Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 92%

 1012837250 Xl3.1-XL519d23ex.5.5 - 92 ESTs
                                                                       -20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xl3.1-XL519d23ex.5.5                     AGACCCCTCCTCTTGCTTCGTGTCGATCACGTGGTCACGCTTCTACTGGCGTAGTCAAAGCCAAGCAGGAAGTAGCTTCTATCGTGAACCGGAAGCGGAACTGACCTTTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTAAA
                                                  Xl3.1-CHK-1012722160                           CTCCTCTTGCTTCGTGTCGATCACGTGGTCACGCTTCTACTGGCGTAGTCAAAGCCAAGCAGGAAGTAGCTTCTATCGTGAACCGGAAGCGGAACTGACCTTTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTAAAAAAAAA
                                                      consensus depths                          2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     7     9    15    16    24    21    29    31    39    34    42    41    47    62    67    69    71    69    73    71    75    71    76    74    77    72    77    69    77    60    78    75    78    69    79    76    80    77    80    76    80    78    80    77    80    80    81    81    81    79    81    79    81    82    83    82    83    82    83    82    83    78    84    84    84    82    84    78    84    66    84    82    82    59    82    62    82    61    81    61    79    60    78    60    81    55    82    61    85    64    80    54    74    61    70    51    67    57    67    47    67    51    67    42    55    31    38    29    36    25    31    17    24
  5   1   2       e50                               Xl3.1-XL519d23ex.5                     AGACCCCTCCTCTTGCTTCGTGTCGATCACGTGGTCACGCTTCTACTGGCGTAGTCAAAGCCAAGCAGGAAGTAGCTTCTATCGTGAACCGGAAGCGGAACTGACCTTTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTAAA
  5   1   2       e50                               Xl3.1-XL485p11ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTTTTTTTTGCCCCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTGAGCCTACATTCTACAGTATTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCC
                                                                   SNP                                                                                                                                                                                                         --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------G--A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---A--------
                                               BLH ATG     171     614                     
                                               BLH MIN     171      76                     
                                               BLH MPR      96      76                     
                                               BLH OVR     171      79                     
                                               CDS MIN     171      36                     
                                               EST CLI     158      36                     
                                               ORF LNG     171       1                     
                                                                                                                                                                                           PROTEIN --- Os ---- 2e-046     NP_001055168.1 Os05g0314100 [Oryza sativa (japonica cultivar-group)] ==========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PROTEIN === Ce ==== 4e-049     NP_506004.1 small nuclear ribonucleoprotein, small nuclear ribonucleoprotein SNR-4 (13.3 kD)(snr-4) [Caenorhabditis elegans] ==========================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PREDICTED = Cf ==== 3e-053     XP_539112.1 PREDICTED: similar to small nuclear ribonucleoprotein polypeptide D2 [Canis familiaris] ===============================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                         PROTEIN === Ag ==== 6e-054     XP_318388.2 AGAP003936-PA [Anopheles gambiae str. PEST] =========================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                         PROTEIN === Dm ==== 7e-054     NP_649645.1 CG1249-PA [Drosophila melanogaster] ================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PREDICTED = Sp ==== 7e-057     XP_001177104.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PREDICTED = Dr ==== 4e-062     XP_001918510.1 PREDICTED: hypothetical protein [Danio rerio] ======================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 2e-062     NP_808210.1 small nuclear ribonucleoprotein polypeptide D2; snRNP core protein D2 [Homosapiens] ===================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PREDICTED = Bt ==== 1e-062     NP_001029648.1 hypothetical protein LOC514932 [Bos taurus] ========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 1e-062     NP_081219.1 small nuclear ribonucleoprotein D2 [Mus musculus] =====================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PROTEIN === Xt ==== 1e-062     AAI61312.1 MGC89748 protein [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 4e-063     AAH88924.1 Unknown (protein for MGC:85085) [Xenopus laevis] =======================================================================================================================================================================================================================================================================
                                                  Xl3.1-XL519d23ex.5.5                                                                        TAG------------------TAG---------TGA------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------TGA------------------TAA---------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------TAATAA
                                                                   ORF                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2       e50                               Xl3.1-XL519d23ex.5                     AGACCCCTCCTCTTGCTTCGTGTCGATCACGTGGTCACGCTTCTACTGGCGTAGTCAAAGCCAAGCAGGAAGTAGCTTCTATCGTGAACCGGAAGCGGAACTGACCTTTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTAAA
                                                  Xl3.1-CHK-1012685762                           CTCCTCTTGCTTCGTGTCGATCACGTGGTCACGCTTCTACTGGCGTAGTCAAAGCCAAGCAGGAAGTAGCTTCTATCGTGAACCGGAAGCGGAACTGACCTTTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTAAAAAAAAA
  5   1   2       bld Egg3                            IMAGE:6869737.5p AATTCCCGGGGCCGCAGAGCAGACCCCTCCTCTTGCTTCGTGTCGATCACGTGGTCACGCTTCTACTGGCGTAGTCAAAGCCAAGCAGGAAGTAGCTTCTATCGTGAACCGGAAGCGGAACTGACCTTTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAACCTACATTCTACGGTGTTTCTTTAAAAACTTTTATAACAAGATCTCTCTGTCCCACCGTGATTTTTTTCTAATAAAGAAAAGTTGTTTCGaaaaaaaaaaaaaaaaaaaaCGGCCCGCCCCCCGCGGGGGGAGCTCCCGCCTTTTGGTTCCCTTTGGAGGGAGGGGTAATTTTCCAACCTTTGCCGGTAATCCATGGGGCATAAGCTGGGTTCCCCGGGGGGGAAATTGGGGCATTCCCCCCA
  5   1   2       bld Egg4 5g3  in                    IMAGE:3744026.5p                     AGACCCCTCCTCTTGCTTCGTGTCGATCACGTGGTCACGCTTCTACTGGCGTAGTCAAAGCCAAGCAGGAAGTAGCTTCTATCGTGAACCGGAAGCGGAACTGACCTTTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGATAATGTCAAAGACATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTGCAAGATGTTCCTCCGTGGAGACAGTGTCATTGNTGTTGCTCCGAATCCACTACTTGCTGGGAAG
  3   1   2       chi DMZ       in                         xl341a16.3p                                                                                                    CTGGCGCGCTCAGGGTGAATGTACCTTTGTAGTAGGGAATTGTGCGCGAACAGAATCTGAATCCGCTAATAGAAAACGCGGTGTCCTGTAATTTGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACNCAGGGCCNCTGTCTGTGCTTACNCNGTCTGTGAAGAACAACACNCAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTNTTCGGAATCCNCTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCNCCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCT
  5   1   2       chi DMZ       in                         xl341a16.5p                                                                                                    CTGGCGCGCTCAGGGTGAATGTACCTTTGTAGTAGGGAATTGTGCGCGAACAGAATCTGAATCCGCTAATAGAAAACGCGGTGTCCTGTAATTTGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTaaaaaaaaaa
  5   1   2       bld Ga15 5x3                           XL490h08ex.5p                                                                                                        CGNTCCGAGCGGAACTGNACCCTTTCACAGGAAGCGTTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGANCCCTTTAAATTGTCAAAAGGATTGTGAAGTTCACCCTACATTCTACAGNGTTTCTTTAAAACCTTTTATAACAA
  5   1   2       bld Ga15 5g3  in                       XL485p11ex.5p                                                                                                         TGAACCGGAAGCGGAACTGACCTCTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAACCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGTTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCGCTACTTGCTGGAAAGTGATAGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgcccccccccccAAAAAANCCCTTTAANTTGT
  3   1   2       bld DMZ  5g3  in                         xl239j14.3p                                                                                                         ACGAGGGGAAGCGGAACTGACCTTTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGNCAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTNACACAGGGCCNCTGTNTGTGNTTACACAGTCTGTGAAGAACAACACNCAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATNTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTNTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCNCCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACCAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCT
  5   1   2       bld Ga15 5x3                           XL515d24ex.5p                                                                                                             CCGGAAGCGGAACTGACCTTTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAANAACCCTTTAAATTGTCAAAAGGATTGTGAAGTTCANCCTACNTTCTACAGNGTTTCTTTAAAACCTTTTATAACAANATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTaaaaaaaaaa
  5   1   2       bld DMZ  5g3  in                         xl239j14.5p                                                                                                               GGAAGCGGAACTGACCTTTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTAA
  5   1   2       bld Ga15 5g3  in                       XL439o02ex.5p                                                                                                                GAAGCGGAACTGACCTTTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACNAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTANATTGTCAAAAGGATTGTGAAGTTCANCCTACNTTCTACAGTGTTTCTTTAAAACCTTTTATAACAANATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAANCTaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL439o02ex.3p                                                                                                                GAAGNGGAACTGACCTTTCAAAGGAAGCGTTGTACNCGCCGGGAAAANGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACNCAGGGCCNCTGTCTGTGCTTACNCAGTCTGNGAAGAACAACACNCAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACNCTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTNTTCGGAATCCNCTACTTGCTGGAAAGTGATACTGTNTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGNGTCAAATAGTTGCGTTACCAAGGATCNCCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTTCCCACCA
  5   1   2       bld Ga15 5x3                           XL489h08ex.5p                                                                                                                  AGCGGAACTGACCTTTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTANATTGTCAAAAGGATTGTGAAGTTCANCCTACNTTCTACAGNGTTTCTTTAAAACCTTTTATAACAANATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAANTTTGTTAAAACTaaaaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl269l01.3p                                                                                                                  GCNCGAGGGACCTTTTCAAAGGAAGCGTTGTNCACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGNGAAGAGGAGGAGTTTAACACAGGGCCACTGTNTGTGCTTACNCNGTTTGTGAAGAACAACACNCAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTNCTGGAAAATGTCAAAGAAATGTGGNCTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATNTCCAAGATGTTCCTCCGTGGAGACNGTGTCATTGTTGTTNTTCGGAATCCNCTACTTGCTGGAAAGTGATACTGTNTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAANCAAGATCT
  5   1   2       bld DMZ  5x3                             xl315j09.5p                                                                                                                   CCTCGTGCCGAATCGGCACGAGGAGCGTTGTACACGCCGGGAAAACGTGAGAACAGAAAGACAAGGCAAAAAGAAAGATGAGTCTCCTTAATAAACCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCGCTACTTGCTGGAAAGTGATAGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTGccccccccccccAAAAAA
  3  -1   2       chi Bla2                            IMAGE:7296393.3p                                                                                                                    GCGGAACTGACCTCTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAACAGAAAGACAAGGCAAAAAGAAAGATGAGTCTCCTTAATAAACCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCGCTACTTGCTGGAAAGTGATAGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTCTGCCCCCCCCCCCCCCCGAAAGACCCTTTAGATTGCAAAGGATTGTGAATTGAGCCTACTTCTACAGTATTTCTTTAAACTTTTATAAAAGTCTCTCTGCCCACCTGATTTTTCTATAANGAAATTGTAAACATAAAAAAAAAAAAAAAACTCGAGGGGGCCGTACCATCGCTAATGACGATACATCTGCGCGTTAACGCTGTGGAACTGGTACATATCTGACACCTCCCTGGAGAAGCACTCTCATCCAGAGTATATACAT
  3   1   2       bld DMZ  5g3  in                         xl269n01.3p                                                                                                                      CGAGGGACCTTTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTNTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACNCTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTNTTCGGAATCCNCTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCNTGGTGTCAAATAGTTGCGTTACCAAGGATCNCCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCAC
  5   1   2       bld Ga15 5g3  in                       XL423g14ex.5p                                                                                                                       GAACTGACCTCTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAACAGAAAGACAAGGCAAAAAGAAAGATGAGTCTCCTTAATAAACCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCGCTACTTGCTGGAAAGTGATAGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTGccccccccccccAAAAAA
  5   1   2       bld DMZ  5g3  in                         xl269l01.5p                                                                                                                          GACCTTTCAAAGGAAGCGTTGTACACGCCGGGCAAAACGTGAGAAGGGAAAGACAAGGCANAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCANAAGCGAGAAGAGGAGGAGTTTANCACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAANAGTGNAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCANATGTCttttttttttcngccccccccGAAAGANCCCTTTA
  5   1   2       bld DMZ  5g3  in                         xl294e11.5p                                                                                                                           GACCTTTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCNNAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTAGATTGNCAAAAGGATTGTGAAGTTCAGCCTACNTTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACT
  5   1   2      seed DMZ  5g3  in                         xl269n01.5p                                                                                                                           GACCTTTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTaaaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl294e11.3p                                                                                                                           GACCTTTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACNCAGGGCCNCTGTCTGTGCTTACNCNGTCTGTGAAGAACAACNCNCAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATNTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTNTTCGGAATCCNCTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCNCCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACCAGTGTTTCTTTAAAACCTTTTATAACAAGATCTC
  3   1   2       bld Ga12 5g3  in                         XL215g18.3p                                                                                                                             GCTTTCAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTNTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACNCAGGGCCNCTGTNTGTGCTTACACAGTNTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATNTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTNTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTNTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTNTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTCTAATAAAGAA
  5   1   2       bld Ga12 5g3  in                         XL215g18.5p                                                                                                                               CTTTCAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAANAACCCTTTAAATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGNGTTTCTTTAAAACCTTTTATAACAANATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTA
  5   1   2       bld Egg1 5x3                           PBX0115F04.5p                                                                                                                                 GGCACGAGGGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgcccccccccGAAAGAACCCTTTAGATTGTCAAAAGGA
  5   1   2       bld Ga15 5x3                           XL513p22ex.5p                                                                                                                                  CAAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAANAACCCTTTAAATTGTCAAAAGGATTGTGAAGTTCANCCTACATTCTACAGNGTTTCTTTAAAACCTTTTNTAACAAGATCTCTCTGTCCCNCCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTaaaaaaaaaa
  5   1   2       bld Egg1 5x3                           PBX0107H05.5p                                                                                                                                   AACGAGGGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgcccccccccGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGT
  5   1   2       bld Bla1 5g3  in                    IMAGE:3379745.5p                                                                                                                                   AAAGGAAGCGTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTNTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTNTAGAT
  5   1   2       bld Egg1 5x3                           PBX0080F12.5p                                                                                                                                         TCGGAACGAGGCGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGGTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGGCTAATCTCTTTATAACTTCCTTACGAATACTAAC
  3   1   2       bld DMZ                                 rxl252o02.3p                                                                                                                                            GTTGTACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACNCAGGGCCNCTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTNTTCGGAATCCNCTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCNCCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACCAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCT
  5   1   2       bld DMZ  5x3                             xl277b15.5p                                                                                                                                                TACACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAACCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCGCTACTTGCTGGAAAGTGATAGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTGccccccccccccAAAAAA
  5   1   2       bld Ga15 5x3                           XL475o09ex.5p                                                                                                                                                  CACGCCGGGAAAACGTGAGAAGGGAAAGACNAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAACCCNAAACTGAGATGACGCCCGAAGAGCTCCNAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCGCTACTTGCTGGAAAGTGATAGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTGcccccccccccAAAAAANCCNTTTAAAT
  5   1   2       bld Ga15 5g3  in                       XL519d23ex.5p                                                                                                                                                  CACGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTANATTGTCAAAAGGATTGTGAAGTTCANCCTACATTCTACAGNGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTaaaaaaaaaa
  5   1   2       bld Ga15 5x3                           XL437i05ex.5p                                                                                                                                                    CGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTANATTGTCAAAAGGATTGTGAAGTTCANCCTACNTTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL452l14ex.5p                                                                                                                                                    CGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCNAAACTGAGATGACGCCCGAAGAGCTCCNAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTANATTGTCAAAAGGATTGTGAAGTTCANCCTACNTTCTACAGNGTTTCTTTAAAACCTTTTATAACAANATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTNNNANNNNNA
  3   1   2       bld Ga15 5g3  in                       XL452l14ex.3p                                                                                                                                                    CGCCGGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACNCAGGGCCNCTGTCTGTGCTTACNCAGTCTGTGAAGAACAACNCNCAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACNCTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGNCCGATATATNTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTNTTCGGAATCCNCTACTTGCTGGAAAGTGATACTGTNTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCNCCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTTCCCACCA
  5   1   2       bld DMZ  5x3                             xl262o14.5p                                                                                                                                                      ATCGATTCGCGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAACCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTATACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCGCTACTTGCTGGAAAGTGATAGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTGcccccccccccNAAANANCCCTTTAAATTGNCAAANGGAT
  5   1   2       bld DMZ  5x3                             xl250b10.5p                                                                                                                                                       TCGATTCGCGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAACCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTATACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCGCTACTTGCTGGAAAGTGATAGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTGcccccccccccNAAANANCCCTTTAAATTGNCAAANGGATNG
  3   1   2       bld Ga12 5g3  in                         XL181p10.3p                                                                                                                                                        GGGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACNCAGGGCCNCTGTNTGTGCTTACACAGTNTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATNTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTNTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTNTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTNTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGA
  5   1   2       bld Ga12 5g3  in                         XL181p10.5p                                                                                                                                                         GGAAAACGTGAGAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAANAACCCTTTAAATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAAT
  5   1   2       bld Neu7 5x3                             XL008c07.5p                                                                                                                                                          AAAACGTGAGNAAGGGAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAACCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCGCTACTTGCTGGAAAGTGATAGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTGcccccccccccGAA
  5   1   2       bld Gas4 5x3                        IMAGE:3421203.5p                                                                                                                                                           ATCGAATCCCCGGGGGGGAAAGACAGGCAAAAAAGAAAGAGAGTCTCCTCTAATAAGCCCAAAACTGAGAGACGCCCGAAGGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAAGATCACCAAATGTCttttttttttctgcccccccccG
  5   1   2       bld Ga12 5g3  in                         XL178i24.5p                                                                                                                                                           GAAAACGTGAGAACAGAAAGACAAGGCAAAAAGAAAGATGAGTCTCCTTAATAAACCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCGCTACTTGCTGGAAAGTGATAGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTGccccccccccccccAAA
  5   1   2       bld Ga15 5g3  in                       XL406e08ex.5p                                                                                                                                                                         GAAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTANATTGTCAAAAGGATTGTGAAGTTCANCCTACNTTCTACAGNGTTTCTTTAAAACCTTTTATAACAANATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL406e08ex.3p                                                                                                                                                                         GAAAGACAAGGCAAAAAAGAAAGATGAGTNTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACNCAGGGCCNCTGTCTGTGCTTACNCAGTCTGTGAAGAACAACNCNCAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACNCTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGNCCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTNTTCGGAATCCNCTACTTGCTGGAAAGTGATACTGTNTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCNCCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTC
  5   1   2       bld Ga18 5g3  in                        xlk3i23ex.5p                                                                                                                                                                         GAAAGANAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGNAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGNTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTNaaaaaaaaa
  5   1   2       bld Ga18 5x3                          xlk140i21ex.5p                                                                                                                                                                          AAAGACAAGGCAAAAAAGAAAGATGAGTCTCCTTAATAAACCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGNAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCGCTACTTGCTGGAAAGTGATAGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgcccccccccc
  3   1   2       bld Ga18 5g3  in                        xlk3i23ex.3p                                                                                                                                                                             GANAAGGNAAAAAAGAAAGATGANTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTNCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAANCCTTTTATAACAAGTCTCTNNNNNCNCCATG
  5   1   2       bld Emb4 5x3                        IMAGE:4680292.5p                                                                                                                                                                                   GGCAAAAAGAATGATGAGTCTCCTTAATAAACCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCGCTACTTGCTGGAAAGTGATAGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTCTGcccccccccccc
  5   1   2       bld DMZ  5x3                             xl317k05.5p                                                                                                                                                                                   GGCAAAAAGAAAGATGAGTCTCCTTAATAAACCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCGCTACTTGCTGGAAAGTGATAGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTGccccccccccccNAAAAA
  5   1   2       bld Ga15 5x3                           XL424m02ex.5p                                                                                                                                                                                    CNANAAAGAAAGATGAGTCTCCTTAATAAGCCCANAACTGANATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACNCAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACNAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCNNGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTANTCTCTTTATAACTTCCTTACNAATACTAACCATGGTGTCNNATAGTTGCGTTACCAAGGATCACCNNATGTCttttttttttctgccccccccT
  5   1   2       bld Ga15 5x3                           XL443h06ex.5p                                                                                                                                                                                    CAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTANATTGTCAAAAGGATTGTGAAGTTCAGCCTACNTTCTACAGNGTTTCTTTAAAACCTTTTATAACAANATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTaaaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl275e08.3p                                                                                                                                                                                    CAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACNCAGGGCCNCTGTCTGTGCTTACNCNGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTNTTCGGAATCCNCTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCNCCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACCAAGAT
  5   1   2       bld DMZ  5g3  in                         xl280d14.5p                                                                                                                                                                                    CAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTANATTGTCAAAAGGATTGTGAAGTTCAGCCTACNTTCTACAGNGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTaaaaaaaaaa
  5   1   2       bld DMZ  5g3  in                         xl275e08.5p                                                                                                                                                                                    CAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTaaaaaaaaaa
  5   1   2       bld DMZ  5g3  in                         xl246p11.5p                                                                                                                                                                                    CAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTANATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTaaaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl246p11.3p                                                                                                                                                                                    CAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCNCTGTCTGTGCTTACACNGTCTGTGAAGAACAACACNCAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTNTTCGGAATCCNCTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCNTGGTGTCAAATAGTTGCGTTACCAAGGATCNCCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACCAGTGTTTCTTTAAAACCTTTTATAACCAAGATCTC
  3   1   2       bld DMZ  5g3  in                         xl280d14.3p                                                                                                                                                                                    CAAAAAAGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACNCAGGGCCNCTGTCTGTGCTTACNCNGTCTGTGAAGAACAACACNCAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACNCTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTNTTCGGAATCCNCTACTTGCTGGAAAGTGATACTGTNTAATCTCTTTATAACTTCCTTACAAATACTAACCNTGGTGTCAAATAGTTGCGTTACCAAGGATCNCCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACCAAGATCTC
  5   1   2       bld Emb1 5x3                        IMAGE:3401447.5p                                                                                                                                                                                     CAAAAAGAAAGATGAGTCTCCTTAATAAACCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGATCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCGCTACTTGCTGGAAAGTGATAGTCTAATCTCTNTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGT
  3   1   2       bld DMZ  5g3  in                         xl287m07.3p                                                                                                                                                                                          AGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACNCAGGGCCNCTGTCTGTGCTTACNCNGTCTGTGAAGAACAACACNCAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACNCTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATNTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTNTTCGGAATCCNCTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCNCCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCT
  3   1   2       bld DMZ  5g3  in                         xl289n01.3p                                                                                                                                                                                          AGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACNCAGGGCCNCTGTCTGTGCTTACNCNGTCTGTGAAGAACAACNCNCAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACNCTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTNTTCGGAATCCNCTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCNCCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCT
  5   1   2       bld DMZ  5g3  in                         xl305b11.5p                                                                                                                                                                                          AGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTANATTGTCAAAAGGATTGTGAAGTTCANCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTaaaaaaaaaa
  5   1   2       bld DMZ  5g3  in                         xl289n01.5p                                                                                                                                                                                          AGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGNGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTaaaaaaaaaa
  5   1   2       bld DMZ  5g3  in                         xl287m07.5p                                                                                                                                                                                          AGAAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTANATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTaaaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl305b11.3p                                                                                                                                                                                          AGAAAGATGAGTNTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCNCTGTCTGTGCTTACACAGTCTGTGAAGAACAACACNCAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATNTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTNTTCGGAATCCNCTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCNCCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACCAAGATCT
  5   1   2       bld Tbd5 5g3  in                    IMAGE:3580557.5p                                                                                                                                                                                           GAAAGATGAGTCTCCTTAATAAACCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCGCTACTTGCTGGAAAGTGATAGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCtttttttttttctgccccccccccGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTGAGCCTACATTCTACAGTATTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTGTTTTCTAATAAAGAAAATT
  5   1   2       bld Ga18 5g3  in                      xlk109l04ex.5p                                                                                                                                                                                            AAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGNAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGNTAAAACTaaaaaaaaaa
  3   1   2       bld Ga18 5g3  in                      xlk109l04ex.3p                                                                                                                                                                                            AAAGATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAANCCTTTTATAACAAGTCTCTNNNNNCNCCATG
  3   1   2       bld Bla1 5g3  in                    IMAGE:3379745.3p                                                                                                                                                                                                ATGAGTCTCTTTAATAAGCCCAAAACTGAGATGACGCCGAAAGAGCTCCAAAAGCGAGAAGAGAAGGAGTTTAACACAGGGCCACTGTCTGTGCTACCCCAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACANAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAAT
  3   1   2       bld Egg4 5g3  in                    IMAGE:3744026.3p                                                                                                                                                                                                ATGAGTCTCCTTAATAAGCCCAAAACTGAGATGACGCCGAAAGAGCTCCAAAAGCGAGAAAAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTTTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTGTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCATGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAAA
  5   1   2       bld Ga15      in                       XL463e10ex.5p                                                                                                                                                                                                 TGAGTCTCCTTAATAAACCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCGCTACTTGCTGGAAAGTGATAGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgcccccccccccNAAAAAACCCTTTAAATTGTCAAANGG
  5   1   2       bld Egg3                            IMAGE:3378736.5p                                                                                                                                                                                                  GAGTCTCCTTAATAAACCCAAAACTGAGATGACACCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTGTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGAGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGACCCTAAGAGTGGAAAGGGTAAAAAGAAGATCAGACCAGTGAACAAAGACCGATATATCTGCAAGATGTACCTCCGTGGAGACAGTGTCATTGTTGATCTGCGGAATGCGCTACTGGCTGGA
  5   1   2       bld Ga14                              Ga14-p12g12.5p                                                                                                                                                                                                           AATANGCCAAAACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGNAAGAACAACACACAAGTCCTGATCAACTGTNAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACA
  3   1   2       bld Ga15 5g3  in                       XL519d23ex.3p                                                                                                                                                                                                             AAGCCCAANATCGGAGNNGACGCCCGAAGAGCTCCNAAAGCGAGAAGAGGNGGAGTTTAACNCAGGGCCNCTGTCTGTGNTTACNCAGNCNGTGAAGAACAACNCNCAAGTCCTGATCAAGNTGTAGGNATAACNAAAAGTTGNTGGGCAGAGTGAAAGCCTTTGACAGACNCTGTAACATGGTNCTGGAAAATGTCAAAGAAATGTGGNCTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGNCAGTGTCATTGTTGTTTTTCGGAATCCNCTACTTGCTGGAAAGTGATACTGTNTAATGTNTTTATAACTTCCTTACAAATNCTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCNCCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTANCAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCA
  5   1   2       bld Egg1                               PBX0088E11.5p                                                                                                                                                                                                                       AACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgcccccccccGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATC
  5   1   2       bld Egg1                               PBX0098H12.5p                                                                                                                                                                                                                       AACTGAGATGACGCCCGAAGAGCTCCAAAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCACTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCtttttttttttctgcccccccccGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTT
  3   1   2       bld Ga15      in                       XL449d08ex.3p                                                                                                                                                                                                                                             CTCCAAAANCGAGAAGAGGAGGAGTTTAACNCAGGGCCCCTGTCTGNGCTTACACAGTCTGTGAAGAACNACCCNCAAGTCCNGATCANCTGTAGGAATAACAAAAAGTTTCTGGGCAGAGNGAAAGCCTTTGACAGACCCTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTNGGAATCCACTACTTGCTGGAAAGTGATACTGTNTAATNTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCNCCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCA
  5   1   2       bld Ga15      in                       XL449d08ex.5p                                                                                                                                                                                                                                                  AAAGCGAGAAGAGGAGGAGTTTAACACAGGGCCNCTGTCTGTGCTTACACAGTCTGTGAAGAACAACACACAAGTCCTGATCNACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTAAATTGTCAAAAGGATTGTGAAGTTCANCCTACNTTCTACAGNGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAA
  3   1   2       bld Ga15      in                       XL449j18ex.3p                                                                                                                                                                                                                                                                                             CTTACNCAGTNTGNGAAGAACAACNCNCAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGNCACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGNCTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTNTTCGGAATCCNCTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCNCCAAATGTNTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTTCCCAC
  5   1   2       bld DMZ                                  xl324j09.5p                                                                                                                                                                                                                                                                                                                ACAACACACAANTCCTGATCNACTGTAGGANNAACAAAAAGTTGCTGGNCANAGTGAAAGCCTTTGACAGACACTGTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAANTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCGCTACTTGCTGGAAAGTGATAGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGT
  5   1   2       bld Ga15                               XL429p13ex.5p                                                                                                                                                                                                                                                                                                                       CAAGTCCTGATCAACTGTAGGAATAACAAAAAGTTGCTGGGCAGAGTGAAAGCCTTTGACAGACACTGCTAACATGGTACTGGAAAATGTCAAAGAAATGTGGACTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCttttttttttctgccccccccGAAAGAACCCTTTANATTGTCAAAAGGATTGTGAAGTTCANCCTACATTCTACAGNGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTaaaaaaaaaa
  3   1   2       bld Tbd5 5g3  in                    IMAGE:3580557.3p                                                                                                                                                                                                                                                                                                                                                                                       CATTGCCCATGGGTACTGGAAAATGTCAAAGAAATTTGGCCTGAAGTCCCTAAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGACCGATATATTTCCAAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCGCTACTTGCTGGAAAGTGATAGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTTCTGCCCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTGAGCCTACATTCTACAGTATTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACAAAAAA
  3   1   2       bld DMZ                                 rxl253o02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                          TAGAGTGGAAAGGGTAAAAAGAAGTCCAAACCAGTGAACAAAGNCCGATATATCTCCAAGATGTTCCTCCGTGGAGACAGTGTCNTTGTTGTTNTTCGGNATCCNNTNCTTGNTGGAAAGTGANACNGTCTAATCTCTTNATAACTTCCTTACAAATACTAACCNTGGTGTCAAATAGTTGCGTTNCCAAGGNTCNCCAAANGTCTTTTTTTNTTCTGCCCCCCCCGAAAGAACCCTTTNGANTGTCAAAAGGATTGTGAAGTTCAGCCTNCATTCTATCAGTGTTTCTNTAAAACCTTTTATAACAAGATCTC
  3   1   2       bld Egg6                            IMAGE:4433218.3p                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAAAGGGGTTAAAAAGAAGTCCCNAACCAGTGACAAAAGACCGATATATCTCCAAAATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCAAATAGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCA
  5   1   2       bld Ga15      in                       XL449j18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATATATCTCCCAGATGTTCCTCCGTGGAGACAGTGTCATTGTTGTTCTTCGGAATCCACTACTTGCTGGAAAGTGATACTGTCTAATCTCTTTATAACTTCCTTACAAATACTAACCATGGTGTCCAAATAGTTGCGTTACCAAG
  3   1   2       bld Gas4                            IMAGE:3421567.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTTGCGTTACCAAGGATCACCAAATGTCTTTTTTTTTCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAA
  5  -1   2       bld Ga18                               xlk64d18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGCCCtttttttttCTGCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTCAGCCTACATTCTACAGTGTTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATTTTTTTCTAATAAAGAAAATTTGTTAAAACTAAA
  5   1   2       e50                               Xl3.1-XL485p11ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTTTTTTTTGCCCCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTGAGCCTACATTCTACAGTATTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCC
                                                  Xl3.1-CHK-1012701941                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTTTTGCCCCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTGAGCCTACATTCTACAGTATTTCTTTAAAACCTTTTATAACAAGATCTCTC
  3   1   2       bld Ga15                               XL464e10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GNTGGGNTTCCCAGGGTCCCCNAAAGTTTTTTTTTTTTTTGCCCCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTGAGCCTACATTNTACAGTATTTCTTTAAAACCTTTTATAACAAGATCT
  3   1   2       bld Ga15 5g3  in                       XL423g14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGTTCCCANGGNNCCCCAAANTTTTTTTTTTTTTTnCCCCCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTGAGCCTACATTCTACAGTATTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCATGATT
  3   1   2      skin Ga15                               XL452g05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGNGTTTCCNAGGNTCCCCNAANGTTTTTTTTTTTnTGCCCCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTGAGCCTACATTCTACAGTATTTCTTTAAAACCTTTTATAACAAGATCTCTCTT
  3   1   2      seed Ga15 5g3  in                       XL485p11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCCNAAAGTTTTTTTTTTTTTTGCCCCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTGAGCCTACATTCTACAGTATTTCTTTAAAACCTTTTATAACAAGATCTCTCTGTCCCACCA
  3   1   2       bld Ga15      in                       XL463e10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAGTTTTTTTTTTTTTTGCCCCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTGAGCCTACATTCTACAGTATTTCTTTAAAACCTTTTATAACAAGATCTCTC
  3   1   2       bld Ga12 5g3  in                         XL178i24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTTTTTTTTTGnCCCCCCCCCCCCCGAAAGAACCCTTTAGATTGTCAAAAGGATTGTGAAGTTGAGCCTACATTCTACAGTATTTCTTTAAAACCTTTTANAACAAGATGCTGCTACTGTCCCACCANAATTTTTTTCTAATAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)