTCTCAGTATGGAGAAGTCGNNNNNNTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGNNTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGNTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAANNCAAACTCCAGGANCTCCTGGATCAAACCAATGGGGAAGNCGAGNAATNNANANNNAGNTAATGGNNGGACAGGGCAACCTNNNCAAACATGGCAGNNTACAGTCCA
  5   1   2       bld Ga18 5g3  in                      xlk144h23ex.5p                                                                                                                                                                                                                                                                                                                                                         GAGAAGNTGCAGAGACCGGAGAGGGGTGANNNNNNNTGAACAACCAAGGCGGGGNCGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCNCNGTNTTTTTCTCAGTATGGAGAAGTCGNNNNNNTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGNTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTANCTGAGGTGGTTATGATATATGATGNCGAAAAACAGAGGCCAAGAGGNTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGNNAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGNAAT
  5   1   2       bld Ga15 5g3  in                       XL502b11ex.5p                                                                                                                                                                                                                                                                                                                                                               CAGAGACCGGAGAGGGGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCCAACCTCCTCAAACATG
  5   1   2       bld Ga18 5g3  in                      xlk123b10ex.5p                                                                                                                                                                                                                                                                                                                                                                TGCAGAGACCGGAGAGGGGTGACNNNNTNTGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGNNNTNTTTTTCTCAGTATGGAGAAGTCGNNNNNNTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGNNTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTGGATTTATAACTTTCGAGGNCGAACAATCAGNGGACCANGNTGTCAACATGCATTTTCACGACATCATGGGNAAAAAAGNTGANGNCAAACGG
  5   1   2       bld Oo1  5g                         IMAGE:5083690.5p                                                                                                                                                                                                                                                                                                                                                                              GGTGACGGAGTTATGAACAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGTCTTCTCCACAGGCGGGTATGGGCAACCTGCAAGCCCgggggggggTCCTCCCTCCACCACCCTTCCTTTTGCGCCATTTCCNTAGTGTCAACAACCCCCTGGGACCCTTTCCCCACCCACCCGCAGGGGCTT
  5   1   2       bld Ga18 5g3  in                      xlk105c02ex.5p                                                                                                                                                                                                                                                                                                                                                                                  GGTGNNNNAGTNTGAACAACCAAGGCGGGNNNNGATCGGAAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCCTGCGCNGTNTTTTTCTCAGTATGGAGAAGTCGNANNNNTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGNTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTANCTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGNTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGNCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATNNAAANNACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGCTACAGTCCACAAGGTA
  5   1   2       bld DMZ  5g3  in                         xl291l04.5p                                                                                                                                                                                                                                                                                                                                                                                     GAGATATGAATAACCAAGGCGGGGACGAGATCGGAAAGCTCTTTGTCGGTGGCCTTGACTGGAGCACGACACAGGAAACCCTGCGCAGTTACTTTTCTCAGTATGGAGAAGTTGTAGACTGCGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAATGATCCCAATTGTGTAGGAACTGTCCTAGCCAGCAGACCGCATACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAACCTGAGAGAACCCGGCCACGAGAAGACTGGCACCAAAAAGGAACCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAGGGAATATTTTAACAGATTTGGAGTGGTAACTGAAGTGGTTATGATTTATGATGCTGAAAAACAAAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCGCGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAGTGGGGAGGTAGAGCAATGCAAAGTACAGCTAATGGATGGACAGCGCAGCCTCCTCCAACATGGCAGGGCTACAGTCCACAAGGGATGTGG
  5   1   2       bld Ga14                                Ga14-p5c7.5p                                                                                                                                                                                                                                                                                                                                                                                           TGAACAACCAAGGCGGGGACNAGATCGGNAAGCTCTTTGTTGGTGGCCTTGACTGGAGCACAACGCAGGAAACCTGCGCAGCTATTTTTCTCAGTATGGAGAAGTCGTNAGACTGTGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTC
  5   1   2       bld DMZ       in                         xl327f01.5p                                                                                                                                                                                                                                                                                                                                                                                                               GTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGCTATGGCTATGGGCCACCCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAG
  5   1   2       bld Neu7      in                         XL007c17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAGCACGACACAGGAAACCCTGCGCAGTTACTTTTCTCAGTATGGAGAAGTTGTAGACTGCGTAATAATGAAAGATAAAACAACAAATCAGTCAAGAGGCTTTGGCTTTGTCAAATTTAATGATCCCAATTGTGTAGGAACTGTCCTAGCCAGCAGACCGCATACA
  5   1   2       chi Ga15      in                       XL416c08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAACCCCTCTTAAAAGCATTAACAGAATCAGCCATAACAACATCGCCCGGCAGGGCATTACAGAACCTCACTGTCCTCACTGTGAAGAACCACCGACACTGCTTCAAATGAAAGTTCTTTTCTTCTAGTCTGAAGGGTACGGTGATCCTTTTTATGGATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCC
  5   1   2       bld Lmb1      in                    IMAGE:8531550.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GNGAGTCATAATTGAATTCGTCCCTAATATCTTTTCTCAGAGTTTAATGGAATACATTTATTGTACCTAACAATCATTTTACTGACCTAAATAATGTCCTTTAAATAGTTAGAATTAAGTTGTAAAGGAGTTAAGTTGTAAAGTGCTAAGTTTAATTGTAAGTACAATTTGGGTCAAAGGGGTGGGCTGGTGGCAAGAACCACTGAACTCCTCCTTAACTAATAACACATTTTGTTCAGGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGCTATGGCTATGGGCCACCCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAG
  5   1   2       bld DMZ       in                         xl248k15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCNGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTANGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCANTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCG
  5   1   2       bld DMZ       in                         xl267k24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACA
  5   1   2       bld DMZ       in                         xl338p16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGCTTTGGCTTTGTCAAATTTAAGGATCCCAATTGTGTAGGAACAGTCTTAGCCAGCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCT
  5   1   2       bld Lmb1                            IMAGE:8533667.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAGACCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTGGCTATGGCTATGGGCCACCCCTCCCCCTCTGATCAGTCGTCTCTCANGAGTCCCACACTCCTGGTACACAGAGCACACGTAGCGTCCCTCTCCCAGGCATCACTCAGATCTGACACCCCAGTGTCACAGATTTCTTTAGCAGTGATGCTGCTGTGATGTCATG
  5   1   2       bld Ga18      in                      xlk135c08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCACACACACTGGATGGCCGGAATATTGATCCAAAGCCATGTACCCCTCGAGGAATGCAGCCTGAAAGAAGCCGGCCACGAGAAGGCTGGCAGCAAAAAGAACCCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGNACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGNNTACAGTCCACAAGGTATGTGGATNCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGNNCCTCCTCCACCACCTTCCTTTGCNCCATTCCTAGNGTCAACAACCCCTGGACCTTNNCCACCACCGCAGGCTTTCCTCCTGGANATGCCACACCGCCTCCCTTTGGCTATGNNTATGGGCCACCCCCNNCCCCTCCTGATCAGT
  5   1   2       bld Emb1                            IMAGE:6864891.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGTAACTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGCTATGGCTATGGGCCACCCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGAAATGCCTGCTTTGTGAAATTGTCCGAGTGGATTTGACCTCTCGAAGTCCATCAAAGGGCAGTGGGTTccaaaccagtggcacatgtgcaacatgttattcgccaaccccttggatgttgctccctgtggcctcaaGGTTATGGACAAGACATGAGTGGGGTTTGGGCAAAGTTCCCGGACCTCACCAGCAGCCCCCTACACGACAGGACCTGCACCCTTCCATCACAAAGTTTGGGGGAGGCCCCACCCCGCCCTGGGGGAAAGTGGGTTTGGGGCT
  5   1   2       bld Neu7                                 XL050f01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTACCCCTCGAGGAATGCAACCTGAGAGAACCCGGCCACGAGAAGACTGGCACCAAAAAGGAACCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAGGGAATATTTTAACAGATTTGGAGTGGTAACTGAAGTGGTTATGATTTATGATGCTGAAAAACAA
  5   1   2       chi DMZ       in                         xl312b23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTAAAGTGCTAAGTTTAATTGTAAGTACAATTTGGGTCAAAGGGGTGGGCTGGTGGCAAGAACCACTGAACTCCTCCTTAACTAATAACACATTTTGTTCAGGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGCCCTGTCCTGTTTCTCTAGGGCAGTGGGTTccaaaccagtggcacatgtgcaacatgttattcgccaaccccttggatgttgctccctgtggcctcaaGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAG
  5   1   2       bld Ga18      in                      xlk164a02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGNCAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGCTATGGNTATGGGCCACCCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGNTTGGNTATGGACAAGACATGAGTGGGTTTGGNCAAAGNTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACANGACCCTCCACACCAGCATCGGGAGGCCCAGCCNCCGTGGGAAGNGNNTTGNCAGAGGNNA
  5   1   2       bld Lu1                             IMAGE:4056308.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACGCGTCCGGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGCTATGGCTATGGGCCACCCCCTCCCCCTCCTGATCAGTTCGTCTCT
  3   1   2       bld Ga18      in                      xlk135c08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTNGAGGNCGANCNATCANTGGNCNAGGCTGTCAACANGCATTTNNCGACNNCANGGGNAAAAAGTTGAAGTCAAACGGGNANNNCNCGTGATANNAAAANCCAANCTNCAGGNCCTCCTGGATCAANCCAATGGGGAANNCGANNAATNNAAANNACAGCTAATGGATGNACAGGNNAACCTCCTCAANCATGNNAGGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGNNAACCTGCAGGCCGGGGGGNTCCTCCTCCNCCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGNCCTTTCCCACCNCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGCTATGGCTATGGNCCNCCCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAGGANTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCNGNNCTTTGTNTNNCATA
  5   1   2       add Ga18      in                      xlk109f11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGNCAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGTCTTCTCCACAGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGCTATGGNTATGGGCCACCCCCTCCCCCTCCTGATCAGTTCGNCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTCCTTTNAGCCAGNTTNGNNATGGACAAGACATGAGTGGGTTTGGNCNAAGTTTCCCGGANCTNANCAGCAGCCCCCTNACACGACAGNCCCTCCACACCAGCATCGGGNNGCCCAGCNG
  3   1   2       chi Ga18      in                      xlk139c24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCANNAAANNACCCAGACTGAAACAGTAGGNCNANNAAANTTTTNNGGGAGGNNNCCACANNNCTGTGGAGAACTGANCTGAAGNANNNTTTNNNAGNTTTGGAGTGGTAACTGNNNNGNTTATGANATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGNCCAGGCTGTCAACATGCATTTTCACGACATCATGGNCAAAAAAGTTGAAGTCAAACGGGCAGANCCACGTGATAGCAAAAGCCAANCTCCAGGACCTCCTGGATCAANCCAANNNNAANCCGANCAATNNAAAGCACAGCTAATGGATGGACAGGGCANCCTCCTCAAACATGNNAGGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGNCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGANNCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATNTTTCTG
  5   1   2       bld Emb1                            IMAGE:6636992.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACCAGAACTGAAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAGGGAATATTTTAACAGATTTGGAGTGGTAACTGAAGTGGTTATGATTTATGATGCTGAAAAAACAAAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGNCTGTCAACATGCATTTTCACGAATTCATGGGCAAAAAAGTTGAANTCAAACGGGCAGAACCGCGTGATAGNAAAGCCANACTCCAGAACCTCCTGGATTAAACCANGGGNGAGGTAGAAGNAATGGNAAGTACAGCTAATGGATGGAACAGCCCACCCTCCTCCAANATGGCAGGGNTTACANCTCCCAAGGGGATGGGGATGGCCNACAGGGANAAACCATTGGAGCGGCATGGGGCAAACCTGCAAGGCCGGGGAAGGGCCCTCCCTCCCACCCTCCTCCCCTTTTGGGCCATTCGCTAATGGACAACAACGCGCTGGGACCCATTTCACCCCCGGGCCCCCGANCTTTTTCCTTCCGGGGAATATGCACGACCCCGCCCGATCCCGCTTNTCGGTTTATTGGACCAACGAACACTGNTATTGGGCGGTATGGGTAGAAAGACAGGTGTCCCGCTGGACCCCTCCGAGCCCGGAGCCAGGGCAGCCCCTTTAACGCTGCAAGAAGAGGGACCCTCTTCCCGACACATATGACCGATGCAGAAAATGGAGACGCCCACTCCCGGNGCCCGGACGGCTNCCAGGCCGCCTTTGGGCCCCTCAGAAGGGCGAACCAACGCGCCACGAAATGGGCNTGGTAAGGGAATCTTCCCCACACCCACTTCCACACGCGNNCGCTACTAATGCCACAACCCACAGACCCCGAGCCACCCGCTGGCGTACGGGCAGGCGGGGACATGACAGGCTTGAATGTGGCCGGCACGACGCCTACGTAGTGATCTTTAGACTCACTACACTACCACCGGATAGATGGAGCGCAAGCTCTCGCGCGGAGCAGATTTTANGTAGCGTCAGTGGAGTGTGGCGAGGGCGTTTACTTCGGAGTCCAAGACTGGCCN
  5   1   2       bld Ga18      in                       xlk62o21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAACAGTAGGTCCAACAAAATTTTTGTGGGAGGAATTCCACACAACTGTGGAGAAACTGAACTGAAGGAATATTTTAATAGATTTGGAGTGGTANCTGAGGTGGTTATGATATATGATGCCGAAAAACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAANNNAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGNNTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGCTATGNNTATGGGCCACCCCCTCNNCCTCCTGATCAGTTCGTCTCTNCAGGAGTTCCACCACCTCCTGGTACACCAGGNGCAGCACCGTTAGCGTTCCCNCCTCCCCCANGGCAGTCAGNTCAGGATCTGAGNNAACCCCCCAGTGGNCAGNAGGNTTTTNCTTTTAGCCAGTTNNAAATGNNTNCTTT
  5   1   2       bld DMZ       in                         xl312c03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATCTTTTCTACAGAGTTTAATGGAATACATTTATTGTACCTAACAATCATTTTACTGACCTAAATAATGTCCTTTAAATAGTTAGAATTAAGTTGTAAAGGAGTTAAGTTGTAAAGTGCTAAGTTTAATTGTAAGTACAATTTGGGTCAAAGGGGTGGGCTGGTGGCAAGAACCACTGAACTCCTCCTTAACTAATAACACATTTTGTTCAGGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGA
  5   1   2       bld DMZ       in                         xl274a22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATCTTTTCTACAGAGTTTAATGGAATACATTTATTGTACCTAACAATCATTTTACTGACCTAAATAATGTCCTTTAAATAGTTAGAATTAAGTTGTAAAGGAGTTAAGTTGTAAAGTGCTAAGTTTAATTGTAAGTACAATTTGGGTCAAAGGGGTGGGCTGGTGGCAAGAACCACTGAACTCCTCCTTAACTAATAACACATTTTGTTCAGGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATG
  5   1   2       bld Egg5      in                    IMAGE:3431099.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCATAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGCTATGGCTATGGGCCACCCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACA
  5   1   2       bld Gas5      in                    IMAGE:3749043.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGCTATGGCTATGGGCCACCCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGT
  5   1   2       bld Em10                            IMAGE:8319440.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGCTATGGCTATGGGCCACCCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGTTTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGANCATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTAG
  5   1   2       bld Lmb1                            IMAGE:8532601.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTAGGCTGGGGAGTGCGAGAGCACATCGAGTCGATAGCTGCATTCGTCCCACAGGGATGTGGATGCCAACAGGACAAACCATTGGCGGGTATGGGCAACCTGCAGGCCGGGGAGGTCCTCCTCCACCTCCTCCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCACAGGGCTTTCCTCCGGGATATGCCACCCCACCTCCATTCGGCTATGGCTATGCGCCACCCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCATTAGCGTTCCCTGCTCCTCCCCCAGGGCAGTCAGCTCAAGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGAAATGCCTGCTTTGTGAAATTGTCCGAGTGGATTTAACCTCTCTAAGAAGTCCATCAAAGGTTATGGACAAGACATGAGTGGGTATGGGCAAAGTTTCCCTGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCACCCGCCGGGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGCGCAAGGATTCCATCCCTACAGGCGCTAATATCAAGCAGGCAGAATTGTGCACAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACCCATCCTGCTATAGACTTGTGGAAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGGACTACAGG
  3   1   2       bld Lmb1      in                    IMAGE:8531550.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCGCTTAATAAACATTGTCAGTGAGTCAACGCGAACGTAGCAGCATCAGACTCGTACATCATGGAGCGGGCATGCAGCCAGTATGATGACAGCACTCCTCAACATGCAGGCTACAGTCACAAGTATGTGATGCCACAGACAGACGATGCGGTATGGCACTGCAGCGGGGGGTCTCCTCACCACTCTTTGCGCCATCTAGTGTCAACAACCCTGGACCTTTCCCACCACCGCAGGGCTTTCTCCTGATATGCCACACCGCCTCCTTTGGCTATGGCTATGGGCCACCCCCTCCCCTCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTTTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGATAAAGATCAAAACAGATACCTATACGAATACAAAGCTCAGCCTGCT
  5   1   2       bld Egg5                            IMAGE:3430954.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCATACCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGCTACAGTCCACAATGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTACTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGACTCCCTTTGGCTATGGCTATAGGCCACCCCCTCCCACTCCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCG
  5   1   2       bld DMZ       in                         xl232a01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACAGAGGCCAAGAGGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCACGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAA
  5   1   2       bld Ga18                              xlk139i17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTTTTGGATTTATAACTTTCGAGGACGAACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCGCGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAGTGGGGAGGTAGAGCAATGCAAAGTACAGCTAATGGATGGACAGNNCNGNTCCTCCAACATGGCAGGNTACAGTCCACAAGGGATGTGGATGCCAACAGGACAAACCATTGTCTTCTCCACAGGCGGGTATGGGCAACCTGCAGGCCGGGGAGGTCCTCCTCCACCTCCTCCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCACAGGGCTTTCCTCCGGGATATGCCACCCCACCTCCATTCGGCTATGGCTATGCGCCACCCCCTCCCCCTCCTGATCAGNTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCATTAGCGTTCCCTGCTCCTCCCCCAGGGCAGTCAGNTCAAGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGCAGGTCAGCGATCCCTGATTTGATCGCAAACAGTACCATTGGAGTGGCTCAAAACCCAGAAGGNTATGGACAAGANATGAGNNGGTATGGGCAAAGTTTCCCTGACCTCAANCAGCAGCCCCCTTACACGAC
  3   1   2       bld Ga18 5g3  in                      xlk144h23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTGNATTNNACTTCGANGACNANATCAGNNNCAGGCTGNCAACATGCATTTCNNGNCNTCATNGGCAAAAAANTGAANTCAAACGGGNANNNCNCGTGATANNAAAANCCAANCTCCAGGNCNNCCTNGATCAAACCAATGGGNNAGCCGANCAATNNAANNNACAGCTAATGGATGGACAGGNCAACCTCCTCAAACATGNNAGGGCTACAGTCCNNNAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGNNAACCTGCAGGCCGGGGGGNNCCTCCTCCACCNCCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGNCCTTTCCCACCNCNNAGGNCTTTCCTCCTGGATATNNCACACCNCCTCCCTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGNCCCCTTACACGACAGGNCCCTCCACACCAGCATCGGGANNNCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGNTTTCCGGTGACAC
  3   1   2       bld Ga15 5g3  in                       XL502b11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ANCAATCAGTGGACCAGGCTNTCAACATGCATTTTCANGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCANGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAATGGGGAAGCCGAGCAATGCAAAGCACAGCTAATGGATGGACAGGGCAACCTCCTCAAACATGGCAGGGNTACAGTCCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTATCAGGCGTTAATATGAGGCAGGCAGAATT
  5   1   2       bld Ga12      in                         XL180o09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAACATGCATTTTCACGACATCATGGGCAAAAAAGTTGAAGTCAAACGGGCAGAACCGCGTGATAGCAAAAGCCAAACTCCAGGACCTCCTGGATCAAACCAGTGGGGAGGTAGAGCAATGCAAAGTACAGCTAATGGATGGACAGCGCAGCCTCCTCCAACATGGCAGGGCTACAGTCCACAAGGGATGTGGATGCCAACAGGACAAACCATTGTCTTCTCCACAGGCGGGTATGGGCAACCTGCAGGCCGGGGAGGTCCTCCTCCACCTCCTCCCTTTGCGCCATTCCTA
  5  -1   2       chi Bla2                            IMAGE:7298741.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATGCGCCCAAGCCAGCCAGCGATATTAGTCTCGTCTTTGTGTCTCATCCAGGGTGACCAGCGGGTTCTCCCCTTCTGGCTTGGTACACCTGACTTCACACGAGCTCTCTGTAGCACACGCTCCTTGTATGNTAGGCACCCCTCNNCCCCCCTACATCGTCTCAGAGTCACCACTCCTGTACACAGGAGCACACCGTTGGTTCCTCCTCCCCCAGGGCGTCAGTCAGGTCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGAAATGCCTGCTTTGTGAAATTGTCCGAGTGGATTTGACCTCTCGAAGTCCATCAAAGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGACAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGgtttaatttggggtttgtttttgttctttttatttagttttttgttttgggagggatatttctgagcctttgttttaccatatagtaaacttttatgtttaaagatgaaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGGACCCAATCGCCCAAGAAGGG
  3   1   2       chi Int2      in                    IMAGE:8822118.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTCTCGACTTCAGGGCAAATAGGTGAGTCAACGGCGAATCAGGGAAGCAAAGGCACTCAGACTCGATCAATCCATTGGGGAGCCGAGCATGCAAAGCACAGCTATGGATGGACAGGGCCACTCTCAAACATGGCAGGGCTACAGTCACAAGGTATGTGGATGCCAACAGGACAGACGATTGGCGGGTATGGGCAACTGCAGGCCGGGGGGGTCCTCCTCCACCACATCCTTGCGCCATCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGAATGTGAATTTTTTAAAAACACAATCCAATCATGTAATCTGTTCTTCTCATCACATAACAGCAAAGTATACGTAACAAAGCTCAGCCTTCC
  5   1   2       bld DMZ       in                         xl247b20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGGTTGAAGCTAGAAGTGCTTTATGCACTTCTGCTCCTCAAACTTTGTATGACCTGAGACCTCAAATGCCATGCAGTGCTGTAAAACTAGGCAGACAGCTCTATGTCTGATTCTGCAAAACACCAAGCCTCCTGCCTTGCTGTGTGGGAGATCAAGTGGGGTTTATACTGCATGCCTAAACCATGCCTCATAAAAAGCCTGAAGAAATCACTCTTTCCAGGAAATGCCTGCTTTGTGAAATTGTCCGAGTGGATTTGACCTCTCGAAGTCCATCAAAGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTC
  5   1   2       bld DMZ       in                         xl246b20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGGTTGAAGCTAGAAGTGCTTTATGCACTTCTGCTCCTCAAACTTTGTATGACCTGAGACCTCAAATGCCATGCAGTGCTGTAAAACTAGGCAGACAGCTCTATGTCTGATTCTGCAAAACACCAAGCCTCCTGCCTTGCTGTGTGGGAGATCAAGTGGGGTTTATACTGCATGCCTAAACCATGCCTCATAAAAAGCCTGAAGAAATCACTCTTTCCAGGAAATGCCTGCTTTGTGAAATTGTCCGAGTGGATTTGACCTCTCGAAGTCCATCAAAGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTG
  5   1   2       bld FaB                             IMAGE:8072660.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGGACCTCCTGGATCAACCAGTGGGGAGGTAGAGCAATGCAAAGTACAGCTAATGGATGGACAGCGCAGCCTCCTCCAACATGGCAGGGCTACAGTCCACAAGGGATGTGGATGCCAACAGGACAAACCATTGGCGGGTATGGGCAACCTGCAGGCCGGGGAGGTCCTCCTCCACCTCCTCCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCACAGGGCTTTCCTCCGGGATATGCCACCCCACCTCCATTCGGTTATGGACAAGACATGAGTGGGTATGGGCAAAGTTTCCCTGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCACCCGCCGGGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGCGCAAGGATTCCATCCCTACAGGCGCTAATATCAAGCAGGCAGAATTGTGCACAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACCCATCCTGCTATAGACTTGTGGAAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGGACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGTTTAATTTGGGtttttttttttttggatttttcttttGTTCTTGTTCTTTAAAATAATTTTTTGTTTGGGGAGG
  3   1   2       bld Ga18      in                      xlk109f11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ANNNACCCCTGGNCNTTTCCCACNNCNNANNNCTTTNNTCCTGGATNNNCNNNNNCNCCTCCCTTNNGCTATGNCTATGGNNCNCCCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAGGANTNCCACCACCNCCTGGTACACCAGGAGCAGCACCGTTAGCNTTCCCTCCTCCCNAGGGCAGTCAGCTCAGGATCTGAGCAANCCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCANNCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGANGNCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGNTTTCCGNNGACACNNA
  3   1   2       bld Ga18      in                      xlk164a02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCCNNGGNNNTTTCCNCCACNGNANNNCTTNCNNCCTGNATATGCCNNNNNCCTCCCTTTNGCTATGNCTATGGGCCNCCCCCTCCCCCNCCTGATCAGTTCNTCTCTTCAGGANTTCCACCACNNCCTGGTACACCAGGAGCAGCACCGTTAGNNTTCCCTCCTCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGNCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGNNNNNAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGNTTTCCGNNGACACTGGA
  3   1   2       bld DMZ       in                         xl338p16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGCTATGGCTATGGGCCACCCCCTTCCCCCTCCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATA
  3   1   2       bld Ga18 5g3  in                      xlk105c02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCTGGNNNTTNCCCNNNCNNAGGNCTTNNNCCTGGATATNNNNCNCCNCCTCCNTTTNNCTANNGCTATGGGCCNCCCCCTCCCCCTCCTGATCAGTTCNTCTCTTCAGGANTTCCACCACCNCCTNGTACACCAGGAGCAGCACCGTTANNNTTCCCTCCTCCCCNAGGGCAGTCAGCTCAGGATCTGAGCAANCCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGNCCCCTTACACGACAGGACCCTCCACACCAGCATCGGNNNNNNAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGNTTTCCGNTGACAC
  3   1   2       bld Int2 5g3  in                    IMAGE:8820842.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGAGCATTTCCACCACCAACGCCGAGGGCTTTCTCCTGATATGCCACACCGCCTCCCTTGGTAGGGTAGGGCCACCCCCTCCCCCTCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATCAAAATAGATACCGTATACGGGTAAAGTAAAGGGTAAAGCTCATGAAAATAA
  3   1   2       bld Ga18 5g3  in                      xlk123b10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGNTTNCNTNCTGGATATGCCACACCNNCTCCCTTTGGCTATGGCTATGGNNCACCCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAGGANTTCCACCACCNCCTGGTACACCAGGAGCAGCACCGTTAGNGTTCNCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGNCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAANCTTTTATGTTTAAAGANGAAAATATA
  3   1   2       bld Ga15 5g3  in                       XL421b23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGATCAGTTCGTCTCTTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGAAATGCCTGCTTTGTGAAATTGTCCGAGTGGATTTGACCTCTCGAAGTCCATCAAAGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTACAGATGG
  5  -1   2       bld Sp1                             IMAGE:5506854.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCAGTCGTCTCTCAGAGTTCACCCACTCCCTGTACACCAGGAGCAGCACCGTTAGCGTCCCCTCTTCCCCNCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGAAATGCCTGCTTTGTGAAATTGTCCGAGTGGATTTGACCTCTCGAAGTCCATCAAAGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGgtttaatttggggtttgtttttgttctttttatttagttttttgttttGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTAATTAAGGCAGGGTTANGGACAAAGCCCGCCTCTCCTAA
  5   1   2       bld Ga15      in                       XL428o02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCGTTTGATGTTTATTGCAGGCTATGGCTATGGGCCACCCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAggtttaatttggggtttgtttttgttctttttatttagttttttgttttGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTAT
  3   1   2       bld Ga18      in                      xlk153b19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAANNNTGNAGGCTANNNNCNACAAGGTATGTNGATNCANNNGGNCAGNNGATNNNTCTCANNGNNGGTATGGNNNNNTGCAGGCCGGGGGGGNCCTCNNNNCCACCNNNTTTGNGCCATTCCTAGTNTCAACAACCCCTGGNCNTTTCCCACNNCNNAGGGCTTTCCNCCTGGATATGCCACACCGCCTNCTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAANTTTCCCGGNCCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACNCCAGCATCGGGANNNCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGNNTTTCCGNNGACA
  3   1   2       bld Ga15      in                       XL428o02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTTGATGTTTATTGCAGGCTATGGNTATGGGCCACCCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGC
  3   1   2       bld Ga18 5g3  in                      xlk120p20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTNCCNTNNGCTATGNCTANGGNCCACCCCCNCCCCTCCTGATCAGTTCNNCTCTTCAGGANNTCCACCACCNNCTGGTACACCAGGAGCAGNACCGTTAGCGTTCCCTCNNCCCCAGGNCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGNCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGNNCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGNTTTCCGNTGACACNNA
  3   1   2       bld DMZ       in                         xl248k15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGCTATGGGCCACCCCCTTCCCCCTCGTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTNATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTNTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTNTTTTACCATATAG
  3   1   2       bld DMZ                                 rxl224j11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTATGGGCCACCCCCTCCCCTCCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTT
  3   1   2       bld Ga15 5g3  in                       XL478c14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATGTGGATGCCAACAGGACAGANCGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTT
  3   1   2      seed Ga15      out                      XL519h08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCCACCCCCTCCCCCTCCTGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGC
  3   1   2       chi Emb9                            IMAGE:7975689.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACCCACCCTACTAAAGGGATATTTTTCAAAAGTTTAAGACTGACGAGGGTCACTAGTGGCGCCCCGGCAGGGTTTGCTTCTCGAAACGANCANTTTGATCAGGTTTTGTACAAACCCNCCNGNGGTANCACTTGATTCCTTAAAACNAGATAGATANTNGNCGAGNCCTCTGTGGGTATTGGCGAAGTTTCCCGTACATCAACCAGCTGCCCCCAGACAGGACAGGACCCTCCACACCAGCTTCGTGAGGCCCAGCCGCCTTGGGAAGTGGTTTGGTCAGTGGACTGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGTAGACACATCCTGTTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGTCCCATCCGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATTTGCAGCTTTAATGGAACTCTTCAGGTTTAATATGGGGTTTGTTTTTGTTCTTTCTATTTAGTTTTTTGTTTTGGGAGGGATATTTATGACCCCATTGTTTTCCCATACAGTAACCTTTTATGTTTTAAGATGAAAATATCTACATTTCCAGATTGCGAATTTTTTTAAAATGACATTTTCTATCTGGTAATCAGTTTTTTTCTCACTTAACGGCAGCTTACTTATGCAAAGCACGCCACCTCCG
  3   1   2       bld DMZ  5g3  in                         xl319n08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAGACGATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAANGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACNTCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTnGTTTTGGGAGGGATANTTCTGAGCCTTNGTTTTACCATATAGTAAACTTTTATGNTTAAAGATGAAAATATATACATTTACCAGATTGTGAATTTTTAAAAAATGAATTNTCTATCTATGTATTACAGGTTTATTTTT
  3   1   2       bld DMZ       in                         xl327f01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGATCAGTTCGTCTCTTCAGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCCAGGGTT
  3   1   2       bld DMZ       in                         xl312c03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTGGCGGGTATGGGCAACCTGCAGGCCGGGGGGGTCCTCCTCCACCACCTTCCTTTGCGCCATTCCTAGTGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCCAGGTTTATTTTTTAAT
  3   1   2       bld Lmb1 5g3  in                    IMAGE:8533151.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTCTCACAGGCGGGTATGGCAACTGCAGGCCGGGGGGTCCTCCTCCACCACTTCCTTGCACCATCTAGTGTCAACAACCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCTGGATATGCCACACCGCCTCCCTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCACAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGGACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTTTGACCCTTCGTTTTCCCATACAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACCTATGTATTCAGGTTTACTTTATAAATAACAGCAAAGTATACTATAACAAAGCCTCAGCACATACT
  3   1   2       bld Ga18                              rxlk62c14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTNTTTTTTTTTATATNNNGGTGTGNAGAGNAGATTTGTATTNATACAGTATGTGNTNGTANNAAANCCNCCATNCNAAGTGTTTTTCAATAGAATGTTTCCNATANTCATTATTTCTTTTTTTGACATAGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGNCCTCANCCAGCAGCCCCCTTACACGACAGGNCCCTCCACNCCAGCATCGGGNNNNCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGNTTTCCGNNG
  3   1   2       bld DMZ       in                         xl267k24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGAGTTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATA
  3   1   2       bld DMZ                                 rxl341g16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTTTTTTTATATATTGGGTGTGTAGAGTAGATTTGTATTTATACAGTATGTGGTTGTATAAAGCCTCCATACCAAGTGTTTTTCAATAGAATGTTTCCATATTCATTATTTCTTTTTTTGACATAGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCCAGGTTTATTTT
  3   1   2       bld DMZ  5g3  in                         xl294a09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCCACCACCTCCTGGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCCAGGTTTATTTTT
  3   1   2       bld DMZ  5g3  in                         xl313m06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAAGTCCATCAAAGGCCCTGTCCTGTTTCTCTAGGGCAGTGGGTTCCAAACCAGTGGCACATGTGCAACATGTTATTCGCCAACCCCTTGGATGTTGCTCCCTGTGGCCTCAAGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGG
  3   1   2       bld DMZ       in                         xl246b20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATACTGCATGCCTAAACCATGCCTCATAAAAAGCCTGAAGAAATCACTCTTTCCAGGAAATGCCTGCTTTGTGAAATTGTCCGAGTGGATTTGACCTCTCGAAGTCCATCAAAGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCCAGGTTTATTT
  3   1   2       bld DMZ       in                         xl232a01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGAAATGCCTGCTTTGTGAAATTGTCCGAGTGGATTTGACCTCTCGAAGTCCATCAAAGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAANGATTC
  3   1   2       bld DMZ  5g3  in                         xl286l23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTACACCAGGAGCAGCACCGTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGG
  3   1   2       bld Ga15      in                       XL416c08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACACCAGGAGCAGCACCGTTTAGCGTTCCCTCCTCCCCCAGGGCAGTCAGCTCAGGATCTGAGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGG
  3   1   2       bld DMZ       out                        xl235f23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTGGTCAGCAGGATTTTCCTTTTAGCCAGTTTGGAAATGCCTGCTTTGTGAAATTGTCCGAGTGGATTTGACCTCTCGAAGTCCATCAAAGGTAAGAAGATGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATNTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTNTGTTTAAAGATGAAAATATATACATNTACAGATTGCGAANTTNTAAAAAATGAATTCTCTNTCTATGTANTCAGGNT
  3   1   2       bld DMZ       in                         xl247b20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAACCATGCCTCATAAAAAGCCTGAAGAAATCACTCTTTCCAGGAAATGCCTGCTTTGTGAAATTGTCCGAGTGGATTTGACCTCTCGAAGTCCATCAAAGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATNTTT
  3   1   2       chi DMZ       in                         xl312b23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTCTAGGGCAGTGGGTTCCAAACCAGTGGCACATGTGCAACATGTTATTCGCCAACCCCTTGGATGTTGCTCCCTGTGGCCTCAAGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCCAGGTTTATTTTTTAATT
  3   1   2       bld DMZ       in                         xl242o14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTCAACAACCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCNGGATATGCCACACCGCCTCCCTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTT
  3   1   2       bld DMZ       in                         xl236f04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCTGGACCTTTCCCACCACCGCAGGGCTTTCCTCCNGGATATGCCACACCGCCTCCCTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTT
  5  -1   2       bld Bla2                            IMAGE:7300180.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGGCAGTCAGCTCAGATCTGAGCAACCCCCCAGTGTCAGCAGATTTTCCTTTAGCCAGTTTGTTATGGACAAGACATGAGTGGTTTGGCAAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGgtttaatttggggtttgtttttgttctttttatttagttttttgttttgggagggatatttctgagcctttgttttaCCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTAACTCCTTGCTTCTaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAATCGCCTTAGATGGN
  5   1   2       bld FaBN                            IMAGE:8078399.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCCATACCAAGTGTTTTTCATAGAATGTTTCCATATTCATTATTTCTTTTTTTGACATAGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGgtttaatttggggtttgtttttgttctttttatttagttttttgttttGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAA
  3   1   2       bld DMZ                                 rxl337n19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCAAACCCCCCAGTGGTCAGCAGGATTTTCCTTTTAGCCAGNNNGGTTATGGACAAGACATGAGTGGNNTTGGGCAAAGTTTNCCGGACCTCAACCAGCAGNCNCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCNGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGNTTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCNTCCACCTNTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGANTCATAGTTCNNNGTNAGAAGGAGAAGCTGTGGGTATTTGAACTNCAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTNAATGGAACTCTTCAGGTTTAANNTGGGGTTNG
  3   1   2       bld DMZ       in                         xl274a22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGCCACACCGCCTCCCTTTGGTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCCAGGTTTATTTTTTAATT
  3   1   2       bld DMZ  5g3  in                         xl330e23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTATGGACAAGACATGAGTGGGTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTT
  5   1   2       bld Ga15      out                      XL466i07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGACATGAGTGGGTATGGGCAAAGTTTCCCTGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCACCCGCCGGGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGCGCAAGGATTCCATCCCTACAGGCGCTAATATCAAGCAGGCAGAATTGTGCACAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACCCATCCTGCTATAGACTTGTGGAAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGGACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGtttttttttttnggttttttttttNG
  5   1   2       bld Egg1                               PBX0020E10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTTGGGCAAAGTTTCCCGGACCTCAACCAGCAGCCCCCTTACACGACAGGACCCTCCACACCAGCATCGGGAGGCCCAGCCGCCGTGGGAAGTGGTTTGGGCAGAGGACAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGgtttaatttggggtttgtttttgttctttttatttagttttttgttttGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATG
  3   1   2       bld Gas5      in                    IMAGE:3749043.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTAATTAATGGCAGGGTTTCCGGTACACTGGAGTTCAGATTTTAACTCCTGCTTCTAAAAA
  3   1   2       bld Egg5      in                    IMAGE:3431099.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCACAATGTACAAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTAACTCCTTGCTTCTAAAAAA
  3   1   2       bld DMZ       in                         xl237i24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTT
  5   1   2       bld DMZ       in                         xl237i24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAggtttaatttggggtttgtttttgttctttttatttagttttttgttttGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTAACTCCTTGCTTCTaaaaaaaaaa
  5   1   2       bld DMZ       in                         xl320d12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAggtttaatttggggtttgtttttgttctttttatttagttttttgttttGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTAACTCCTTGCTTCTaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl320d12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGGATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCCAGGTTTATTTTT
  5   1   2       bld Ga15      in                       XL407f21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAggtttaatttggggtttgtttttgttctttttatttagttttttgttttgggagggatatttctgagcctttgttttACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTAACTCCTTGCTTCTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL407f21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATTCCATCCCTACAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGG
  3   1   2       bld Emb4 5g3  in                    IMAGE:4960326.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGGCGTTAATATGAGGCAGGCAGAATTGTGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTAACTCCTTGCTTCTA
  3   1   2       bld Egg6                            IMAGE:4433423.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCAAAGTGGCGATGAGCTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTC
  3   1   2       bld Ga15      in                       XL446p12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGATGCTTCCACCTCTGAACTTGTGACAATCACGTGGTGAAGACACATCCTGCTTATAGACTTATAGTTCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTCCGGG
  5   1   2       bld Emb1      in                    IMAGE:3402005.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTATGTTTGAAGGAGAAGCTGTGGGTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAggtttaatttggggtttgtttttgttctttttatttagatttttggtttggggagggatatttctgagcctttgttttACCATATAGTAAACTTTTATGTTGAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTA
  5   1   2       bld Ga15      in                       XL488i07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGgtttaatttggggtttgtttttgttctttttatttagttttttgttttGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTAACTCCTTGCTTCTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL488i07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTATTTGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCCAGGGTTCC
  3   1   2       bld Emb1      in                    IMAGE:3402005.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAACTACAGTTTTCAGATCTTTCTCTGACCCATCAGCACAAATAAAGCCAATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTAACTCCTTGCTTCTAAAAAAA
  3   1   2       chi Ga18      in                       xlk62o21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TACANNTTTCAGNNNTTTNTCTNNCCNATCAGNACAAATAAANCCANTGAGTCACTNNNNNCNAAANNNGGTTNGNAAACATCTGCAGCTTNAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGNNNTCCGNTGACACNG
  5   1   2       bld Ga15      in                       XL446p12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATAAAGCCNATGAGTCACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAggtttaatttggggtttgtttttgttctttttatttagttttttgttttGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTAACTCCTTGCTTCTaaaaaaaaaa
  5   1   2       bld Ga15      in                       XL449k01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCGACTGGTTCCAAACAGGGTTTGAAAACATCTGCNGCTTTAATGGAACTCNTCNGgtttaatttggggtttgtttttgttctttttatttagttttttgttttGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTAACTCCTTGCTTCTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL449k01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTGGTTCCAAACAGGGTTTGAAAACATCTGCAGCTTTAATGGAACTCTTCAGGTTTAATTTGGGGTTTGTTTTTGTTCTTTTTATTTAGTTTTTTGTTTTGGGAGGGATATTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTT
  5   1   2       bld Ga18                              xlk118k20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTAACTCCTTGCTTCTaaaaaaaaaa
  5   1   2       e50                              Xl3.1-xlk114c21ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTTTTTTTTTTTGGTTTTTTTTTTGTTTCTTGTTCTTTATATTTAGTTTTTTGTTTTGGGAGGGAAATTTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAACAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGG------------------------------------AAAAAAAAAAAGAGAGAAAAAAAACAAAAAAAAAAGCTTTATTTTTTTTTTTTTTAATATTATTTTGGAGGGAATGGGGAGAAGGGTTGTTGGGTGCAGTTGGTCGGCATCTCGGTGTTCCTCACAGACTTCCTACTGAGTAATTGATTTTGTTACTTGAGATTAGAGTGGCTGGAAATGCCATCTGCTCCGAGGTTACCAATGGAAAGACTTTGTCCCCAAGCCTGTGACATCATATCTGCAACATTTCTGGGGTAGCAGAGCCATTTCTAGATGTAATTTCCTCAGGATAAAGGTGTACAGTGCATTTTG------------TATACCTCTTGTTTGAATAAAGGAAAATAATCCTTT
                                                  Xl3.1-CHK-1012692513                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTTGGTTTTTTTTTTGTTTCTTGTTCTTTATATTTAGTTTTTTGTTTTGGGAGGGAAATTTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAACAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTxxxxxGACACTGAGTTCAGATTTT------------TTTTTAAAAAAAAAAAAGAGAGAAAAAAAACAAAAAAAAAAGCTTTATTTTTTTTTTTTTTAATATTATTTTGGAGGGAATGGGGAGAAGGGTTGTTGGGTGCAGTTGGTCGGCATCTCGGTGTTCCTCACAGACTTCCTACTGAGTAATTGATTTTGTTACTTGAGATTAGAGTGGCTGGAAATGCCATCTGCTCCGAGGTTACCAATGGAAAGACTTTGTCCCCAAGCCTGTGACATCATATCTGCAACATTTCTGGGGTAGCAGAGCCATTTCTAGATGTAATTTCCTCAGGATAAAGGTGTACAGTGCATTTTGCACAAAAAAATGTATACCTCTTGTTTGAATAAAGGAAAATAA
  5   1   2      skin Tad2                            IMAGE:6935501.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGTGGAACTCTTCAGGTTTAATTTGGGttttttttttttggttttttttttgtttcttgttctttatatttagttttttgttttgggagggaaattttctgagcctttgttttACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATACATTTACAGATTGTGAATTTTTAAACAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTAACTCCTTGCTTCTaaaaaaaaaaaaaagagagaaaaaaaacaaaaaaaaaagctttatttttttttttttttAATATTATTTTGGAGGGAATGGGGAGAAGGGTTGTTGGGTGCAATTGGTCGGCATCTCGGTGTTCCTCACAGACTTCCTACTGAGTAATTGATTTTGTTACTTGAGATTAGAGTGGCCTGGAAATGCCATCCGCTCCGAGGTTACCCAATGGAAAGACTTTTGGTCCCCAAAACCTGTTGAACATCCTATCTGGCAACATTTTTTTGGGGGTTACCACAAACCCTTTTTCTAAAAATGAAATTTTccccccccGGAAAAAAAGGGGGTTAACAAATGGGCAATTTTTTTCCCACCCCAAAAAAGTGGGTTTTACCCTCCCTTGGTTTTTCGAATTAAAAGGGAAAAAATAAATTCCCGCTTTCGTGATTTCTCAGTCACCGGCAACTAAACCCNAAGGCGTAAACCACTTTTTTATTGGGGGCTCTCTCTTCCGGGccccccccTTGAAAAAACATCT
  3   1   2       bld Neu7      in                         XL007c17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GNTTAAATTGGGGTTTTTTTTTTTGGnTTTTTTTTTTGTTTCTTGTTCTTTATATTTAGTTTTTTGTTTTGGGAGGGAAATTTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAACAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAAGGCAGGGTTTCCGGGACACGGAGTTCAGATTTTAAC
  3   1   2      seed Ga18 5g3  in                      xlk114c21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGNTTTTTTTTTTTnnTTTTTTTTTTTTGTNTCNNGTNCTTNATATTTAGTTNTTTGTTTTGGGAGGGAAATTTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAACAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACNCTGGAGTTCAGATTTTAACTCCTTGCTTCTAAAAAAAAAAAAGAGAGAAAAAAAACAAAAAAAAAAGCTTTATTTTTTTTTTTTTTAATATTATTTTGGAGGGAATGGGGAGAAGGGTTGTTGGGTGCAGTTGGTCGGCATCTCGGTGTTCCTCACAGACTTCCTACTGAGTAATTGATTTTGTTACTTGAGATTAGAGTGGCTGGAAATGCCATCTGCTCCGAGGTTACCAATGGAAAGACTTTGTCCCCAAGCCTGTGACATCATATCTGCAACATTTCTGGGGNNGAGAGCCATTTCTAGATGTAATTTCCTCAGGATAAAGGTGTACAGNNCATTTTNNA
  3   1   2      skin Ga18                             rxlk140i17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTGTTTNGGGAGGGAAATTTTCTGAGCCTTTGTTTTACCATATAGTAAACTTTTATGTTTAAAGATGAAAATATATACATTTACAGATTGTGAATTTTTAAACAAAAAATGAATTTTCTACTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGNTTTCCGGTGAC
  3   1   2       add Ov1  5g3  in                    IMAGE:5073336.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAAAAATGAATTTTTTCCTATGTATTCAGGTTTATTTTTTAATTTAATGGCAGGGTTTCCGGTGACACTGGAGTTCAGATTTTAACTCCTTGGTTGTAAAAAAAAAAAAAAAAGCTGTATTTTTTTTAATATTATCTTGGAGGGAATGGGGAGATGGGTTGTTGGGTGCAGTTGGTCAGCATCTCTGTGTTCACAGACTTCCTACTGAGTAATTCTTGCTTTTGTTACTTGAGATTGAGTGGCTGGAAATGCCAACTGCTCCGAGGTTACCAATGGAAAGACTTTGTCCCCAAGCCTGTGACATCATATCCGCAAAATTTTTGGGGTAGCAGAGCCATTTCTAGATGTAATTTCCTCAGGATAAAGGTGTACAGTGCATTTTGCACAAAAAAGTGTATACCTTTTGTTTGAATAAAGGCAAATAATCCTTTTGGATGAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Ga12      in                         XL180o09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CNGGGNCCCCGGGGNTNNAANTTTTANCCCCNNNTTTTTAAAAAAAAAAAAGGGGGAAAAAAAnCnAAAAAAAAGCTTTnTTTTTTTTTTTTTTTAATATTATTTTGGAGGGAATGGGGAGAAGGGTTGTTGGGTGCAGTTGGTCGGCATCTCGGTGTTCCTCACAGACTTCCTACTGAGTAATTGATTTTGTTACTTGAGATTAGAGTGGCTGGAAATGCCATCTGCTCCGAGGTTACCAATGGAAAGACTTTGTCCCCAAGCCTGTGACATCATATCTGCAACATTACTGGGGTAGCAGAGCCATTTCTAGATGTAATTTCCTCAGGATAAAGGTGTACAGTGCATTTTGCACACAAAAAATGT
  5   1   2       add Ga18      in                      xlk161h06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGANACTGGAGTTCAGATTTTAACTCCTTGCTTCTaaaaaaaaaaaaagagagaaaaaaaacaaaaaaaaaagctttattttttttttttttttAATATTATTTTGGAGGGAATGGGGAGAAGGGTTGTTGGGTGCAGTTGGTCGGCATCTCGGTGTTCCTCACAGACTTCCTACTGAGTAATTGATTTTGTTACTTGAGATTAGAGTGGCTGGAAATGCCATCTGCTCCGAGGTTACCAATGGAAAGACTTTGTCCCCAAGCCTGTGACATCATATCTGCAACATTTCTGGGGTAGCANANNNTTTCTAGATGTAATTTCCTCAGGATAAAGGTGTACAGTGCATTTTGCACACAAAAAATGTATACCTCTTGTTTGAATAAAGGAAAATAATCCTTTaaaaaaaaaa
  3   1   2       add DMZ  5g3  in                         xl291l04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCNGNTTTTTAAAAAAAAAAAGGGGGnAAAAAAACCAAAAAAAAAGCTTTTTTTTTTTTTTTTTNTAATATTATTTTGGAGGGAATGGGGAGAAGGGTTGTTGGGTGCAGTTGGTCGGCATCTCGGTGTTCCTCACAGACTTCCTACTGAGTAATNGATTTTGTTACTTGAGATTAGAGTGGCTGGAAATGCCATC
  3   1   2       add DMZ  5g3  in                         xl331i01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTTTTAAAAAAAAAAnGGGGGnAAAAAACCnAAAAAAAAAGnnTTTTTTTTTTTTTTTTTTAATATTATTTTGGAGGGAATGGGGAGAAGGGTTGTTGGGTGCAGTTGGTCGGCATCTCGGTGTTCCTCACAGACTTCCTACTGAGTAATNGATTTNGTTACTTGAGATTAGAGNGGCTGGAAATGCCATCTGCTCCGNGGTTACCAANGGAAAGACNTTGTCC
  3   1   2       bld Ga15                               XL456g24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTAAAAAAAAAAAGnGGGAAAAAAAAACnAAAAAAAAGCTTTATTTTTTTTTTTTTTTAATATTATTTTGGAGGGAATGGGGAGAAGGGTTGTTGGGTGCAGTTGGTCGGCATCTCGGTGTTCCTCACAGACTTCCTACTGAGTAATTGATTTTGTTACTTGAGATTAGAGTGGCTGGAAATGCCATCTGCTCCGAGGTTACCAATGGAAAGACTTTGTCCCCAAGCCTGTGACATCATATCTGCAACATTTCTGGGGTAGCAGAGCCATTTCTAGATGTAATTTCCTCAGGATAAAGGTGTACCAGTGCATTTTGCACACAAAAAATGTATACC
  3   1   2       add DMZ  5g3  in                         xl258e18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAAAAAAAAGGGGGnAAAAAAACCAAAAAAAAAGCnTTnTTTTTTTTTTTTTNTAATATTATTTTGGAGGGAATGGGGAGAAGGGTTGTTGGGTGCAGTTGGTCGGCATCTCGGTGTTCCTCACAGACTTCCTACTGAGTAATTGATTTTGTTACTTGAGATNAGAGTGGCTGGAAATGCCATCTGCTCCGAGGTTACCAATGGAAAGACTTTGTCCCCAAGCCTGNGACATCANATCTNCAACANTTCTGGGGTAGCAG
  3   1   0       add Ga15      out                      XL466m15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAAAAAAAAAAAAAAAAAAGCTTTATTTTTTTTAATATTATTTTGGAGGGAATGGGGAGATGGGTTGTTGGGTGCAGTTGGTCAGCATCTCTGTGTTCACAGACTTCCTNCNGAGTAATTCTTGCTTTNG
  3   1   2       bld Ga18      in                      xlk161h06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTTTTTTTTTTTTTTTTTNNAANNANTNNNANNGAATGGGGAGAAGGGTTGTTGGGTGCAGTTGGTCGGCATCTCGGTGTTCCTCACAGACTTCCTACTGAGTAATTGATTTTGTTACTTGAGATTAGAGTGGCTGGAAATGCCATCTGCTCCGAGGTTACCAATGGAAAGACTTTGTCCCCAAGCCTGTGACATCATATCTGCAACATTTCTGGGGTAGAGAGCCATTTCTAGATGTAATTTCCTCAGGATAAAGGTGTACAGNNCATNNNNNNNCAAAAAAT
  3   1   2       add Ga15      out                      XL484o08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTNGGAGGTGCAGTTGGTCNGCATCTCGGTGTTCCTCACAGACTTCCTANTGAGTAATTGATTTTGTTACTTGAGATTAGAGTGGCTGGAAATGCCATCTGCTCCGAGGTTACCAATGGAAAGACTTTGTCCCCAAGCCNGTGACATCATATCTGCAACATTTCTGGGGTAGCAGAGCCATTTCTAGACTGTAATTTCCTCANGATAAAGGTGTAGCAGTGCATTTTGCACACAAAAAATGTATACCTCTGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)