Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:5129848.3                       6 PI      93       4627     5019                hypothetical protein LOC495206 [Xenopus laevis]
     2   0.0    0Xl3.1-IMAGE:3398434-IMAGp.5                 4 PI      89        956     2225                complement C3
     3   0.0    0Xl3.1-IMAGE:3397906.3                       3 PI      76       4514     4960                hypothetical protein LOC398666 [Xenopus laevis]

 This cluster: approximate FL confidence score = 79%

 1012837236 Xl3.1-xl324m01.3.5 - 240 ESTs
                                                                       ......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870......4880......4890......4900......4910......4920......4930......4940......4950......4960......4970......4980......4990......5000......5010......5020......5030......5040......5050......5060......5070......5080......5090......5100......5110......5120......5130......5140......5150......5160......5170......5180......5190......5200......5210......5220......5230......5240......5250......5260......5270......5280......5290......5300......5310......5320......5330......5340......5350......5360......5370......5380......5390......5400......5410......5420......5430......5440......5450......5460......5470
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xl324m01.3.5                 GGACTTCTCTCCCTGTCTCTCCTGCTACTGGTCTCTGGGTCCTACGCCCAAACGCCATGTACGCTCATAACACCCAACTTGCTGCGTGTGGAGAGTGAGGAGACCATTGTGATAGATGCTCAAGGGCAAAATGCCCCATTTGAAGCTGAGGTCATCATCCAGGACTTCCCTCAGAAGAAACTCAATCTAGTCAGCACCAAAGTCCCCCTGAATGTTAACAATGGCTTCCTTGGGACGGCCACGTTAAAGATTCCCTCTGGAGATTTATCCAAAGATACAAAAAGCAAGCAGTATGTGTATGTCAGCGTGAAATCAAATGTGTGTGCCCTGGAGAAAGTCGTGCTGCTGTCGTACCACAGTGGCTACATCTTCCTTCAGACGGACAAGACTATCTACACACCAGGATCTACAGTTTTGTACCGAATTTACTCCATGAACTACAAGATGCAGCCTATTTCCAAAACGCTCATCATTGAATTTTTGACCCCAGATGGTATTATCGTGAAGAGAGATACCATCCTCCAAGACAGCAAATCTGGTATCATCTCACAGTCCCACAAACTGCCAGAACTTTTGAGCCTTGGAGTGTGGACTATCTCAGCAAAGTATGAAGACACCCCTCAACAGAATTACACCATCAACTTTGAGGTGAAAGAATATGTGCTACCCTCAATAGAAATTATTCTGAAGCCAGACACTAACTACTTCTATGCTGATGCAGAATCTTTCGGAATTCATTTTCTGGGAAAGCGCCAGCAACACCTAAACCTAACCTTTCCTAAGGACTTGAAAGGCCAGAAAATCTCTTTCCCGGGAAGGGGGGCTTTACCAGAGTCGCTGACAAGAGTCAGGATTGATGATGGAGAAGGTCGTGCTGAACTGAAAAGGAAAGACCTAGTGAAGTACTTTGAGAAACCAGAGGACATGCTACAATTCGGCTTGTATGTGACTGTCTCTGTTGTCACGGAAACAGGTAGCGACATGGTGGAGGCTGAGATAGAGCATATCAGTATTGTGACGACGCCATACAAAATCCTCTTTACCAAAACCTCCAAATATTTCAAGCCTGGAATGCCTTTTGATATGATGGTCTATGTAACCAATCCCGATGGTTCTCCCGCTCGTCGTATCCCTGTGGTGGTTGAGCCAGGAAATGTTGAAGGGACCACTCAAGGAGATGGAACCACAAGGCTGACAATGAACACACCCGCAAATATAAACGTTTTGCCCATAACTGTGAAAACAAGGGACCCAACTTTGCCTCCCTTGCGGCAAGCAACTGCCACCATGACTGCTACAGCTTACCGACCCTCAAAAGCACAAGGGAACTACCTGCATATCAGCATTGCTGGGTCAGATATAAAACCTGGAGAAAACATCCCGGTGAACTTTAATATCCGAAACACTGATGCGGGCGTCCAGAACCAAATACAACATTTTACATATCTGATCATGAGCAGGGGAAGGATTCTAAAGGTGGGAAGGCAGCAACGGCAGCCTGGTCAGCCTTTTGTCACCATGTCTCTACCTGTTACCGATACCTTGATACCATCTTTCCGTATTGTGGCATATTACATTGTCAGTGTTGGTGGATCACGTGATGTTGTATCTGACTCTCTTTGGGTGGATGTGGTTGATGACTGCATGGGCACATTGACGGTGACTGGAGATAAGGACAGGGACAATGCCATACAAACTCCTGGTTCTCCAATGAAGCTGAAGCTGAGAGCAGACCACAAGGCCTATGTGGGATTGGTGGCTGTGGATAAGGGTGTCTATGTGCTGAACAGTAAATTTAAGATCACACAAAAGAAGGTATGGGATTCAGTGGAGAAGTCAGACATTGGCTGCACTCCTGGAAGCGGTGCAAACAGCGAGGGGGTCTTTTCTGACGCTGGGCTTGCTCTACAGACCTCCTTTGGTATCAATACAGCTCAAAGATCGGATGCTCAATGTCCAGCCCCGGCACAACGCAGAAAACGCTCATCTGTTGCGCTCATTGAGATTAAAGCTGGCAAAGCTTCAGAATACAAGGACAAGGCAAAGAAGTGCTGCCTGGATGGAATGCAGGAGAACCTGATGGGCCACACCTGTGACCGACGTTCCCGCTACATCTTGGATGGGAAAGAATGTGTGGATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAAGAGGGAAGCTGAGAAGCTTAGTAAAGATGATGACACCCTTGGAAGAAGTGACGAAGATGATGAATACATGCTGGATTCTGACATTGTGTCCAGGACGGAGTTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTACAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTTTGGATTGGAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGATATAGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTTGTTCAGTGTTTTATATACAGTTCCAATAAAGCATTTATTTGCTTAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012722612                       CTCTCCCTGTCTCTCCTGCTACTGGTCTCTGGGTCCTACGCCCAAACGCCATGTACGCTCATAACACCCAACTTGCTGCGTGTGGAGAGTGAGGAGACCATTGTGATAGATGCTCAAGGGCAAAATGCCCCATTTGAAGCTGAGGTCATCATCCAGGACTTCCCTCAGAAGAAACTCAATCTAGTCAGCACCAAAGTCCCCCTGAATGTTAACAATGGCTTCCTTGGGACGGCCACGTTAAAGATTCCCTCTGGAGATTTATCCAAAGATACAAAAAGCAAGCAGTATGTGTATGTCAGCGTGAAATCAAATGTGTGTGCCCTGGAGAAAGTCGTGCTGCTGTCGTACCACAGTGGCTACATCTTCCTTCAGACGGACAAGACTATCTACACACCAGGATCTACAGTTTTGTACCGAATTTACTCCATGAACTACAAGATGCAGCCTATTTCCAAAACGCTCATCATTGAATTTTTGACCCCAGATGGTATTATCGTGAAGAGAGATACCATCCTCCAAGACAGCAAATCTGGTATCATCTCACAGTCCCACAAACTGCCAGAACTTTTGAGCCTTGGAGTGTGGACTATCTCAGCAAAGTATGAAGACACCCCTCAACAGAATTACACCATCAACTTTGAGGTGAAAGAATATGTGCTACCCTCAATAGAAATTATTCTGAAGCCAGACACTAACTACTTCTATGCTGATGCAGAATCTTTCGGAxTxxATTTTCTGGGAAAGCGCCAGCAACACCTAAACCTAACCTTTCCTAAGGACTTGAAAGGCCAGAAAATCTCTTTCCCGGGAAGGGGGGxxxTxCCAGAGTCGCTGACAAGAGTCAGGATTGATGATGGAGAAGGTCGTGCTGAACTGAAAAGGAAAGACCTAGTGAAGTACTTTGAGAAACCAGAGGACATGCTACAATTCGGCTTGTATGTGACTGTCTCTGTTGTCACGGAAACAGGTAGCGACATGGTGGAGGCTGAGATAGAGCATATCAGTATTGTGACGACGCCATACAAAATCCTCTTTACCAAAACCTCCAAATATTTCAAGCCTGGAATGCCTTTTGATATGATGGTCTATGTAACCAATCCCGATGGTTCTCCCGCTCGTCGTATCCCTGTGGTGGTTGAGCCAGGAAATGTTGAAGGGACCACTCAAGGAGATGGAACCACAAGGCTGACAATGAACACACCCGCAAATATAAACGTTTTGCCCATAACTGTGAAAACAAGGGACCCAACTTTGCCTCCCTTGCGGCAAGCAACTGCCACCATGACTGCTACAGCTTACCGACCCTCAAAAGCACAAGGGAACTACCTGCATATCAGCATTGCTGGGTCAGATATAAAACCTGGAGAAAACATCCCGGTGAACTTTAATATCCGAAACACTGATGCGGGCGTCCAGAACCAAATACAACATTTTACATATCTGATCATGAGCAGGGGAAGGATTCTAAAGGTGGGAAGGCAGCAACGGCAGCCTGGTCAGCCTTTTGTCACCATGTCTCTACCTGTTACCGATACCTTGATACCATCTTTCCGTATTGTGGCATATTACATTGTCAGTGTTGGTGGATCACGTGATGTTGTATCTGACTCTCTTTGGGTGGATGTGGTTGATGACTGCATGGGCACATTGACGGTGACTGGAGATAAGGACAGGGACAATGCCATACAAACTCCTGGTTCTCCAATGAAGCTGAAGCTGAGAGCAGACCACAAGGCCTATGTGGGATTGGTGGCTGTGGATAAGGGTGTCTATGTGCTGAACAGTAAATTTAAGATCACACAAAAGAAGGTATGGGATTCAGTGGAGAAGTCAGACATTGGCTGCACTCCTGGAAGCGGTGCAAACAGCGAGGGGGTCTTTTCTGACGCTGGGCTTGCTCTACAGACCTCCTTTGGTATCAATACAGCTCAAAGATCGGATGCTCAATGTCCAGCCCCGGCACAACGCAGAAAACGCTCATCTGTTGCGCTCATTGAGATTAAAGCTGGCAAAGCTTCAGAATACAAGGACAAGGCAAAGAAGTGCTGCCTGGATGGAATGCAGGAGAACCTGATGGGCCACACCTGTGACCGACGTTCCCGCTACATCTTGGATGGGAAAGAATGTGTGGATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAAGAGGGAAGCTGAGAAGCTTAGTAAAGATGATGACACCCTTGGAAGAAGTGACGAAGATGATGAATACATGCTGGATTCTGACATTGTGTCCAGGACGGAGTTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTACAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTTTGGATTGGAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGATATAGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTTGTTCAGTGTTTTATATACAGTTCCAATAAAGCATTTATTTGCTTAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                      7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     5     7     5     7     4     7     5     7     4     7     5     7     4     7     5     7     4     6     4     6     4     6     4     6     3     5     1     4     1     4     1     4     1     4     1     4     1     4     1     4     1     4     1     4     1     4     1     4     1     3     1     3     1     3     1     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     3     3     3     3     3     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     5     5     5     5     6     7     6     7     6     7     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     8     8     8     8     8     8     8     8     7     7     7     7     6     7     6     7     6     7     6     7     6     8     7     8     6     9     8     9     6     8     6     7     6     7     8     9     8     9     8     9     8     9     8     9     8     9     8     9    10    11    10    11    10    11    11    12    11    12    12    13    12    13    11    12    11    12    10    11    12    13    12    13    12    12    12    13    13    13    13    13    12    13    12    13    13    14    13    14    13    14    13    14    12    13    12    13    12    13    12    12    11    12    13    13    13    13    13    13    13    14    16    17    17    17    17    17    17    17    17    17    16    16    17    18    17    18    17    19    17    19    17    20    19    20    19    20    18    19    18    19    18    20    18    20    19    20    19    20    19    20    19    20    15    20    19    21    19    21    19    23    19    22    23    24    17    21    19    21    15    19    17    20    18    19    17    18    18    19    18    19    17    21    20    24    18    22    18    21    17    20    17    20    17    20    17    19    17    20    17    19    15    19    16    19    18    20    18    20    16    22    20    22    20    21    19    21    19    21    20    21    19    21    19    21    19    22    18    21    19    21    18    21    18    20    18    20    18    20    18    21    20    22    19    20    19    21    20    22    20    22    21    22    20    22    20    22    18    21    18    22    20    23    21    24    21    24    22    24    21    24    22    24    19    24    22    25    21    25    20    25    22    27    20    27    20    25    21    25    19    25    16    23    19    24    22    26    19    24    21    25    20    25    22    25    20    24    21    23    22    24    22    24    23    24    21    24    23    25    23    26    26    28    26    28    25    28    23    26    20    23    23    24    22    24    22    24    24    26    22    27    29    30    29    30    29    30    29    30    29    30    30    32    29    31    27    31    29    31    30    32    29    30    29    30    29    30    29    30    29    30    29    30    28    29    28    29    29    30    28    30    27    31    28    31    27    31    27    32    28    34    31    35    31    34    32    36    33    36    33    35    34    36    34    37    33    38    33    37    36    39    35    38    33    39    32    39    31    41    34    45    33    46    33    47    35    47    32    46    34    47    35    47    33    47    34    46    33    46    32    46    33    48    32    50    33    54    34    55    34    59    42    64    43    71    49    73    52    75    54    76    54    77    62    83    60    83    64    82    64    88    62    90    62    90    64    90    68    93    69    94    69    96    69    97    69    98    73   105    76   109    74   109    77   110    78   111    83   110    90   113    91   110    93   111    91   109    88   108    91   107    87   106    89   105    93   106    95   105    91   105    96   105    95   105    91   103    92   104    88   105    94   106    85   105    90   104    93   102    93    99    93   101    92   102    92   100    95   101    83   100    91    99    95   100    93    99    96   103    94   100    95   101    92   101    88   100    82    98    56    93    35    63    28    58    23    48    20    36    13    28     8    10
  5   1   2      ests                            Xl3.1-IMAGE:5543186.5     ATCATGGGGTGCGGACTTCTCTCCCTGTCTCTCCTGCTACTGGTCTCTGGGTCCTACGCCCAAACGCCATGTACGCTCATAACACCCAACTTGCTGCGTGTGGAGAGTGAGGAGACCATTGTGATAGATGCTCAAGGGCAAAATGCCCCATTTGAAGCTGAGGTCATCATCCAGGACTTCCCTCAGAAGAAACTCAATCTAGTCAGCACCAAAGTCCCCCTGAATGTTAACAATGGCTTCCTTGGGACGGCCACGTTAAAGATTCCCTCTGGAGATTTATCCAAAGATACAAAAAGCAAGCAGTATGTGTATGTCAGCGTGAAATCAAATGTGTGTGCCCTGGAGAAAGTCGTGCTGCTGTCGTACCACAGTGGCTACATCTTCCTTCAGACGGACAAGACTATCTACACACCAGGATCTACAGTTTTGTACCGAATTTACTCCATGAACTACAAGATGCAGCCTATTTCCAAAACGCTCATCATTGAATTTTTGACCCCAGATGGTATTATCGTGAAGAGAGATACCATCCTCCAAGACAGCAAATCTGGTATCATCTCACAGTCCCACAAACTGCCAGAACTTTTGAGCCTTGGAGTGTGGACTATCTCAGCAAAGTATGAAGACACCCCTCAACAGAATTACACCATCAACTTTGAGGTGAAAGAATATGTGCTACCCTCAATAGAAATTATTCTGAAGCCAGACACTAACTACTTCTATGCTGATGCA
  5   1   2      ests                                 Xl3.1-xl324m01.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACTCAAGGAGATGGAACCACAAGGCTGACAATGAACACACCCGCAAATATAAACGTTTTGCCCATAACTGTGAAAACAAGGGACCCAACTTTGCCTCCCTTGCGGCAAGCAACTGCCACCATGACTGCTACAGCTTACCGACCCTCAAAAGCACAAGGGAACTACCTGCATATCAGCATTGCTGGGTCAGATATAAAACCTGGAGAAAACATCCCGGTGAACTTTAATATCCGAAACACTGATGCGGGCGTCCAGAACCAAATACAACATTTTACATATCTGATCATGAGCAGGGGAAGGATTCTAAAGGTGGGAAGGCAGCAACGGCAGCCTGGTCAGCCTTTTGTCACCATGTCTCTACCTGTTACCGATACCTTGATACCATCTTTCCGTATTGTGGCATATTACATTGTCAGTGTTGGTGGATCACGTGATGTTGTATCTGACTCTCTTTGGGTGGATGTGGTTGATGACTGCATGGGCACATTGACGGTGACTGGAGATAAGGACAGGGACAATGCCATACAAACTCCTGGTTCTCCAATGAAGCTGAAGCTGAGAGCAGACCACAAGGCCTATGTGGGATTGGTGGCTGTGGATAAGGGTGTCTATGTGCTGAACAGTAAATTTAAGATCACACAAAAGAAGGTATGGGATTCAGTGGAGAAGTCAGACATTGGCTGCACTCCTGGAAGCGGTGCAAACAGCGAGGGGGTCTTTTCTGACGCTGGGCTTGCTCTACAGACCTCCTTTGGTATCAATACAGCTCAAAGATCGGATGCTCAATGTCCAGCCCCGGCACAACGCAGAAAACGCTCATCTGTTGCGCTCATTGAGATTAAAGCTGGCAAAGCTTCAGAATACAAGGACAAGGCAAAGAAGTGCTGCCTGGATGGAATGCAGGAGAACCTGATGGGCCACACCTGTGACCGACGTTCCCGCTACATCTTGGATGGGAAAGAATGTGTGGATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAAGAGGGAAGCTGAGAAGCTTAGTAAAGATGATGACACCCTTGGAAGAAGTGACGAAGATGATGAATACATGCTGGATTCTGACATTGTGTCCAGGACGGAGTTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTACAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTTTGGATTGGAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGATATAGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTTGTTCAGTGTTTTATATACAGTTCCAATAAAGCATTTATTTGCTTAAAAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCATGATGACT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --G--------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --C------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------A
                                               BLH ATG      -9     220                 
  5   1   2      ests                            Xl3.1-IMAGE:5543186.5     ATCATGGGGTGCGGACTTCTCTCCCTGTCTCTCCTGCTACTGGTCTCTGGGTCCTACGCCCAAACGCCATGTACGCTCATAACACCCAACTTGCTGCGTGTGGAGAGTGAGGAGACCATTGTGATAGATGCTCAAGGGCAAAATGCCCCATTTGAAGCTGAGGTCATCATCCAGGACTTCCCTCAGAAGAAACTCAATCTAGTCAGCACCAAAGTCCCCCTGAATGTTAACAATGGCTTCCTTGGGACGGCCACGTTAAAGATTCCCTCTGGAGATTTATCCAAAGATACAAAAAGCAAGCAGTATGTGTATGTCAGCGTGAAATCAAATGTGTGTGCCCTGGAGAAAGTCGTGCTGCTGTCGTACCACAGTGGCTACATCTTCCTTCAGACGGACAAGACTATCTACACACCAGGATCTACAGTTTTGTACCGAATTTACTCCATGAACTACAAGATGCAGCCTATTTCCAAAACGCTCATCATTGAATTTTTGACCCCAGATGGTATTATCGTGAAGAGAGATACCATCCTCCAAGACAGCAAATCTGGTATCATCTCACAGTCCCACAAACTGCCAGAACTTTTGAGCCTTGGAGTGTGGACTATCTCAGCAAAGTATGAAGACACCCCTCAACAGAATTACACCATCAACTTTGAGGTGAAAGAATATGTGCTACCCTCAATAGAAATTATTCTGAAGCCAGACACTAACTACTTCTATGCTGATGCA
                                                  Xl3.1-CHK-1012699616           GGGTGCGGACTTCTCTCCCTGTCTCTCCTGCTACTGGTCTCTGGGTCCTACGCCCAAACGCCATGTACGCTCATAACACCCAACTTGCTGCGTGTGGAGAGTGAGGAGACCATTGTGATAGATGCTCAAGGGCAAAATGCCCCATTTGAAGCTGAGGTCATCATCCAGGACTTCCCTCAGAAGAAACTCAATCTAGTCAGCACCAAAGTCCCCCTGAATGTTAACAATGGCTTCCTTGGGACGGCCACGTTAAAGATTCCCTCTGGAGATTTATCCAAAGATACAAAAAGCAAGCAGTATGTGTATGTCAGCGTGAAATCAAATGTGTGTGCCCTGGAGAAAGTCGTGCTGCTGTCGTACCACAGTGGCTACATCTTCCTTCAGACGGACAAGACTATCTACACACCAGGATCTACAGTTTTGTACCGAATTTACTCCATGAACTACAAGATGCAGCCTATTTCCAAAACGCTCATCATTGAATTTTTGACCCCAGATGGTATTATCGTGAAGAGAGATACCATCCTCCAAGACAGCAAATCTGGTATCATCTCACAGTCCCACAAACTGCCAGAACTTTTGAGCCTTGGAGTGTGGACTATCTCAGCAAAGTATGAAGACACCCCTCAACAGAATTACACCATCAACTTTGAGGTGAAAGAATATGTGCTACCCTCAATAGAAATTATTCTGAAGCCAGACACTAACTACTTCTATGCTGATGCAGAATCT
  5   1   2       bld DMZ  5g3  in                         xl313g21.5p CTGCATCATGGGGTGCGGACTTCTCTCCCTGTCTCTCCTGCTACTGGTCTCTGGGTCCTACGCCCAAACGCCATGTACGCTCATAACACCCAACTTGCTGCGTGTGGAGAGTGAGGAGACCATTGTGATAGATGCTCAAGGGCAAAATGCCCCATTTGAAGCTGAGGTCATCATCCAGGACTTCCCTCAGAAGAAACTCAATCTAGTCAGCACCAAAGTCCCCCTGAATGTTAACAATGGCTTCCTTGGGACGGCCACGTTAAAGATTCCCTCTGGAGATTTATCCAAAGATACAAAAAGCAAGCAGTATGTGTATGTCAGCGTGAAATCAAATGTGTGTGCCCTGGAGAAAGTCGTGCTGCTGTCATACCACAGTGGCTACATCTTCCTTCAGACGGACAAGACTATCTACACACCAGGATCTACAGTTTTGTACCGAATTTACTCCATGAACTACAAGATGCAGCCTATTTCCAAAACGCTCATCATTGAATTTTTGACCCCAGATGGTATTATCGTGAAGAGAGATACCATCCTCCAAGACAGCAAATCTGGTATCATCTCACAGTCCCACAAACTGCCAGAACTTTTGAGCCTTGGAGTGTGGACTATCTCAGCAAAGTATGAAGACACCCCTCAACAGAATTACACCATCAACTTTGAGGT
  5   1   2       bld Emb4 5g                         IMAGE:4683741.5p     ATCATGGGGTGCGGACTTCTCTCCCTGTCTCTCCTGCTACTGGTCTCTGGGTCCTACGCCCAAACGCCATGTACTCTCATAACACCCAACTTGCTGCGTGTGGAGAGTGAGGAGACCATTGTGATAGATGCTCAAGGGCAAAATGCCCCATTTGAAGCTGAGGTCATCATCCAGGACTTCCCTCAGAAGAAACTCAATCTAGTCAGCACCAAAGTCCCCCTGAATGTTAACAATGGCTTCCTTGGGACGGCCACGTTAAAGATTCCCTCTGGAGATTTATCCAAAGATACAAAAAGCAAGCAGTATGTGTATGTCAGCGTGAAATCAAATGTGTGTGCCCTGGAGAAAGTCGTGCTGCTGTCGTACCACAGTGGCTACATCTTCCTTCAGACGGACAAGACTATCTACACACCAGGATCTACAGTTTTGTACCGAATTTACTCCATGAACTACAAGATGCAGCCTATTTCCAAAACGCTCATCATTGAATTTTTGACCCCCGATGGTATTATCGTGAAGAGAGATACCATCCTCCGAGACAGCAAAATCTGGTATTATCCTCACCGTCCCCCCCAAACTGGCCAGAAACTTTTTGGAGCCCTCTGGAAGTGGGGGAACCTATCTCCACCCAAAGTTATGGAAGGACACCCCCCCTCCAACAGGAAAATTACCCCCCCAATTCCAACCCTTTTCGACGGTTGGAAACCAAAATTATGCCGCCCTAACCCCTCTCCAATACGAAAAATTCATTTTCTGGGAAAGCGCCAGCAACACCTAAACCTAACCTTTCCTAAGGACTTGAAAGGCCAGAAAATCTCTTTCCCGGGAAGGGGGGCTTTATTTTCAAGGGCCCCCATGATATCCTGTGAACAGGGGGAAAACCCCCGCCGGCGGATGGGAATAAACCCCGACTCTCGCGGGCCTCCTTTTGTGGACGCCTTCGGGGAAAAGGCCCCAAGTGGATCAAAGAATAAACGGCAAATTCCCCAGACAGTTCTCGCCTGATCACCC
  5   1   2       bld Ga18 5g3  in                      xlk137d08ex.5p     ATCATGGGGTGNGGACTTCTCTCCCTGTCTCTCCTGCTACTGGTCTCTGGGTCCTACGCCCAAACGCCATGTACGCTCATAACACCCAACTTGCTGCGTGTGGAGAGTGAGGAGACCATTGTGATAGATGCTCAAGGGCAAAATGCCCCATTTGAAGCTGAGGTCATCATCCAGGACTTCCCTCAGAAGAAACTCAATCTAGTCAGCACCAAAGTCCCCCTGAATGTTAACAATGGCTTCCTTGGGACGGCCACGTTAAAGATTCCCTCTGGAGATTTATCCAAAGATACAAAAAGCAAGCAGTATGTGTATGTCAGCGTGAAATCAAATGTGTGTGCCCTGGAGAAAGTCGTGCTGCTGTCATACCACAGTGGCTACATCTTCCTTCAGACGGACAAGACTATCTACACACCAGGATCTACAGTTTTGTACCGAATTTACTCCATGAACTACAAGATGCAGCCTATTTCCAAAACGCTCATCATTGAATTTTTGACCCCAGATGGTATTATCGTGAAGAGAGATACCATCCTCCAAGACAGCAAATCTGGNATCATCTCACAGTCCCACAAACTGCCAGAACTTTTGAGCCTTGGNGTGTGGACTATCTCAGCNAAGNATGAAGACACCCCTCAACAGAATTACNNCATCAACTTTGAGGNGAAAGAATATGTNCTACCCTCA
  5   1   2       bld Emb4 5g                         IMAGE:5571257.5p      TCATGGGGTGCGGACTTCTCTCCCTGTCTCTCCTGCTACTGGTCTCTGGGTCCTACGCCCAAACGCCATGTACTCTCATAACACCCAACTTGCTGCGTGTGGAGAGTGAGGAGACCATTGTGATAGATGCTCAAGGGCAAAATGCCCCATTTGAAGCTGAGGTCATCATCCAGGACTTCCCTCAGAAGAAACTCAATCTAGTCAGCACCAAAGTCCCCCTGAATGTTAACAATGGCTTCCTTGGGACGGCCACGTTAAAGATTCCCTCTGGAGATTTATCCAAAGATACAAAAAGCAAGCAGTATGTGTATGTCAGCGTGAAATCAAATGTGTGTGCCCTGGAGAAAGTCGTGCTGCTGTCGTACCACAGTGGCTACATCTTCCTTCAGACGGACAAGACTATCTACACACCAGGATCTACAGTTTTGTACCGAATTTACTCCATGAACTACAAGATGCAGCCTATTTCCAAAACGCTCATCATTGAATTTTTGACCCCAGATGGTATTATCGTGAAGAGAGATACCATCCTCCAAGACAGCAAATCTGGTATCATCTCACAGTCCCACAAACTGCCAGAAACTTTTGAGCCTTGGAGTGTGGACTATCTCAGCAAAGTATGAAGACACCCCTCAACAGAATTACACCATCCACTTTGAGGTGAAAGAAATATGTGCTACCCTCAATAGAAATTAATTCTGAAGCCAGACACTAACTACTTCTAATGCTGATGCCGAATTCTTTCGGAGTGGAATATTCAAGGCCCAGTTATCTGTATGGGAAAACCCGTGGGATGGAATACCCGTTTTGTGCCTCTTTGGGCATTAAGGGAAGGGACCAATGTTAAAGGAAAGGGAATCCCCAAAGTTCTCTTGACAAAA
  5   1   2       bld Emb4 5g                         IMAGE:5543186.5p        ATGGGGTGCGGACTTCTCTCCCTGTCTCTCCTGCTACTGGTCTCTGGGTCCTACGCCCAAACGCCATGTACGCTCATAACACCCAACTTGCTGCGTGTGGAGAGTGAGGAGACCATTGTGATAGATGCTCAAGGGCAAAATGCCCCATTTGAAGCTGAGGTCATCATCCAGGACTTCCCTCAGAAGAAACTCAATCTAGTCAGCACCAAAGTCCCCCTGAATGTTAACAATGGCTTCCTTGGGACGGCCACGTTAAAGATTCCCTCTGGAGATTTATCCAAAGATACAAAAAGCAAGCAGTATGTGTATGTCAGCGTGAAATCAAATGTGTGTGCCCTGGAGAAAGTCGTGCTGCTGTCGTACCACAGTGGCTACATCTTCCTTCAGACTGACAAGACTATCTACACACCAGGATCTACAGTTTTGTACCGAATTTACTCCATGAACTACAAGATGCAGCCTATTTCCAAAACGCTCATCATTGAATTTTTGACCCCAGATGGTATTATCGTGAAGAGAGATACCATCCTCCAAGACAGCAAATCTGGTATCATCTCACAGTCCCACAAACTGCCAGAACTTTTGAGCCTTGGAGTGTGGACTATCTCAGCAAAGTATGAAGACACCCCTCAACAGAATTACACCATCAACTCTGAGGTGAAAGAATATGTGCTACCCTCAATAGAAATTATTCTGAAGCCCGACCCTAACTACTTCTATGCTGATGCAGAATCTTTCCGAAGTGGATATTCAGGCCCCGAATCTGGATGGGGAAACACGTGGGATGGATAACGCGCTTTGTGGCTCCTTGGCCATAAGGGAAAGGACAATGGTTAAACAAAAGAGAATCCCCAAAAGTCTGCTTGTACCCCAAGTCCATGGATTTGTAAGATATGGCAACAAAAGGCTCGGGGGCTTGGAATT
  5   1   2      seed Ga15      in                       XL476b14ex.5p          GGGGTGCGGACTTCTCTCCCTGTCTCTCCTGCTACTGGTCTCTGGGTCCTACGCCCAAACGCCATGTACGCTCATAACACCCAACTTGCTGCGTGTGGAGAGTGAGGAGACCATTGTGATAGATGCTCAAGGGCAAAATGCCCCATTTGAAGCTGAGGTCATCATCCAGGACTTCCCTCAGAAGAAACTCAATCTAGTCAGCACCAAAGTCCCCCTGAATGTTAACAATGGCTTCCTTGGGACGGCCACGTTAAAGATTCCCTCTGGAGATTTATCCAAAGATACAAAAAGCAAGCAGTATGTGTATGTCAGCGTGAAATCAAATGTGTGTGCCCTGGAGAAAGTCGTGCTGCTGTCGTACCACAGTGGCTACATCTTCCTTCAGACGGACAAGACTATCTACACACCAGGATCTACAGTTTTGTACCGAATTTACTCCATGAACTACAAGATGCAGCCTATTTCCAAAACGCTCATCATTGAATTTTTGACCCCAGATGGTATTATCGTGAAGAGAGATACCATCCTCCAAGACAGCAAATCTGGTATCATCTCACAGTCCCACAAACTGCCAGAACTTTTGAGCCTTGGAGTGTGGACTATCTCAGCAAAGTATGAAGACACCCCTCAACAGAATTACACCATCAACTTTGAGGTGAAAGAATATGTGCTACCCTCAATAGAAATTATTCTGAAGCCAGACACTAACTACTTCTATGCTGATGCAGAATCTTTCGGAGTGGATATTCA
  5   1   2       bld DMZ       in                         xl299p01.5p               GCGGACTTCTCTCCCTGTCTCTCCTGCTACTGGTCTCTGGGTCCTACGCCCAAACGCCATGTACGCTCATAACACCCAACTTGCTGCGTGTGGAGAGTGAGGAGACCATTGTGATAGATGCTCAAGGGCAAAATGCCCCATTTGAAGCTGAGGTCATCATCCAGGACTTCCCTCAGAAGAAACTCAATCTAGTCAGCACCAAAGTCCCCCTGAATGTTAACAATGGCTTCCTTGGGACGGCCACTGTAAAGATTCCCTCTGGAGATTTATCCAAAGATACAAAAAGCAAGCAGTATGTGTATGTCAGCGTGAAATCAAATGTGTGTGCCCTGGAGAAAGTCGTGCTGCTGTCGTACCACAGTGGCTACATCTTCCTTCAGACGGACAAGACTATCTACACACCAGGATCTACAGTTTTGTACCGAATTTACTCCATGAACTACAAGATGCAGCCTATTTCCAAAACGCTCATCATTGAATTTTTGACCCCAGATGGTATTATCGTGAAGAGAGATACCATCCTCCAAGACAGCAAATCTGGTATCATCTCACAGTCCCACAAACTGCCAGAACTTTTGAGCCTTGGAGTGTGGACTATCTCAGCAAAGTATGAAGACACCCCTCAACAGAATTACACCATCAACTTTGAGGTGAAAGAATATGTGCTACCCTCAATAGAAATTATTCTGAAGCCAGACACTAACTACTTCTATGCTGATGCAGAA
  5   1   2      ests                                 Xl3.1-xl324m01.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACTCAAGGAGATGGAACCACAAGGCTGACAATGAACACACCCGCAAATATAAACGTTTTGCCCATAACTGTGAAAACAAGGGACCCAACTTTGCCTCCCTTGCGGCAAGCAACTGCCACCATGACTGCTACAGCTTACCGACCCTCAAAAGCACAAGGGAACTACCTGCATATCAGCATTGCTGGGTCAGATATAAAACCTGGAGAAAACATCCCGGTGAACTTTAATATCCGAAACACTGATGCGGGCGTCCAGAACCAAATACAACATTTTACATATCTGATCATGAGCAGGGGAAGGATTCTAAAGGTGGGAAGGCAGCAACGGCAGCCTGGTCAGCCTTTTGTCACCATGTCTCTACCTGTTACCGATACCTTGATACCATCTTTCCGTATTGTGGCATATTACATTGTCAGTGTTGGTGGATCACGTGATGTTGTATCTGACTCTCTTTGGGTGGATGTGGTTGATGACTGCATGGGCACATTGACGGTGACTGGAGATAAGGACAGGGACAATGCCATACAAACTCCTGGTTCTCCAATGAAGCTGAAGCTGAGAGCAGACCACAAGGCCTATGTGGGATTGGTGGCTGTGGATAAGGGTGTCTATGTGCTGAACAGTAAATTTAAGATCACACAAAAGAAGGTATGGGATTCAGTGGAGAAGTCAGACATTGGCTGCACTCCTGGAAGCGGTGCAAACAGCGAGGGGGTCTTTTCTGACGCTGGGCTTGCTCTACAGACCTCCTTTGGTATCAATACAGCTCAAAGATCGGATGCTCAATGTCCAGCCCCGGCACAACGCAGAAAACGCTCATCTGTTGCGCTCATTGAGATTAAAGCTGGCAAAGCTTCAGAATACAAGGACAAGGCAAAGAAGTGCTGCCTGGATGGAATGCAGGAGAACCTGATGGGCCACACCTGTGACCGACGTTCCCGCTACATCTTGGATGGGAAAGAATGTGTGGATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAAGAGGGAAGCTGAGAAGCTTAGTAAAGATGATGACACCCTTGGAAGAAGTGACGAAGATGATGAATACATGCTGGATTCTGACATTGTGTCCAGGACGGAGTTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTACAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTTTGGATTGGAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGATATAGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTTGTTCAGTGTTTTATATACAGTTCCAATAAAGCATTTATTTGCTTAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012685129                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGGAGATGGAACCACAAGGCTGACAATGAACACACCCGCAAATATAAACGTTTTGCCCATAACTGTGAAAACAAGGGACCCAACTTTGCCTCCCTTGCGGCAAGCAACTGCCACCATGACTGCTACAGCTTACCGACCCTCAAAAGCACAAGGGAACTACCTGCATATCAGCATTGCTGGGTCAGATATAAAACCTGGAGAAAACATCCCGGTGAACTTTAATATCCGAAACACTGATGCGGGCGTCCAGAACCAAATACAACATTTTACATATCTGATCATGAGCAGGGGAAGGATTCTAAAGGTGGGAAGGCAGCAACGGCAGCCTGGTCAGCCTTTTGTCACCATGTCTCTACCTGTTACCGATACCTTGATACCATCTTTCCGTATTGTGGCATATTACATTGTCAGTGTTGGTGGATCACGTGATGTTGTATCTGACTCTCTTTGGGTGGATGTGGTTGATGACTGCATGGGCACATTGACGGTGACTGGAGATAAGGACAGGGACAATGCCATACAAACTCCTGGTTCTCCAATGAAGCTGAAGCTGAGAGCAGACCACAAGGCCTATGTGGGATTGGTGGCTGTGGATAAGGGTGTCTATGTGCTGAACAGTAAATTTAAGATCACACAAAAGAAGGTATGGGATTCAGTGGAGAAGTCAGACATTGGCTGCACTCCTGGAAGCGGTGCAAACAGCGAGGGGGTCTTTTCTGACGCTGGGCTTGCTCTACAGACCTCCTTTGGTATCAATACAGCTCAAAGATCGGATGCTCAATGTCCAGCCCCGGCACAACGCAGAAAACGCTCATCTGTTGCGCTCATTGAGATTAAAGCTGGCAAAGCTTCAGAATACAAGGACAAGGCAAAGAAGTGCTGCCTGGATGGAATGCAGGAGAACCTGATGGGCCACACCTGTGACCGACGTTCCCGCTACATCTTGGATGGGAAAGAATGTGTGGATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAAGAGGGAAGCTGAGAAGCTTAGTAAAGATGATGACACCCTTGGAAGAAGTGACGAAGATGATGAATACATGCTGGATTCTGACATTGTGTCCAGGACGGAGTTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTACAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTTTGGATTGGAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGATATAGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTTGTTCAGTGTTTTATATACAGTTCCAATAAAGCATTTATTTGCTTAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Li1       in                    IMAGE:5129689.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACGCGTCCGAGAATATGTGCTACCCTCAATAGAAATTATTCTGAAGCCAGACACTAACTACTTCTATGCTGATGCAGAATCTTTCGGAGTGGATATTCAGGCCCAGTATCTGTATGGGAAACACGTGGATGGATACGCGTTTGTGCTCTTTGGCATAAGGAAGGACAATGTAAAGAAAGGAATCCCAGAGTCGCTGACAAGAGTCAGGATTGATGATGGAGAAGGTCGTGCTGAACTGAAAAGGAAAGACCTAGTGAAGTACTTTGAGAAACCAGAGGACATGCTACAATTCGGCTTGTATGTGACTGTCTCTGTTGTCACGGAAACAGGTAGCGACATGGTGGAGGCTGAGATAGAGCATATCAGTATTGTGACGACGCCATACAAAATCCTCTTTACCAAAACCTCCAAATATTTCAAGCCTGGAATGCCTTTTGATATGATGGTCTATGTAACCAATCCCGATGGTTCTCCCGCTCGTCGTATCCCTGTGGTGGTTGAGCCAGGAAATGTTGAAGGGACCACTCAAGGAGATGGAACCACAAGGCTGACAATGAACACA
  5   1   2       bld Emb4                            IMAGE:4724942.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGCTCGTCGTATCCCTGTGGTGGTTGAGCCAGGAAATGTTGAAGGGACCACTCAAGGAGATGGAACCACAAGGCTGACAATGAACACACCCGCAAATATAAACGTTTTGCCCATAACTGTGAAAACAAGGGACCCAACTTTGCCTCCCTTGCGGCAAGCAACTGCCACCATGACTGCTACAGCTTACCGACCCTCAAAAGCGCATGGGAATTACCTGCATATCAGCATTGCTGGGTCAGATATAAAACCTGGAGAAAACATCCCTGTGAACTTTAATATCCGAAACACTGATGCGGGCGTCCAGAACCAAATACAACATTTTACATATCTGATCATGAGTAGGGGAAGGATTCTAAAGGTGGGAAGGCAGCAACGGCAGCCTGGTCAGCCTTTTGTCACAATGTCTCTACCTGTTACCGATACCTTGATACCATCTTTCCGTATTGTGGCATATTACATTGTCAATGTTGGTGGATCACGTGATGTTGTATCTGACTCTCTTTGGGTGGATGTGGTTGATGACTGCATGGGCACATTGACGGGGACTGGAGATAAGGACAGGGACAATGCCATACAAACCTCCTGGTTCCTCCAATGGAAGCTGAAGCTGAGAGCAGACCACAAGGCCTATGTGGGATTGGGGGCTGTGGATAAAGGGGTCTATGTGCTGAACCGTAAATTTAAGATCCCCCAACAAGAAGGGATGGGATTCACTGGAGAAAGTAGACATTGGGCTGCACTCCTGGAAACCGGGCCAAACAGGCGAGGGGGTCTTTTTCTGAACGCTGGGCTTGCTTCTAACAACCTCCTTTGGGTATTCATACAAGTCCACAGAACGGGAGGCTTCAATGGCCCACCCCCCGGGAACAACGCAAAAAAACCCTCCTTCGGTTGCCGCCCTCTTTGAAATTAAAGCCTGGGAAAAACTTCCCAAAAAA
  5   1   2       bld Li1       in                    IMAGE:3397629.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGGACCACTCAAGGAGATGGAACCACAAGGCTGACAATGAACACACCCGCAAATATAAACGTTTTGCCCATAACTGTGAAAACAAGGGACCCAACTTTGCCTCCCTTGCGGCAAGCAACTGCCACCATGACTGCTACAGCTTACCGACCCTCAAAAGCACAAGGGAACTACCTGCATATCAGCATTGCTGGGTCAGATATAAAACCTGGAGAAAACATCCCGGTGAACTTTAATATCCGAAACACTGATGCGGGCGTCCAGAACCAAATACAACATTTTACATATCTGATCATGAGCAGGGGAAGGATTCTAAAGGTGGGAAGGCAGCAACGGCAGCCTGGTCAGCCTTTTGTCACCATGTCTCTACCTGTTACCGATACCTTGATACCATCTTTCCGTATTGTGGCATATTACATTGTCAGTGTTGGTGGATCACGTGATGTTGTATCTGACTCTCTTTGGGTG
  5   1   2       bld Ga15      in                       XL468l19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACACACCCGCAAATATAAACGGTTTTGCCCATAACTGGTGAAAACAAGGGACCCAACTTTGCCTCCCTTGCGGCAAGCAACTGCCACCATGACTGCTACAGCTTACCGACCCTCAAAAGCACAAGGGAACTACCTGCATATCAGCATTGCTGGGTCAGATATAAAACCTGGAGAAAACATCCCGGTGAACTTTAATATCCGAAACACTGATGCGGGCGTCCAGAACCAAATACAACATTTTACATATCTGATCATGAGCAGGGGAAGGATTCTAAAGGTGGGAAGGCAGCAACGGCAGCCTGGTCAGCCTTTTGTCACCATGTCTCTACCTGTTACCGATACCTTGATACCATCTTTCCGTATTGTGGCATATTACATTGTCAGTGTTGGTGGATCACGTGATGTTGTATCTGACTCTCTTTGGGTGGATGTGGT
  5   1   2       bld Li1                             IMAGE:3397498.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATTTTACATATCTGATCATGAGCAGGGGAAGGATTCTAAAGGTGGGAAGGCAGCAACGGCAGCCTGGTCAGCCTTTTGTCACCATGTCTCTACCTGTTACCGATACCTTGATACCATCTTTCCGTATTGTGGCATATTACATTGTCAGTGTTGGTGGATCACGTGATGTTGTATCTGACTCTCTTTGGGTGGATGTGGTTGATGACTGCATGGGCACATTGACGGTGACTGGAGATAAGGACAGGGACAATGCCATACAAACTCCTGGTTCTCCAATGAAGCTGAAGCTGAGAGCAGACCACAAGGCCTATGTGGGATTGGTGGCTGTGGATAATGGTGTCTATGTGCTGAACAGTAAA
  5   1   2       bld Emb4                            IMAGE:4680005.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAGTAGGGGAAGGATTCTAAAGGTGGGAAGGCAGCAACGGCAGCCTGGTCAGCCTTTTGTCACAATGTCTCTACCTGTTACCGATACCTTGATACCATCTTTCCGTATTGTGGCATATTACATTGTCAGTGTTGGTGGATCACGTGATGTTGTATCTGACTCTCTTTGGGTGGATGTGGTTGATGACTGCATGGGCACATTGACGGTGACTGGAGATAAGGACAGGGACAATGCCATACAAACTCCTGGTTCTCCAATGAAGCTGAAGCTGAGAGCAGACCACAAGGCCTATGTGGGATTGGTGGCTGTGGATAAGGGTGTCTATGTGCTGAACAGTAAATTTAAGATCACACAAAAGAAGGTATGGGATTCAGTGGAGAAGTCAGACATTGGCTGCACTCCTGGAAGCGGTGCAAACAGCGAGGGGGTCTTTTCTGACGCTGGGCTTGCTCTACAGACCTCCTTTGGTATCAATACAGCTCAAAGATCGGATGCTCAATGTCCAGCCCCGGCACAACGCAGAAAACGCTCATCTGTTGCGCTCATTGAGATTAAAGCTGGCAAAGCT
  5   1   2       bld DMZ       in                         xl251a16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCNGCAACGTGCAGCCTGGCTCAGCCTTTTGTCACCATGGTCTCTACCTGTTACCGATACCTTGATACCATCTTTCCGTATTGTGGCATATTACATTGTCAGTGNTGGTGGATCACGTGATGTTGTATCTGACTCTCTTTGGGTGGATGNGGTTGATGACTGCATGGGCACATTGACGGTGACTGGAGATAAGGACAG
  5   1   2       bld DMZ       in                         xl236p12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAGCAACGGCAGCCTGGTCAGCCTTTTGTCACCATGTCTCTACCTGTTACCGATACCTTGATACCATCTTTCCGTATTGTGGCATATTACATTGTCAGTGTTGGTGGATCACGTGATGTTGTATCTGACTCTCTTTGGGTGGATGTGGTTGATGACTGCATGGGCACATTGACGGTGACTGGAGATAAGGACAGGGACAATGCCATACAAACTCCTGGTTCTCCAATGAAGCTGAAGCTGAGAGCAGACCACAAGGCCTATGTGGGATTGGTGGCTGTGGATAAGGGTGTCTATGTGCTGAACAGTAAATTTAAGATCACACAAAAGAAGGTATGGGATTCAGTGGAGAAGTCAGACATTGGCTGCACTCCTGGTAGTGGTGCAAACAGCGAGGGGGTCTTTTCTGACGCTGGGCTTGCTCTACAGACCTCCTTTGGTATCAATACAGCTCAAAGATCGGATGCTCAATGTCCAGCCCCGGCACAACGCAGAAAACGCTCATCTGTTGCGCTCATTGAGATTAAAGCTGGCAAAGCTTCAGAATACAAGGACAAGGCAAAGAAGTGCTGCCTGGATGGAATGCAGGAGAACCTGATGGGCCACACCTGTGACCGACGTGCCCGCTACATCTTGGATGGGAAGGAATGTGTGGATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAA
  5   1   2       bld Li1                             IMAGE:3396948.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACAATGTCTCTACCTGTTACCGATACCTTGATACCATCTTTCCGTATTGTGGCATATTACATTGTCAATGTTGGTGGATCACGTGATGTTGTATCTGACTCTCTTTGGGTGGATGTGGTTGATGACTGCATGGGCACATTGACGGTGACTGGAGATAAGGACAGGGACAATGCCATACAAACTCCTGGTTCTCCAATGAAGCTGAAGCTGAGAGCAGACCACAAGGCCTATGTGGGATTGGTGGCTGTGGATAAGGGTGTCTATGTGCTGAACAGNAAATTTAAGATCACACAAAAGAAGGTATGGGATTCAGTGGAGAAGTCAGACATTGGCTGCACTCCTGGAAGCGGTGCAAACAGCGAGGGGGTCTATTCTGACGCTGGGCTTGCTCTACACACCTCCTTTGGTGTCAATACAGCTCAAAGATCGGATGCTCAATGTTCAGCCCCGGCACAAGGCAGAAGACGCTGATCTGTTGCGCTTCTT
  5   1   2       bld Neu7                                 XL011c02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACGTGATGTTGTATCTGACTCTCTTTGGGTGGATGTGGTTGATGACTGCATGGGCACATTGACGGTGACTGGAGATAAGGACAGGGACAATGCCATACAAACTCCTGGTTCTCCAATGAAGCTGAAGCTGAGAGCAGACCACAAGGCCTATGTGGGATTGGTGGCTGTGGATAAGGGTGTCTATGTGCTGAACAGTAAATTTAAGATCACACAAAAGAAGGTATGGGATTCAGTGGAGAAGTCAGACATTGGCTGCACTCCTGGTAGTGGTGCAAACAGCGAGGGGGTCTTTTCTGACGCTGGGCTTGCTCTACAGACCTCCTTTGGTATCAATACAGCTCAAAGATCGGATGCTCAATGTCCAGCCCCGGCACAACGCAGAAAACGCTCATCTGTTGCGCTCATTGAGATTAAAGCTGGCAAAGCTTCAGAATACAAGGACAAGGCAAAGAAGTGCTGCCTGGATGGAATGCAGGAGAACCTGATGGGCCACACCTGTGACCCGACGTGCCCGCTACATCTTGGATGGGAAGGAATGTGTGGATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAAGAGGGAAGCTGAGAAGCTTAGTAAAGATGATGACACCC
  5   1   2       bld Li1                             IMAGE:3396453.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTTGATGACTGCATGGGCACATTGACGGTGACTGGAGATAAGGACAGGGACAATGCCATACAAACTCCTGGTTCTCCAATGAAGCTGAAGCTGAGAGCAGACCACAAGGCCTATGTGGGATTGGTGGCTGTGGATAAGGGTGTNTATGTGCTGAACANTNNATTTAAA
  5   1   2       bld Emb4                            IMAGE:5571597.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACGCGTCCGCCCACGCGTCCGGTGGCTGTGGATAAGGGTGTCTATGTGCTGAACAGTAAATTTAAGATCACACAAAAGAAGGTATGGGATTCAGTGGAGAAGTCAGACATTGGCTGCACTCCTGGAAGCGGTGCAAACAGCGAGGGGGTCTTTTCTGACGCTGGGCTTGCTCTACAGACCTCCTTTGGTATCAATACAGCTCAAAGATCGGATGCTCAATGTCCAGCCCCGGCACAACGCAGAAAACGCTCATCTGTTGCGCTCATTGAGATTAAAGCTGGCAAAGCTTCAGAATACAAGGACAAGGCAAAGAAGTGCTGCCTGGATGGAATGCAGGAGAACCTGATGGGCCACACCTGTGACCGACGTTCCCGCTACATCTTGGATGGGAAAGAATGTGTGGATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAAGAGGGAAGCTGAGAAGCTTAGTAAAGATGATGACACCCTTGGAAGAAGTGACGAAGATGATGAATACATGCTGGATTCTGACATTGTGTCCAGGACGGAGTTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTANAAGATTCCATCCCCACCTGGGAAGTTCTGGGCTGTGAGTTTGTCTGAANACAAAGGTCCTGTTGTGTGGGGTCAGCCCCTATGAGATTAAGGTTGAAGGAAGGGATTCTTTTATCGACCTGGAAACTTCCCATATTCTGGTTGGAAGGGAACGACCCAGGTGGGAGAATTCGCCGCCCATTCTCCTACCACTTATTAGGAATGGCCAGAATTTAAGGGGGCCCGGGGGGAAACTTGAACCCACAAATTCCCAAAAGTTTTGGCAGTCCGGGTCCCAGGGCCTTAAGAA
  5   1   2       bld Li1       in                    IMAGE:5129752.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGCGTCCGTAAGGGTGTCTATGTGCTGAACAGTAAATTTAAGATCACACAAAAGAAGGTATGGGATTCAGTGGAGAAGTCAGACATTGGCTGCACTCCTGGAAGCGGTGCAAACAGCGAGGGGGTCTTTTCTGACGCTGGGCTTGCTCTACAGACCTCCTTTGGTATCAATACAGCTCAAAGATCGGATGCTCAATGTCCAGCCCCGGCACAACGCAGAAAACGCTCATCTGTTGCGCTCATTGAGATTAAAGCTGGCAAAGCTTCAGAATACAAGGACAAGGCAAAGAAGTGCTGCCTGGATGGAATGCAGGAGAACCTGATGGGCCACACCTGTGACCGACGTTCCCGCTACATCTTGGATGGGAAAGAATGTGTGGATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAAGAGGGAAGCTGAGAAGCTTAGTAAAGATGATGACACCCTTGGAAGAAGTGACGAAGATGATGAATACATGCTGGATTCTGACATTGTGTCCAGGACGGAGTTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACC
  5   1   2       bld Emb4                            IMAGE:4724885.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGGATTCAGTGGAGAAGTCAGACATTGGCTGCACTCCTGGAAGCGGTGCAAACAGCGAGGGGGTCTTTTCTGACGCTGGGCTTGCTCTACAGACCTCCTTTGGTATCAATACAGCTCAAAGATCGGATGCTCAATGTCCAGCCCCGGCACAACGCAGAAAACGCTCATCTGTTGCGCTCATTGAGATTAAAGCTGGCAAAGCTTCAGAATACAAGGACAAGGCAAAGAAGTGCTGCCTGGATGGAATGCAGGAGAACCTGATGGGCCACACCTGTGACCGACGTTCCCGCTACATCTTGGATGGGAAAGAATGTGTGGATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAAGAGGGAAGCTGAGAAGCTTAGTAAAGATGATGACACCCTTGGAAGAAGTGACGAAGATGATGAATACATGCTGGATTCTGACATTGTGTCCAGGACGGAGTTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCANGTGGAGATTCGCGCCATTCTCTACAACTATAGGAATGACAGGAATTAAGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGGCTAAGAAGAGTACAGACCAGGAGGGTTTGAATTTGGAGCCCTCTTCCTCCACCGTTGGTCCCAATTTGTCATTTGTGCCACTCACTCTTGGCCTCCACTGACATTAAAGGGGGAAAGGCATCTGTTTCCAGCTC
  5   1   2       bld Kid                             IMAGE:7010009.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTCAGTGGAGAAGTCAGACATTGGCTGCACTCCTGGAAGCGGTGCAAACAGCGAGGGGGTCTTTTCTGACGCTGGGCTTGCTCTACAGACCTCCTTTGGTATCAATACAGCTCAAAGATCGGATGCTCAATGTCCAGCCCCGGCACAACGCAGAAAACGCTCATCTGTTGCGCTCATTGAGATTAAAGCTGGCAAAGCTTCAGAATACAAGGACAAGGCAAAGAAGTGCTGCCTGGATGGAATGCAGGAGAACCTGATGGGCCACACCTGTGACCGACGTTCCCGCTACATCTTGGATGGGAAAGAATGTGTGGATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAAGAGGGAAGCTGAGAAGCTTAGTAAAGATGATGACACCCTTGGAAGAAGTGACGAAGATGATGAATACATGCTGGATTCTGACATTGTGTCCAGGACGGAGTTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCCATTCTCTANCACTACAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCAN
  5   1   2       bld DMZ       in                         xl247f05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCTTGCTCTACAGACCTCCTTTGGTATCAATACAGCTCAAAGATCGGATGCTCAATGTCCAGCCCCGGCACAACGCAGAAAACGCTCATCTGTTGCGCTCATTGAGATTAAAGCTGGCAAAGCTTCAGAATACAAGGACAAGGCAAAGAAGTGCTGCCTGGATGGAATGCAGGAGAACCTGATGGGCCACACCTGTGACCGACGTGCCCGCTACATCTTGGATGGGAAGGAATGTGTGAATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAAGAGGGAAGCTGAGAAGCTTAGTAAAGATGATGACACCCTTGGAAGAAGTGATGAAGATGATGAATACATGCTGGATTCTGACATTGTGTCCAGGACGGAGTTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTACNGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGG
  5   1   2       bld DMZ       in                         xl271a04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTCTACAGACCTCCTTTGGTATCAATACAGCTCAAAGATCGGATGCTCAATGTCCAGCCCCGGCACAACGCAGAAAACGCTCATCTGTTGCGCTCATTGAGATTAAAGCTGGCAAAGCTTCAGAATACAAGGACAAGGCAAAGAAGTGCTGCCTGGATGGAATGCAGGAGAACCTGATGGGCCACACCTGTGACCGACGTGCCCGCTACATCTTGGATGGGAAGGAATGTGTGAATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAAGAGGGAAGCTGAGAAGCTTAGTAAAGATGATGACACCCTTGGAAGAAGTGATGAAGATGATGAATACATGCTGGATTCTGACATTGTGTCCAGGACGGAGTTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTACAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAAGA
  5   1   2       bld FaB                             IMAGE:8072713.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGATCGGATGCTCAATGTCCAGCCCCGGCACAACGCAGAAAACGCTCATCTGTTGCGCTCATTGAGATTAAAGCTGGCAAAGCTTCAGAATACAAGGACAAGGCAAAGAAGTGCTGCCTGGATGGAATGCAGGAGAACCTAATGGGCCACACCTGTGACCGACGTTCCCGCTACATCTTGGATGGGAAAGAATGTGTGGATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAAGAGGGAAGCTGAGAAGCTTAGTAAAGATGATGACACCCTTGGAAGAAGTGACGAAGATGATGAATACATGCTGGATTCTGACATTGTGTCCAGGACGGAGTTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTACAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAAAAAGAGGTACAAACAGGATGTTTGGATTGGAGGCCTCTCCTCCACCGCTGTCCCAATGTCATT
  5   1   2       bld DMZ                                  xl266i23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCACAACGCAGAAAACGCTCATCTGTTGCGCTCATTGAGATTAAAGCTGGCAAAGCTTCAGAATACAAGGACAAGGCAAAGAAGTGCTGCCTGGATGGAATGCAGGAGAACCTGATGGGCCACACCTGTGACCGACGTTCCCGCTACATCTTGGATGGGAAAGAATGTGTGGATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAAGAGGGAAGCTGAGAAGCTTAGTAAAGATGATGACACCCTTGGAAGAAGTGACGAAGATGATGAATACATGCTGGATTCTGACATTGTGTCCAGGACGGAGTTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTATAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAANAAGAGGTACAGACAGGAGG
  5   1   2       bld DMZ       in                         xl230c22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGCTTCAGAATACAAGGACAAGGCAAAGAAGTGCTGCCTGGATGGAATGCAGGAGAACCTGATGGGCCACACCTGTGACCGACGTGCCCGCTACATCTTGGATGGGAAGGAATGTGTGGATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAAGAGGGAAGCTGAGAAGCTTAGTAAAGATGATGACACCCTTGGAAGAAGTGACGAANATGATGAATACATGCTGGATTCTGACATTGTGTCCAGGACAGAGTTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTACNGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAANAAGAGGTACAGACAGGANGTTTGGATTGGAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGATATAGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGT
  5   1   2       bld DMZ       in                         xl302f24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGCTTCAGAATACAAGGACAAGGCAAAGAAGTGCTGCCTGGATGGAATGCAGGAGAACCTGATGGGCCACACCTGTGACCGACGTGCCCGCTACATCTTGGATGGGAAGGAATGTGTGGATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAAGAGGGAAGCTGAGAAGCTTAGTAAAGATGATGACACCCTTGGAAGAAGTGACGAAGATGATGAATACATGCTGGATTCTGACATTGTGTCCAGGACAGAGTTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCANCCCTATGA
  5   1   2       bld DMZ       in                         xl271b06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGGAATGCAGCGAGAACCTGATGGGCCACACCTGTGACCGACGTTCCCGCTACATCTTGGATGGGAAAGAATGTGTGGATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAAGAGGGAAGCTGAGAAGCTTAGTAAAGATGATGACACCCTTGGAAGAAGTGACGAAGATGATGAATACATGCTGGATTCTGACATTGTGTCCAGGACGGAGTTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCANGTGGAGATTCGCGCCATTCTCTACAACTATAGGAATGACAGANTTAAGGTGCGTGTGGAGCTGACCCACAATCCANAGTTTTGCAGTCTGTCCACGGCTAATAANAGGTACAGACAGGAGGTTTGGATTGNAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGACATANAGGTGAAGGCATCTGTTTCA
  5   1   2       bld Li1                             IMAGE:3396881.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAAGAATGTGTGGATGCTTTCCTGGACTGCTGCAGATACTATGAGAAGAAGAGGGAAGCTGAGAAGCTTAGTAAAGATGATGACACCCTTGGAAGAAGTGACGAAGATGATGAATACATGCTGGATTCTGACATTGTGTCCAGGACGGAGTTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGAAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTACAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCAC
  5   1   2       bld Emb4      in                    IMAGE:4958893.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGAAGATGATGAATACATGCTGGATTCTGACATTGTGTCCAGGACGGAGTTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTATAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTTTGGATTGGAGCCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGACATAGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTT
  5   1   2       bld Li1       out                   IMAGE:5129448.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  gacgcgtccgcccacgcgtccgcccacgcgtccgcTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCGAGCAAGAGCCTAAATGTTTTCTTGAAAGATTCCATCACCACCTGGGAGGTTCTAGCTGTGAGTTTATCTGAAACTAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTACGGGAATGACAGAATTAAGGTACGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTTTGGATTGGAGCCCTCTCCTCCACCACTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCAGCATGATATAGAGGTGAAGGCATCTGTTTCAGGAGTTTTTGCGTCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGC
  5   1   2       bld Ga15      in                       XL477i07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTCCTGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTACAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTTTGGATTGGAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGATATAGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCCGCTGGCTGTG
  5   1   2       bld Li1                             IMAGE:3396632.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGAAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTACAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTTTGGATTGGAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGATATAGAGGTGAAG
  5   1   2       bld Li1                             IMAGE:3396522.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAGCTGGTTCTGGAAAGTGGAGCAAATGGCCGAGAAGCCTGATGTCAACGGTATTTCAAGCAAGACCCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTACAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAG
  5   1   2       bld Ga15      in                       XL492k18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTAAATGTTTTCTTAAAAGATTCCATCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTACAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTTTGGATTGGAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGATATAGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTANAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTG
  5   1   2       bld Emb9      in                    IMAGE:7976802.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCGGGTGTTTTCTTAAAGATTCCTCACCACCTGGGAAGTTCTGGCTGTGAGTTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTACAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTTTGGATTGGAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGATATATAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCATATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATCTTAGAGCCGGTAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCACTGAATCCCTAAAATGTTGTCCTGCGAACCGTACTTGATTACCTCATTACTTTATGAGTAACCCGATTAGCCAGATGGTGGAATATGCCTTTGATGGTCACATTATTAATCATCTGATTGGTGTTCCCGCTTGTTGTGGGGATCTATACTCTATTTCTACGACTTTTTTTGTTATTTCACACGCTTACTGTATGTTATTGGC
  5   1   2       bld Emb4      in                    IMAGE:4959992.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACGCGTGGGCCACCCACGCGTCGGCTGTGAGGTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTACAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCTTTTTTCTTAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTTTGGATTGGAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGATATAGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAACTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAAGGAAAGGTGGCGTGCAAGAAGAGAAAGCTGACGCCCTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCC
  5   1   2       bld Li1                             IMAGE:3397144.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACGCGTCCGTTGTCTGAAAACAAAGGTCTGTGTGTGGGTCAGCCCTATGAGATTAAGGTGATGAAGGATTTCTTTATCGACCTGAAACTTCCATATTCTGTTGTGAGAAACGAGCAGGTGGAGATTCGCGCCATTCTCTACAACTACAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTTTGGATTGGAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGATATAGAGGTGAAGGCATCTGTT
  5   1   2       bld Neu7                                 XL028a02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGTGATGAAAGATTTCTTTATCGACCTGAAACTTCCTATTCTGTTGTGAGGAACGAGCAGGTGGAGATTCGCGCGATTCTCTACAACTACAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTGTGGATTGGAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGATATAGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTCGAAGCACTGAAT
  5   1   2       bld Lu1                             IMAGE:4057678.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTATAGGAATGACAGAATTAAGGTGCGTGTGGAGCTGACCCACAATCCAGAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTTTGGATTGGAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGACATAGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGGCATTGCTTCAAGATGTAAAGAACTGTTATATTAGAAGCCGGAAGTTAAAGGGAAAGGGTGGCGTGCAAGAAGAAAAAGGTTAAAGCCCTGAATTCCCAAAA
  5   1   2       bld Emb4                            IMAGE:5514586.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCGTGTGGAGCTGACCCTCAATCCAGAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTTTGGATTGGAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGATATAGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCCCTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCAAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAGTTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCANGAATNNTATGATATGAGGCTATGTTCTCTGCGGCTCCGTCAAATGGCTATACTGGAGAACAGAAGCGGATGGATTGTC
  5   1   2       bld Emb4                            IMAGE:4680406.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAGCTGATCCACCATCCAGAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTTTGGATTGGAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGATATAGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCT
  5   1   2       bld Emb4                            IMAGE:5516355.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCAGAGTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTTTGGATTGGAGCCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGACATAGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCCCTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAGTTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCANACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTTATGATATTGAGGCTAAATGTCTCTGCNGCTCCGTCAAATGGCTAAACTGGAAAACANAAGCCCGGATGTATGTTCAGAAATGCGCAGTCATCATACGAAA
  5   1   2       bld Neu7      in                         XL021p24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTTGCAGTCTGTCCACGGCTAAGAAGAGGTACAGACAGGAGGTTTGGATTGGAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGATATAGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAA
  5   1   2       bld Li1                             IMAGE:3397473.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACGCGTGGGTGGAGGCCTCTCCTCCACCGCTGTCCCAATTGTCATTGTGCCACTCACTCTTGGCCTGCATGACATAGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCCCTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCAAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGNGAGCGAGTTGGAGTGAACCGGATAGAACAAGCCCTCACACACATGAGACAATGCTATGCTCAACAAATTGGTTTTCGCAAACCGGACAACTCCTACGCAGCCTTGAATGATAGACTAGCGAATACATGGGTCACAAGC
  5   1   2       bld Tad2                            IMAGE:6931458.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGTCATTGTGCCACTCACTCTTGGCCTGCATGATATAGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGGAGAAACAGAAGCCGGATGGATTGTTCCANGNAGAATGCGCCCAGTCATCCANNTCAAGAGATGGGTGGGAAGGGAATCACAACCAGGGGAGCAAGCA
  5   1   2       bld Emb4                            IMAGE:4201840.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCTTCCGAGGTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTATAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCATGAATAGAAAGTTGAAGCACTGAATCCCAAAAATGTTGTCCTGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAAC
  5   1   2       bld Ga18                              xlk117n05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATATAGAGGTGAAGNNATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGNTCAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGNGTGCAAGAAGAGAAAGNTGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGNAACAATATGAATCATCTGATTGTGGNTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGNGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCNNANACATGAGACAAGGNTATGCTCAACAAATGGCTTTCCGCAAACCAGNACAACTCCTACGCAGCCTGNAAGGATAGANCAGCGAGTACATGGCTCANAGNCTATGTGGCTAAAGNCTTTTGGGATGNCTCAGGAATTTATTGATATTGAGNCTAATGTTCTCTGCGGCTNCNNCAAATGGCTTATACTGGAGAAACAGAAGCCGG
  5   1   2       bld Ga18      in                      xlk116n05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATATAGAGGNGAAGNCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCANNNNNAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATNNNNCAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGNTAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTNATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGNNTGTTCNAGGAGANTGCGCCAGTCATCCATCAGGAGATGNGGGAGGAATCACAACAGGAGCAGCAG
  5   1   2       bld Ga18      in                      xlk146g15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAGAGGTGAAGNNATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATNNNNAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTCGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCAAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCGTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATATATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATNNNTGTTCCAGGAGAATGCGCCAGTNATCCATCAGGAGANGGTGGGAGGAATCACAGCAGGANNAGCAGAGGGAGANTCTTCGCTCACGGCCTTTATTCTTNTCGNCATNNTAGAATGCCAAAGGACTT
  5   1   2       bld DMZ       in                         xl228o19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGGAGGAATCACAACAGGAGCAGCAGAGGG
  5   1   2       bld DMZ       in                         xl226n24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGAAGGCATCTGTTTCAGCTCAATCTGGATTCTTTGGTGCAGATGGTGTCCGTAAAAAGCTGAAAGTTGTGCCTGAAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGA
  5   1   2       bld DMZ       in                         xl324m01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGGAATGCGCATTGCTCAAGATGTAAAGACTGTTATATTAGAGCCGGAAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAAT
  5   1   2       bld Tad2      in                    IMAGE:6872022.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGTTAAAGGGAAAGGTGGCGTGCAAGAAGAGAAAGTTGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAAGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGGCCTTTATTCTTATCGCCCATGCTAGAATGCCAAAAGGACTTGTAAACGAGCCATGTGAAACAACCCTTCCAAGTCAGGTATTGGATAAAGGCCCCTCAAGGTTACCCCTGTGGTTGGGTCCAAATAATTCCCAGGGACCTTaaaaaaaaaCCCCATTAATTTTCCAAATTGGCCAAT
  5   1   2       bld DMZ                                  xl310i02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGAAAGTTGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCNGGGAAGCT
  5   1   2       bld DMZ                                  xl227c12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGAAAGTTGAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCT
  5   1   2       bld DMZ       in                         xl262h14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGCACTGAATCCCAAAAATGTTGTCCCGCGAACCGACATTGACACCACCATTACTTTACAAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAATATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACT
  5   1   2       bld Li1       in                    IMAGE:5129660.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGGAACCCCGATCAGTCAGATGGTGGAAGATGCCATTGATGGCAACAAAATGAATCATCTGATTGTGGTTCCCGCTGGCTGTGGGGAGCAGAATATGATCTCAACGACTCCTAGTGTCATTGCCACACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCANGAGATGGTTGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTTATTCTATCGCCATGCTAGAAATGCCAAAGACTTGTAACGAGCATGTGAACNACCTTTCAGTCAGTATTGATAAGGCCCTCAGTTAC
  5   1   2       chi Em10      in                    IMAGE:7983243.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCGTGTGGCAATGACACTAGGAGTCGTCGAGATCATATTCTGCTCCCCACAGCCACTTGCATCCAGGTAGCGTGTGGCAATGACACTAGGAGTCGTCGAGATCATATTCTGCCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTAGCTGGTTGGTCAATATCCAGGACTAAAAAATCATATTCCATTGCAATTACTTCCTATGCTCTTGACCTGGCCAGGAAGCTTCTAAACAAAATAAACTGCTGTCTGCATCTATAG
  5   1   2       bld Neu7      in                         XL040f21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTCCTAGTGTNTTGCCCACGCTACCTGGATGCAAGTGGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGAACAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGA
  5   1   2       bld Li1                             IMAGE:5129419.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACGCGTCCGCCTGGATGCAACCGGGCAGTGGGATCGAGTTGGAGTGAACAGCAGAGATCAAGCCCTCAAAAACATGAGACAAGGTTATACACAACAAATGGCTTACCGCCAACCAAACAACGCATATGCAATCTACTTGACCAAACCAGCAAGTACATGGCTCACAGGCTATGTTGCTAAAGTCTTTGGGATGGCTCANGAATTTATTGATATTGAGGATAAAGTTCTCTGTGGTGGCGTCAAATGGCTTATACTGGAGAGACAGAAGCCGGATGGATTGTTCGAGGAGAACGCACAGTCATCCNACAGATATGGTGGGAGAATCACCACAGGAGCACAGAAGCAGAATCTTCTCTCACGCCTTTTATGGTATTGCATGCTAAAATGCCAAAGGACTTGC
  5   1   2       bld DMZ       in                         xl280h11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCCAATGGGAGCGAATTGGAGTGAACCGCAGAGACCAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGTACTTGTAATGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAACGAGCAGAGATACTATGGAGCAGTTTATGGCTC
  5   1   2       bld DMZ                                  xl296p10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAGAGAGTGAACCGCAGAGACCAAGCCCTCAAAAACATGAGACAAGGCTATGCTCAACAAATGGCTTTCCGCAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGTACTTGTAATGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAACGAGCAGAGATACTATGGAGCAGTTTATGGCTC
  5   1   2       bld Emb4                            IMAGE:5542085.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ccacgcgtccgtcgacccacgcgtccgcccacgcgtccggCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGCTGGTCAATATCAAGGACTAAAAAAACCCTATTCCATTGCAATTACTTCCTATGCTCCTGCACTGGCCCGGGAACTTCCAAACACAAATAAACTGCGGGCCTGCATCTATAGGAAACACCCCCCTGGGGAGGAACCAAGGGAAACCGCTTTTATCTTCCTTGGGAAACCCCCATCATAATGGCCCTCCCTAACCCTTCCTTAAAAAATGAAGGGGATTTTGGATTCCTAACCAGGGGGGGCATTTGTAACGCTTTGGCCTCTCAATGGGACCCCAAAAATTACCTATGGGGAGCCCAAGTTTTAATGGGGTTccccccccccGGGCCACCCCATTCCCGGGAAATGGTTCCCAAAACCTTCCTGTTGGTTCCCGGTAACCCGC
  5   1   2       bld Emb4                            IMAGE:5514703.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAACCAGACAACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAAACACCTTTAACCTATCGTATNCATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTTAATCANGACTTTGTGGT
  5   1   2       bld EggS                            IMAGE:4785636.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACTCCTACGCAGCCTGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCTTGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGTTAGACTCTTCCCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGC
  5   1   2       bld Neu7      in                         XL018h04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGAAGGATAGACCAGCGAGTACATGGCTCACAGGCTATGTGGCTAAAGTCTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCAAGGACTAAAAAAACCCTATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGC
  5   1   2       bld Brn3                            IMAGE:8539012.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTACATGGCTCACAGGCTATGTGGCTAAAGTGTTTGGGATGGCTCAGGAATTTATTGATATTGAGGCTAATGTTCTCTGCGGCTCCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGGATTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGTACTTGTAATGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTCCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAAAACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATTGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACTATCGTATCAATCTTGAAATGCTTTGTGGCACGTCTGCAGAGACTAGTAANCNAGACTTGTGTAAAGCTAAGGGAGGACAGTACATGAGGG
  5   1   2       bld FaB       in                    IMAGE:8069407.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGAATTTATTGATATTGAGGATAAAGTTCTCTGTGGTGCCGTCAAATGGCTTATACTGGAGAGACAGAAGCCGGATGGATTGTTCGAGGAGAACGCACCAGTCATCCAACAGAATATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGCAGAATCTTCTCTCACAGCCTTTATTGTTATTGCCATGCTAGAATGCCAAAGGACTTGCAATCAGCATATAAACAACCTTCAAGTGAGTATTGATAAGGCCTCAGACTACCTGGTTGGTCAATATCAAGGACTACAAAAACCATATTCCATTGCAATCACTTCTTATGCTCTTGCACTGGCCGGGAAGCTTCCGAACACAAAGAAACTGCTATCTGCATCTAACGGTAACACCCACTGGGGGGAGATAAGGGAACGTTTTATCTCCCTGGAAGCCACATCATACGCCCTCCTAACCCTCCTAAAAATGAAAGAATATGATTTAACGGGTGGGATCGTACATTGGATCAATGAGAAGAGATACTATGGAGCAGTTCACGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGACATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACACAACCTTTACCTATCGTATCATCTGAAATGCTTGCTGGCACTTCTGCGGAGACAGTTAAAACAAAATTGTTGGTGAAGCCCAGCAGGGGCAGGTACTTGAGGTGTG
  5   1   2       bld Ga18      in                      xlk162c16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGTCAAATGGCTTATACTGGAGAAACAGAAGCCGGATGNTTGTTCCAGGAGAATGCGCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTNNTCGCGCGTTCTGCGGAGNNTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAANGGGANAAGGTACAATGAGGGNGGNGACCNTGTACCATGCTCNTNTCACAGAGAAAGAAAGAAAGNNCNTNACTTTGAACTGTCTGTGANNTAAAGGA
  5   1   2       bld Ga14                                Ga14-p4c6.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGGCTTATACTGGATAAACANAAGCCGGATGGATTGTTCCAGGAGAATGCNCCAGTCATCCATCAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACG
  5   1   2       bld DMZ       in                         xl338b03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGGAGATGGTGGGAGGAATCACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCAAGGACTAAAAAAACCCTATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGACATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAG
  5   1   2       bld Emb4                            IMAGE:5514371.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCACAACAGGAGCACCATAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCAAGGACTAAAAAAACCCTATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGACATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAAGTACACTTTGCAGACCCTCCGAANNGTGCAANNGCACAGTGTCTATAGAAGCCTGTGNCAGGCATNCTCAGAACGTTGATC
  5   1   2       bld DMZ       in                         xl335e10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAACAGGAGCAGCAGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGTACTTGTAATGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAACGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGA
  5   1   2       bld Lu1                             IMAGE:4633918.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAGGGAGACTCTTCGCTCACGGCCTTTATTCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCAAGGACTAAAAAAACCCTATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGACATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAAT
  5   1   2       bld Li1                             IMAGE:3397386.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACGCGTCCGCCCACGCGTCCGCTTATCGCCATGCTAGAATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGA
  5   1   2       bld Emb4                            IMAGE:5572204.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGCCAAAGGACTTGTAACGAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCAAGGACTAAAAAAACCCTATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCCAGACCTCCCGAAGGGCCAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTTCCATGATGACTGGCCTTTTCTCCTGATAACCCATTCCCTGGAATAAGGTAATGGAAGGGAAGGGGACAAATACCACCTCCAAATATGAAAGCCCACCAAGGAACCAATTTACAAGGGAAACCCTTTATTATCCACCTTGGGACAAAGTCCTCCCC
  5   1   2       bld FaB                             IMAGE:8073451.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGCATGTGAACAACCTTCAAGTCAGTATTGATAAGGCCTCAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGGCATCTCAGAACGTTGATGCCACCATGTCCATATTGATATTTCATGATGACTGGCTT
  5   1   2       bld FaBN                            IMAGE:8076942.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATAAGGCCTCAGACTACCTGGTTGGTCATATCAAGGACTACAAAAACCATATTCCATTGCAATCACTTCTTATGCTCTTGCACTGGCCGGGAAGCTTCCGAACACAAAGAAACTGCTATCTGCATCTAACGGTAACACCCACTGGGGGGAGATAAGGGAACGTTTTATCTCCCTGGAAGCCACATCATACGCCCTCCTAACCCTCCTAAAAATGAAAGAATATGATTTAACGGGTGGGATCGTACATTGGATCAATGAGAAGAGATACTATGGAGCAGTTCACGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGACATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCGGAGACCAGGTTAAACCAAGACTTTGTGGTGAAAGCCCAGGGCAAGGGGCAAGGTACATTGAGGGTGGTGACAGTGTACCATGCTCTTGTCACGGAGAAAGAAAGGAAGTGCCTTAACTTTGATCTGTCTGTGAAAGTGAAGAAAGAACAATTGCTAGACCTTCCGAGGAGCAAGGCAACGGTGTCTATCGAAGCTTGTGCTGGCATCTCAAGAACGTGATGCACCATGTCCATAATGATATTCCATGATGACTGCTTTTCTCCGAACTGATCTCTAAAGGCTATGA
  5   1   2       bld Neu4      in                    IMAGE:4084761.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAGTTACCTGGTTGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCATGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTCGCGCGTTCTGCGGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATG
  5   1   2       bld Tbd3                            IMAGE:3548201.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGTCAATATCCAGGACTAAAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTNTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTGCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTT
  5   1   2       bld Panc                            IMAGE:8737836.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTAAAAAAACCCTATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAGACCTCCCGAAGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGCATCTCAGAACGTGATGCCACCATGTCATATGAATATTTCCATGATGACTGGCTTTTCTCCTGATACGATCCCTGGATAGCTATGAGGAGTGACAATACATCTCTAATATGAGTCAACAAGGAACATGACAGATCCTTAATTATTCTACTTGACAGGTCTCCAAAGACAGAGAATGCCTGAGTTTACGCTCACAATACTTGAGTGATCATCAGCAGCT
  5   1   2       bld Tbd3      in                    IMAGE:3548526.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAAACCATATTCCATTGCAATTACTTCCTATGCTCTTGCACTGGCCGGGAAGCTTCCAAACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTNTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTNCATTATTGATATTTNCATGATGACTGGCTTTTCTCCTGATACCGATTCCNTGGATAAGCTAAATGAAGGAGTG
  5   1   2       bld Emb4                            IMAGE:4680083.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACACAAATAAACTGCTGTCTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTCGCGCGTTCTGCGGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGNCAGGCATCTCAAGAACGTTGATGCCACCATGTCC
  5   1   2       bld Emb4                            IMAGE:5571907.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGCATCTATAGGTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAANGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCNAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTTGAATTTTATGCTCATCAATACTTTGAAAGGGGGTTTCATCCAGCCAGGCTTCTGGAAACTGTGGATGGACTAATTATACTCCAGGAATATCCGTTGGCACTAAAATTTTTACCCCTGGTGGGAAAAAAAGGGCATGGGCCCCTGCCTGGNGCAAAC
  5   1   2       bld DMZ       in                         xl341o09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTAACACCCACTGGGAGGAGCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAACGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGTAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACCCTTATTATCTACTTGGACAAAGTCTCCCA
  5   1   2       bld Neu7                                 XL030m01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCAGGNAATTCGGCACGAGGGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTCGCGCGTTCTGCGGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACT
  5   1   2       bld Neu7                                 XL045k15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCACCCACTGGGAGGAGCCGGGNAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATTGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAAT
  5   1   2       bld DMZ       in                         xl273e02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCAGGGAAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTCGCGCGTTCTGCGGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAG
  5   1   2       bld Brn3                            IMAGE:8537664.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCAGGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGTAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGANCAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACACAGAGGAAGAATGTGTGAAGTTTATGCTCATCATACTTTGAAGTGGTTCATCAGCCAGCTCTGTACTGTGTAGACTATATACTCAGATATCGTGCACTATTTACATGTGAGAAGCATGCC
  5   1   2       bld Li1       in                    IMAGE:3397936.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTCGCGCGTTCTGCGGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAA
  5   1   2       bld Emb4                            IMAGE:4680646.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGAAACGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTCGCGCGTTCTGCGGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACNAATACATCTCTTAATATGAA
  5   1   2       bld Emb9                            IMAGE:7977707.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCTTTATCTCCCTGGAAACCACATCATATGCCCTCCTAACCCTCTTAAAAATGAAGGAATTTGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTCGCGCGTTCTGCGGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGGACAAAGTCTCCCACAAAGACGAAGAATGCGTGAAGTTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGA
  5   1   2       bld Li1                             IMAGE:3396583.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGATGGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGCTCTATGCATCACTATATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAA
  5   1   2       bld Eye1                            IMAGE:6947524.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGATCTAACAGGTGGCATTGTACGTTGGCTCAATGAGCAGAGATACTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTCGCGCGTTCTGCGGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGGTTTCATCCCAGCCCAGCTTCTTGTAACTGGTGTAGGAATATTTATACTCCAAGATAAATTCGTTGGCACTAAAATTTTTACCCATGGGGGAAAAAAGGCGAGTGGCCCTGCCTGGGGAAGGAATTTGCCCAAGGGAAAATATATTGCCGGGGGGTGCCAAAAAGAAGAAACGGGTTTTCTTGGCAGGCAAACAAAATC
  5   1   2       bld Tad1                            IMAGE:6937496.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTATGGAGCAGTTTATGGCTCCACCCAGGCAACCATCGTGATGTTCCAAGCTCTTGCTCAGTACCAGACAGATATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAAACACTATTCTCTACTTGGAACAAAGTCTTCCCCCTAGACCGAAAAATGGTGTGGAAGTTTTATGCCTCATCCAATACCTTTGAAGTGGGGTTTCCATTCCAGCCCAGCCTTCTGGTAACCTGGTGTATGGACTTATTTTATACTCCCCGAATAAATCCGTTGCACCTAAAATTTTTACCAATGTGGGGAAAAAAAGGCAGGTGGCCCCTGGTT
  5   1   2       bld Tad1                            IMAGE:6939001.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGTCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGCGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAAAAAGGCAGTGCCCCTGTTTGGGCAGGATTTTGCCAAGGGAGATATTATGCCGAATGTGGCCAAAAGAAGAAACTGTTTTCATGGCCACCCACCAAATTTgggggggggTAAAAATCCACCTGGCTTGAACATTGGAGAAAGTCCAAACATTGTGGCCTTTGGCCGCCCTCCCCCGGGAAAGTGGGA
  5   1   2       bld Tbd7      in                         XL092b08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCAACAACCTTTAACCTATNCGTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGC
  5   1   2       chi DMZ       in                         xl231p18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCCCAAGTGTCAATGAGTTGAACTTAGATGTCTCCCTTCATCTCCCAGAGAGACAACAACCTTTAACCTATCGTATCAATCTTGAAAATGCTTTGCTCGCGCGTTCTGCGGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTAC
  5   1   2       bld Emb4                            IMAGE:5572099.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTATCAATCTTGAAAATGCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACCCTTATTATCTACTTGGACAAAGTCTCCCACAAAGACGAAGAATGCGTGAAGTTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGCTGCACTANATTTTACCATGTGGAAGAAGGCAGTGCCCTGTTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCNTCCCGGAGTGGATTTTGTGTACCAAGCTACTCTCACGGAGTTGCCAGCCAGCGGACACTTTGACAACTATGTTTATGACATTAAGAAAGGTCTTCAAGCAAGGCACCGAATGAAGGATCCTGAAGGACTAGACACCGAAATTTTTATCCGCCATATTCAAATGCCCGAAAAGGCTTTTAAATTTGGCCGGCTGGAACCGCAGAAATTATCCTGAATTTTTgggggggggataaacttgggggggACCCCTCA
  5   1   2       bld Tbd7                                 XL109m15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTTTGCTGGCACGTTCTGCAGAGACTAGGTTAAACCAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACCCTTATTATCTACTTGGACAAAGTCTCCCACAAAGACGAAGAATGCGTGAAGTTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGCTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGTTGGGCAGGATTTGCCAAGGAGATATATGCCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCG
  5   1   2       bld DMZ       in                         xl222p12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGTAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACCCTTATTATCTACTTGGACAAAGTCTCCCACAAAGACGAAGAATGCGTGAAGTTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGCTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGTTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCA
  5   1   2       bld DMZ       in                         xl278a06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTCTGCAGAGACTAGGTTAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGTAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACCCTTATTATCTACTTGGACAAAGTCTCCCACAAAGACGAAGAATGCGTGAAGTTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGCTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGTTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGC
  5   1   2       bld Li1                             IMAGE:3397514.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACGCGTCCGAAACCAAGACTTTGTGGTAAAAGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTTCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGGAACTGTGTATGACTATTATACTACAGATAATCGTTGCACTAGATATTACCATGTGGAAGAACGCAGTGCCCTGCTGGGCAGGATTTGCACAGGATATATTTTCCGGTGTGCAAAAAAGAACTGT
  5   1   2       bld Emb4      in                    IMAGE:4958870.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACAAAGACGAAGAATGCGTGAAGTTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGT
  5   1   2       bld Emb4      in                    IMAGE:4958994.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCTAAAGGGAAGGGACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACAAAGACGAAGAATGCGTGAAGTTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACT
  5   1   2       bld Brn3                            IMAGE:8540889.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGACAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGTTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACACTATGTAATGACAATTAAGAAGTCATTAAGCAGGCACAGATGAAGATCCTGAGACAGACACGCATTTATCAGCATATCAATGCCGAAAGCTTAATATGCACTGAACGAGANTCTGATTGGGGTACTGTGACTCTGCGCAGCAATGATATCTACTCATGGAGACCTGATGATG
  5   1   2       bld Tad2      in                    IMAGE:6874257.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACAAGGTACAATGAGGGTGGTGACCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTGTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGANGGGTAAAATCACTGGCTGACATGAGAGTCAACATGGCCTTGGCGCTCCCGGGAGTGGGATTTTGGTTGTACAAAGGCTACCTCCTCACGGGAGGTTGGCAGCCCCAGGCGGACAAACGTATTGGACCAACCTATGGTTAAATTGGAACAAAATTTAAGAAT
  5   1   2       bld Brn3                            IMAGE:8539241.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGTGTACCATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATNNGACATTAGAAGGTCATTNAGCAGGCACAGATGAAGATCCTGAGGACAGACACGCATTTTATCAGCATATCAATGCCGAAAGCTTAATATGCAGCTGAACGAGATACTGATTTGGGGTACTGTGACTCTGCGCAGCAGATGAATCTACTCATGGAAGACCTGATGATGTGCCATG
  5   1   2       bld Tbd2      in                    IMAGE:3200956.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATGCTCTTGTCACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACAAAGACGAAGAATGCGTGAAGTTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCTACTACTATGACTACTATGTAATGACAATTAAGAAAGTCATTAAGCAAAGC
  3   1   2       bld Ga18      in                      xlk130d07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CNNAANNCTNCNNNNTNNNNCGAAGNANNNNNGAAGTTTNATGCTCATCANNNTTTGAAGTGGGTTTCNNCCAGCCAGCTTCTGTNACTGTGTATGACTATTATNCNNCAGANAANNGTTGCACTAAATTTTNCCATGTGGAAGNAGNNAGNNNCNGCTGGGCAGGATTTGCCAAGGAGATATATNNCGATGTGCAGAAGAGAACTGTTTCATNCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATNNNNGCGCTCCCGGAGTGGATTTTGTGTACAAGNCTACTCTCACGGAGTTGCAGNCCAGCGACAACTTTGACAACTATGTTATGACAATTAAGAAGGTCATCAANCAAGGCACAGATGAGGATCCTGAGGACAAGACACGTAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGGTAAGTAAAATGTCTGTTGAGTCAAAAATGAAGTTTCATGAGTCTGTGAATGCCCAAATACAAGCATTCACAAAAGAGAGGCATCATTATGTCCAGACCAACTGGAATACAATTAAAATAAACATGTCTCTTAAAACTGCCTCCATACATGCAGCAGAAGTCTGACCATACTGTTTCACACATTTTTGTGACGCCCAATTGAGTGTATCGCTTTGGAAAGAGATAGGACTTGTGGCCCGTTTCACTTACAAGTCTGCTGATAACCCCCATTCAATTCATTGGAATGATGTGTGTTCTTTGTAGATATTCCTACATCATTGGAAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTTNTTCAGTNTTTTATANACA
  5   1   2       bld Ga15      in                       XL456o10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACAGAGAAAGAAAGAAAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACAAGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGG
  3   1   2       bld Ga18 5g3  in                      xlk137d08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CANAGAGNAAGAAAGNAANNGCNTNNNNTTGANCTGTCTGTGAATGTAAAGNAAGTANNNCTNNCANGNCNTCCNGNANGNTNNAAAGGNAACAGTGTCTATAGAAGCCTGTNNAAGGCATCTCAAGNACGNTNATGCCACCATGTCCATTATTGATATTTCCATGATGACTGNCTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACNTCTCTAAATATGAAGTCAACAAAGGAGNAAATGACAAGGGAACACTTATTCTCTACTTGGACAAANTCTCCCACATAGNCGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCANNNNCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACANNNNNGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTNTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTTNTTCAGTNTTTTATANA
  5   1   2       bld Li1       in                    IMAGE:5130000.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGAAAGAAAGACAGTGCCTTAACTTTGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTG
  5   1   2       bld Li1       in                    IMAGE:3397460.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTNTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACCCTTATTATCTACTTGGACAAAGTCTCCCACAAAGACGAAGAATGCGTGAAGTTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGCTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGTTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAAGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTTCGCCTCCGGAATGGATATTGTGTACAGGCTACTCTCGACGAGTTCAGCCCAGCGACACTTTTGACACTATGTTATG
  5   1   2       bld Li1       in                    IMAGE:3397461.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAACTGTCTGTGAATGTAAAGGAAGTACAACTTGCAAGACCTCCCGAAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACCCTTATTATCTACTTGGACAAAGTCTCCCACAAAGACGAAGAATGCGTGAAGTTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGCTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGTTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTTAACATGGCTCGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTTTGACAACTATTGTATG
  5   1   2       bld Ga18      in                      xlk124a08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGAAGTACAACTTGCAAGACCTCCNGNAGNGCAANNNNNNAGTGTCTATAGAAGCCTGTGCAAGGATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGCTGCACTAAATTTTACCATGTGGAAGAAGGCAGNNCCCTGCTGNNNGGATTTGCCAAGGAGATATATGCCGGTGCGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGNNCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGGTGCAGCCCAGCGACAACTTTGACNANNNNNNTATGACNA
  5   1   2       bld Neu7      in                         XL045d07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTACAACTTGCAAGNACCTCCCGAGGTGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTA
  3   1   2       bld Ga18      in                      xlk146g15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ANGNCNTCCNGANGNTGNAAAGGCAACAGTGTCTATAGAANNCTGTNNAAGGCATCTCAAGNACGTTGATGNCACCATGTCCATTATTGATATTTCCATGATGACTGNCTTTTCNCCTGANNCCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATNCATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAANTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTANCTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCANNNNCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACANNNNTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTTTGACAACTATGTTATGACAATTAAGAAGGTCATCAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGTAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGAAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTTGTTCAGTNTTTTATATACA
  3   1   2       bld Ga18      in                      xlk116n05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GNCCTCCCGAAGNTNNAAAGGCAACAGNNNCTANAGAAGCCTGTNNAAGGCNTCTCAAGACGTTGATGCCNCCNTNTCCATTATTGANNTTCCATGATGACTGGCTTTCTCCTGANNCNATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATANNNNNNNAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGNACNCTTATTCTCTACTTGGACAAANTCTCCCACATAGACGAAGAATGTGTGAAGTTTNATGCTCATCAATNCTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATNCTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCANNNNCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACANNNNNGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTNTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCNNCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTTGTTCAGTNTTTTATANA
  5   1   2       bld Tbd7      in                         XL109m09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCAAAGGCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAAC
  3   1   2       bld Ga18                             rxlk156c14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TNNAAANGNANCAGTGTCTATAGNAGCCTGTNNAAGGCATCTNANGNACGTTGATGCCACCATGTCCNTTATTGATATTTCCATGATGACTGGCTTTTCTCCTGANNCCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATANNTCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAANTCTCCCACATAGNCGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCANNNCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACANNNNTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTTTGACAACTATGTTATGACAATTAAGAAGGTCATCAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGTAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTNTGGCGCCAGCCAGATGGATATTCCTACATCATTGGAAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTTNTTCAGTNTTTTATATA
  5   1   2       bld Neu7      in                         XL027o06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAACAGTGTCTATAGAAGCCTGTGCAAGGCATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACAAGGCTTGCGCTCCCCGGAGTGGATTTTTGTGTACAAGG
  5   1   2       bld Ga18      in                       xlk74a06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAACAGTGTCTATAGAAGCCTGTGCAAGGATCTCAAGAACGTTGATGCCACCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGNNNNTGCnnnnnnnnTTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCNCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGNTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGNCATTAAGCAAGNNACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGNAACTGGNG
  3   1   2       bld Ga18      in                       xlk74a06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GNANCAGTGTCTATAGAANCCTGTNNANGCNTCTCAAGAACNTTGATGCCACCNTGNNNTTATNANNTTCCATGATGACTGGCTTTTCTCCTGATNCCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACNTCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGANCACTTATTCTCTACTTGGACAAANNCTNNNCATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGNTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGNANTNNCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACANNNNNGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTNTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTTGTTCAGTNTTTTANANACA
  5   1   2       bld FaBN                            IMAGE:8077100.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAGGCATCTCAAGAACGTTGATGCCCCATGTCCATTATTGATATTTCCATGATGACTGGCTTTTCTCCTGATACCGATTCCCTGGATAGGCTAATGAAGGGAGTGGACAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACACAGAGGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCATGAGAAGGAGTGTCACAACGTGAGAACGAGAT
  3   1   2       chi Tad1      ?                     IMAGE:6879279.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               NGGCTTTTTTTTTTCCCCAGGATTACCCCGAATTTCCCCTCTGGAAATAGGCGCTCCATGAAGAGGGGAGGGGGGGCCAAAATTCCCTTTTCTCTAAAATTTGGAAGGTCCACCAAAAGGGGGGCAAATGGCCAAGGGGGAACCATTTTTTCTTTTACTTGGGACAAAAGTTTCCCCCCATTGGACGAAGGAAAGGTGGGAAGTTTTATGTCCATCAATACTTTGGAAGTGGGTTTCATCCAGCCAGGTTCGGTACCTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAATTTTTACCATGTGAAGAAAGGCAGTGCCCTGTTGGCAAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCCGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATTTTCCATCTTCCCAAGCTCATCTGTGATGTTTAATTTTGTAAATGTTTTC
  3   1   2       bld Tad2      in                    IMAGE:6872022.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATTGATTTTTCCAGGATGACTGGGTTTTTTTCCCGGATACCGGATTCCCTGGATAGGCTAATGAAGGGAGGGGACAAAATACATCTCTAAATTTGAAGTCAACAAAGGAGCAAATGACAAGGGAACATTTATTCTCTACTTGGACAAAGTCTCCCACAAGGACGAAGAATGCGTGAAGTTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTGTTTCAG
  3   1   2       chi Emb9      in                    IMAGE:7976802.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTTTTGATATCCTCCAGAGCACGTTGACTGAGTTCAACTGGCCTTCATAGATCTGAACGCTTTCTGACGATCCGAAGCTAGAGGAGGGCATCTCTTAATTGAGCACAAGGCAATGCAAGGACACTATCTTTATTGACAAGTTCCACATGCGAAGATGGGAAGTTTAGCTCATCATACTTGAAGTGGTTCATCCAGCCAGCTCTGTAACTGTGTATGATTTTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGTTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTTTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGATGTTTAATTTTGTAAATGTTGTTCA
  3   1   2       bld Tad2      in                    IMAGE:6874257.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTTAATGAAGGGGGAGTGGACAAATTAATTTTTTAAATATGAAGTCAACCAAGGGAGGCAAATGACAAGGGAAACCCTTTTTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATCAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGATGTTTAATTTGGT
  3   1   2       bld Ga18      in                      xlk124a08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATNANGGNANNGGANAAATACATCTCTAANNNTGAANTCANNAANGNNGNAAATGANAAGGGAANNCTTNNTCTCTACTTGGACAAANTCTCCCACATAGNCGAAGAATGTGTGAAGTTTTANNCTCACCAATNCTTTGAAGTNGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGCTGCACTAAATTTTACCATGTGGAAGAAGGCANNNCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGCGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACANNNNNGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGGTGCAGCCCAGCGACAACTTTGACAACTATGTTATGACAATTAAGAAGGTCATAAANCAAGGCACAGATGAGGATCCTGAGGACAAGACACGTAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTAAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAATTGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTTGTTCAGTNNNNATATA
  3   1   2       bld Ga15      in                       XL492k18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACAAATACATCTCTTAAATATGAAGTCAACAAAAGGAGCAAATGACAAGGGGAACACTTATTCTNTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATGATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGT
  3   1   2       bld Ga15                               XL493m07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAATACATCTCTAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACAACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGNTGACATGAGAGTCAACAAGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGATGTT
  3   1   2       chi DMZ       out                        xl309f11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTTTCCTGGCCAATAGGTTTCTGGCAGTCTCCAAGCAGATACCTGTTAGGAAGGCCATTTGACTCCATACATGAGTTAAAAAGCTCCTGAATTGGTCCACTGACTTCCAGAAAAGGGATAAAAACAAGTAATACACCACGTCCGTGGTCTCTAGAAATATGACATACACCATTGAAAAGGGGCAGCACTTGGATGCATAGGTTAGCAATGATGCCAGCACTGGGATCCTAAGATTGATTCCAGGACAAGCACTATCTGCAAGAAAACTGTATGTTTGTCCTATGTCTGCATGGGTAAATATACTAGAGCTATCAACTTTTTAATTGTCCGTCTATATTCATTCACAGTGTACAAAGCTACTCTCACGGAGGTGCAGCCCAGCGACAACTTTGACAACTATGTTATGACAATTAAGAAGGTCATCAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGTAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAATTGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTG
  5   1   2       chi Emb4      in                    IMAGE:4957361.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACGCGTCCGTTAGTCCTATGCTCATCAATACTTCACACATTCTTCGTCTATGTGGGAGACTTTGTCCAAGTAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGTTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCT
  3   1   2       bld Ga18      in                      xlk162c16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCTAATATGAANTNNNNAANGNNGNAAATGACANGGGAANNCTTNNTCTCTACTTGGACAAANNCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATNCTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCANNNNCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACANNNNNGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGNCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTTGTTCAGTNNNTANANA
  3   1   2       bld DMZ       in                         xl222p12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAAATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACCCTTATTATCTACTTGGACAAAGTCTCCCACAAAGACGAAGAATGCGTGAAGTTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGCTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGTTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTTTGACAACTATGTTATGACAATTAAGAAGGTCATCAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGTAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGAAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTGCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGT
  3   1   2       bld Ga15      in                       XL477i07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATATGAAGTCAACAAAGGAGCAAATGACAAGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTT
  3   1   2       bld Em10      in                    IMAGE:7983243.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATATGAGTCAACAAAGAGCAAATGACAAGGAACACTTATCTTCTACTGGACAAATTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGTTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGATGTTTAATTTGTAAA
  5  -1   2       bld Emb4                            IMAGE:4971079.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACAATCATCTCTATATGAGTCACNANGAGCAATGCANGGGACACTATCTCTACTGACNAAGTCTCCACTAGACGAGAATGTGGAAGTNTATGCTCATCATACTTGAAGTGGTTCATCCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAATTGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTTGTTCAGTGTTTTATATACAGTTCCAATAAAGCATTTATTT
  3   1   2       bld DMZ       in                         xl226n24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAACAAGGAGCAAATGACAAGGGNACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGT
  3   1   2       bld DMZ       in                         xl278a06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGAGCAAATGACAAGGGAACCCTTATTATCTACTTGGACAAAGTCTCCCACAAAGACGAAGAATGCGTGAAGTTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGCTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGTTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTTTGACAACTATGTTATGACAATTAAGAAGGTCATCAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGTAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGAAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTGCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGT
  3   1   2       bld DMZ       in                         xl341o09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATGACAAGGGAACCCTTATTATCTACTTGGACAAAGTCTCCCACAAAGACGAAGAATGCGTGAAGTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGCTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGTTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTTTGACAACTATGTTATGACAATTAAGAAGGTCATCAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGTAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGAAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTGCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGT
  3   1   2       bld DMZ       in                         xl231p18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGACANGGGAACACTTATTCTCTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGT
  3   1   2       chi FaB       in                    IMAGE:8069407.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGACCATGGGAAACCTATTCTTCTACTTGGACAAAGTCTCCCACACAGAAGAAAGAATGTGTGAGTTTTACGCTCACCATTCTTTGAGTGGGTTCATCCAGCCAGCTTCTGTATCTGTGTATGACTATTATAATCCAGATAGTCGATGCACTAAGTTTTACCATGTGGAAGAAGGCAGTGCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAATTGTTTTATGCAGCAGCAAATTGAGGGTAAAATCACCGCTGAAAGTAGAATCAACATGGCTTGCGCTCCCGGGGTGGATTTTGTGTACAAGGCTACTCTCACGGAGGTGCAGCCCAGCGACAACTTTGACAACTATGTTATGACAATTAAGAAGGTCATTAAGCAAGGCACGGATGAGGATCCTGCAGACAAGACACGTAATTTTTATCAGCCATATCAAATGCCGAAAAGCTTTAGCTATGCAATTGAACCGAGATTATTTGATTTGGGGGGTTTTTTGGTGACTTTTGGTTGAAACCAGATGGATTTTCTTACATTTTTTTTTTTGGACACATGGTTGTTTTTTTGGCCCAATGAGAGGGAGTTTCAACAACGTTTTTTCCTGGATTTTTTTTTTTTTTTTTGATACAGTTTTTGTTTTTTTTTTTTTTTTTTGGTTGTTCTAGTTGTTTTTTTTTTTTTTTTTTTTTTTATTTTTTTTTTTTTTTTTTTTTTTTGTTTTGTTGTGTTTTTTAATAATTTTTTTTTTTTTTTTTTTTTTCCCCCTTTTTTTGGGGATCATTTTTTGGATTTTTTTTATTTCCTTTTTTTCTTGAAGAATTTGAGACATTTCACTTTTTGCATATACTACAAATTTTTTTTTTTATTTTTTTATTGCTATGATAATCTATTCGTT
  3   1   2       bld DMZ       out                        xl250p17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGTGAGTCTGTGACGTGTTCATATATATCGGTCACTGCAGTTATTCTGCAGCTCAGAACCTTCATTTGCTTGTTCTCTATAATCCTTTAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGGTAAGTAAAATGTCTGTTGAGTCAAAAATGAAGTTTAATGAGTCTGTGAATGCCCAAATACAAGCATTCACAAAAGAGAGGCATCATTATGTCCAGACCAACTGGAATACAATTAAAATAAACATGTCTCTTAAAACTGCCTCCATACATGCAGCAGAAGTCTGACCATACTGTTTCACACATTTATGTGACGCCCAATTGAGTATATCGCTTTGGAAAGAGATAGGACTTGTGGCCCGTTTCACTTACAAGTCTGCTGATAACCCCCATTCAATTCATTGGAATGATGTTTGTTCTTTGTAGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAANCGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATTCTGTGTGATGTTTAATTTTGTAAATGT
  3   1   2       bld DMZ       in                         xl302f24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGT
  3   1   2       bld DMZ  5g3  in                         xl313g21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCNAAATNTTTCCATCTTCCCAAGCTCATCTGTGT
  3   1   2       bld DMZ       in                         xl247f05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTACTTGGACAAAGTCTCCCACAAAGACGAAGAATGCGTGAAGTTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGCTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGTTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTTTGACAACTATGTTATGACAATTAAGAAGGTCATCAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGTAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGAAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTGCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTG
  3   1   2       bld DMZ       in                         xl230c22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTACTTGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATNATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAANTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGANGGAGNGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTNCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATG
  3   1   2       bld DMZ       in                         xl280h11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACTTGGACAAAGTCTCCCACAAAGACGAAGAATGCGTGAAGTTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGCTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGTTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTTTGACAACTATGTTATGACAATTAAGAAGGTCATCAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGTAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGAAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTGCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTT
  5   1   2       bld Li1                             IMAGE:3397708.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTTGGACAAAGTCTCCCACACAGAGGAAGAATGTGTGAAGTTTTACGCTCACCAATTCTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTATCTGTGTATGACTATTATAATCCAGATAGTCGATGCACTAAGTTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAATTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACCGCTGAAAGTAGAATCAACATGGCTTGCGCTCCCGGGGTGGATTTTGTGTACAAGGCTACTCTCACGGAGGTGCAGCCCAGCGACAACTNTGACAACTATGTTATGACAATTAAGAAGGTCATTAAGCAAGGCACGGATGAGGATCCTGCAGACAAGACACGTAATTGTATCAGCCATATCAAATGCCGAAAAGCTGTAGCTATGCAACTGAACCGAGATTATCTGATCCTGGGGGTAACTGGTGACCTCTGGCTTGAACCAGATGGATATTCCTACATCATTTGGGAGGACACATTGATTGGAGTGGTGCCGGATGAGAGGGAG
  3   1   2      seed DMZ       in                         xl324m01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGT
  3   1   2       bld Ga15      in                       XL456o10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACAAGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGATGTTTAATTTTGTAAATGT
  3   1   2       bld DMZ       in                         xl335e10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGACAAAGTCTCCCACAAAGACGAAGAATGCGTGAAGTTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGCTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGTTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTTTGACAACTATGTTATGACAATTAAGAAGGTCATCAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGTAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGAAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTGCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGT
  3   1   2       bld DMZ       in                         xl262h14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATTCTGTGTGATGTTTAATTTTGTAAATGT
  3   1   2       bld DMZ       in                         xl228o19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACAAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTGTTC
  5   1   2       chi Ga18      in                      xlk130d07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAGTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGNNNNTGCTGNNNNNATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACNNNNNNCAGCCCAGCGACAACTTTGACAACTATGTTATGACAATTAAGAAGGNCATCAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGTAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGNGACCTCTGGCGnnnnnnnnGGGTAAGNAAAATGTCTGTTGAGTCAAAAANGAAGNTTCATGAGTCTNTGAATNCCCNAATACAAGCATTCACAAAAGAGAGNNATCNNTATGTCNNGACCAACTGGAATACAATTNAAATAAACATNTCTCTTNNAAACTGCCTCC
  3   1   2       bld DMZ                                 rxl253k09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCNGGCGCCAGCCAGNTGGATATTCNTACATCATTGGGAAGGACACNTGGATGGAGTGGTGNCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGCGGATCTGTGCGANGACTTTGAGACAGTTTCTGACAACCTGGANATTNTTGGTTGTCCCAAACTGAGGAACCTAAATTCAGACCAAAATGTATCCATCNTCCCAAGCTCA
  3   1   2       bld DMZ                                 rxl257h14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAATCTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAATGTTGTTCAGTGT
  3   1   2       bld DMZ       in                         xl338b03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCCCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACAAGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGATGTTTAATTTTGTAAATGT
  5  -1   2       bld DMZ       out                        xl236g10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACATAGACGAAGAATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATT
  3   1   2       bld DMZ       in                         xl299p01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACAANGACGAAGAATGCGTGAAGTTTTACGCTCACCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGATGCACTAAGTTTTACCACGTGGAAGAAGGCAGTGCCCTGTTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAAGCTACTCTCACGGAGGTGCAGCCCAGCGACAACTTTGACAACTATGTTATGACAATTAAGAAGGTCATCAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGTAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAATTGTTTCCATCTTCCCAAGCTCATTCTGTGTGATGTTTAATTTTGTAAATGT
  3   1   2       bld Neu7      in                         XL040f21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATGTGTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGTGATGTTTAATTTTGTAAAT
  3   1   2       bld Tbd7      in                         XL092b08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGAAGTTTTATGCTCATCAATACTTTGAAGTGGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACAAGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGATGTTTAATTTTGTAAATGTTGTTCAGTGTTTTATATACAGTTCCAATAAA
  3   1   2       bld Tbd3      in                    IMAGE:3548526.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGTTTATGGTCATCAATACTTGAAGTGGGGTTTCACCCAGCAGCTTTCTGTAACTGTGTATGACTATAAAACTCCAGATAATCGTTGCATTAAATTTACCCATGGGAAAGAAGGAAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATCCCGGTGTGCAAAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAAAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTTTGACAACCTGGAGATTGTTGGTTGTCCCA
  3   1   2       bld Ga15      in                       XL476b14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATGCTCATCAATACTTGGAAGTGGGTTTCATCCAGCCAGNTTCNGTAACTGTGTANGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGGCCCTGCTGGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACAAGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGATGTTTAATTTTGTAAA
  3   1   2       bld DMZ       in                         xl271b06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TANTTTGAAGTNGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCNTGAGGACAAGACACGCAATTTTNTCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTNGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATACTGTGTGANGTTTAATTTTGTAAATCT
  3   1   2       bld Neu7      in                         XL027o06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACAAGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGATGTTTAATTTTGTAAATGTTGTTCAGTGTTTTATATACAGTTCCAATAA
  3   1   2       bld Neu7      in                         XL021p24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGTTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACAAGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATCTGTGATGTTTAATTTTGTAAATGTTGTTCAGTGTTTTATATACAGTTCCAATAAA
  3   1   2       bld Tbd7                                 XL092d13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTTCCCAAGCTCATACTGTGATGTTTAATTTTGTAAATGTTGTTCAGTGTTTTATATACAGTTCCNATAAAGCATT
  3   1   2       bld Neu7      in                         XL045d07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGTTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGCTGGGCAGGATTTGCCAAGGAGATATATGCCGATGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTATGACAACTATGTAATGACAATTAAGAAGGTCATTAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGCAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGGAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACGAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCTNCTTCCCAAGCTCATNCTGTGTGATGTTTAATTTTGTAAATG
  3   1   2       bld DMZ       in                         xl271a04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCATCCAGCCAGCTTCTGTAACTGTGTATGACTATTATACTCCAGATAATCGCTGCACTAAATTTTACCATGTGGAAGAAGGCAGTGCCCTGTTGGGCAGGATTTGCCAAGGAGATATATGCCGGTGTGCAGAAGAGAACTGTTTCATGCAGCAGCAAATTGAGGGTAAAATCACTGCTGACATGAGAGTCAACATGGCTTGCGCTCCCGGAGTGGATTTTGTGTACAAGGCTACTCTCACGGAGTTGCAGCCCAGCGACAACTTTGACAACTATGTTATGACAATTAAGAAGGTCATCAAGCAAGGCACAGATGAGGATCCTGAGGACAAGACACGTAATTTTATCAGCCATATCAAATGCCGAAAAGCTTTAAATATGCAGCTGAACCGAGATTATCTGATTTGGGGGGTAACTGGTGACCTCTGGCGCCAGCCAGATGGATATTCCTACATCATTGGAAAGGACACATGGATGGAGTGGTGGCCCAATGAGAGGGAGTGTCAACAACGTGAGAACCAGGATCTCTGCGATGACTTTGAGACAGTTTCTGACAACCTGGAGATTGTTGGTTGTCCCAACTGAGGAACCTAAATTCAGACCAAAATGTTTCCATCTGCCCAAGCTCATTCTGTGTGATGTTTAATTTTGTAAATGT
  3   1   2       bld DMZ       in                         xl236p12.3p