Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8531597.3.5                   612 PI      76       3487     5862                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:6879463.3.5                    50 PI      73       3990     4821                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:8740747.5.5                    36 PI      75       4089     5812                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:8535495.5.5                    32 PI      76       4656     5812                (no blast hit)
     5   0.0    0Xl3.1-IMAGE:4408919.3                      28 PI      73       2517     3320                (no blast hit)
     6   0.0    0Xl3.1-IMAGE:6879751.3                      19 PI      87       4486     5862                (no blast hit)
     7   0.0    0Xl3.1-IMAGE:6880452.3                      15 PI      74       5128     5855                (no blast hit)
     8   0.0    0Xl3.1-IMAGE:8741070.5                       9 PI      75       4554     5863                myosin, heavy polypeptide 13, skeletal muscle [Xenopus tropicalis]
     9   0.0    0Xl3.1-IMAGE:4408827.5                       7 PI      83       1464     1687                hypothetical protein LOC432231 [Xenopus laevis]
    10   0.0    0Xl3.1-IMAGE:8533649.5                       5 PI      80       2892     3619                (no blast hit)
    11   0.0    0Xl3.1-IMAGE:4408506.3                       5 PI      77       2523     3278                hypothetical protein LOC432141 [Xenopus laevis]
    12   0.0    0Xl3.1-IMAGE:4409007.5                       4 PI      84       1376     1573                hypothetical protein LOC432231 [Xenopus laevis]
    13   0.0    0Xl3.1-IMAGE:6874571.5                       4 PI      82        594     1947                (no blast hit)
    14   0.0    0Xl3.1-IMAGE:8641590.3                       4 PI      82       5213     5847                (no blast hit)
    15   0.0    0Xl3.1-IMAGE:8741537.5                       4 PI      73       4395     5236                (no blast hit)
    16   0.0    0Xl3.1-IMAGE:6876485.5                       3 PI      78       3978     4789                (no blast hit)
    17   0.0    0Xl3.1-IMAGE:8743343.5                       3 PI      75       4655     5470                (no blast hit)
    18   0.0    0Xl3.1-IMAGE:8640405.3                       2 PI      78       5231     5847                myosin, heavy polypeptide 13, skeletal muscle [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012837262 Xl3.1-xlk117e20ex.3.5 - 546 ESTs
                                                                       .....-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870......4880......4890......4900......4910......4920......4930......4940......4950......4960......4970......4980......4990......5000......5010......5020......5030......5040......5050......5060......5070......5080......5090......5100......5110......5120......5130......5140......5150......5160......5170......5180......5190......5200......5210......5220......5230......5240......5250......5260......5270......5280......5290......5300......5310......5320......5330......5340......5350......5360......5370......5380......5390......5400......5410......5420......5430......5440......5450......5460......5470......5480......5490......5500......5510......5520......5530......5540......5550......5560......5570......5580......5590......5600......5610......5620......5630......5640......5650......5660......5670......5680......5690......5700......5710......5720......5730......5740......5750......5760......5770......5780......5790......5800......5810......5820......5830......5840......5850......5860......5870......5880......5890......5900......5910......5920......5930......5940......5950......5960......5970......5980......5990......6000......6010......6020......6030......6040......6050......6060......6070......6080......6090......6100......6110...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-xlk117e20ex.3.5                                                                                                                                                                                                                                                                                                                  AACTTTTTTTTTCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTGAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCATCAGGATCCATTTTGGAACTACAGGAAAACTGTCTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAGCAGAAAGAAGTTATCACATCTTCTATCAGATCTTAACAAATAAGAAGCCAGAACTTGTTGAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGAGGAATTGATGGCCACAGATAATGCCATTGACATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACTTGAAATTCAAGCAAAAGCAAAGGGAAGAGCAGGCTGAACCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGTCGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCTCAGGTCTATAACGCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTTGAAATCTTTGACTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGAGTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGACACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGCTCAACTTATTACTTGCACCCAAGCTCTTTGCAGAGGATTTTTGATGAGGGTTGAGTTCAAGAAAATGATGGAAAGAAGGGAGGCCATATATCTCATTCAGTACAATTTGAGGTCGTTCATGAATGTCAAACACTGGCCATGGATGAAACTGTACTTCAAGATCAAGCCTCTCCTGCAGAGTGCTGAGACTGAGAAAGAGATGGCAAACATGAAGGAAGAATTTGAGAAGACCAAGGAAGCACTGGTAAAAGCAGAAGCAAGAAAGAAAGAACTGGAGGAGAAAATGGTTTCCCTGCTCCAGGAAAAGAATGATCTAGTCCTGCAGGTTCAATCGGAAGGTGAAACCTTGGCTGATTCTGAGGAGAGATGTGAAGGGCTCATCAAAAGCAAAATTCAGCTGGAGTCTAAACTAAAGGAATTAACAGAAAGACTTGAAGATGAAGAAGAAAGCAATGCAGAACTAACAGCAAAGAAGAGGAAACTGGAGGATGAATGTTCTGAGCTTAAGAAAGACATTGATGACCTTGAACTTACGTTGGCCAAAGTAGAAAAGGAGAAGCATGCCACAGAAAACAAGGTCAAAAACCTTACTGAAGAAATGGCAGCTCTCGATGAGAACATTTCCAAACTGTCCAAAGAAAAGAAGGCCCTTCAAGAGGCTCACCAACAAACACTTGATGACCTGCAAGCTGAAGAGGACAAAGTCAGTTCTCTGTCAAAAGCAAAGACAAAGCTAGAACAGCAAGTTGATGATCTGGAAGGTTCCCTGGAACAAGAGAAGAAACTTCGTCTTGACTTTGAGAGAGCCAAGAGAAAGCTTGAAGGAGATCTGAAACTGACCCAGGAAACTGTTATGGACCTTGAGAATGATAAACAACAAACTGAAGAAAAACTTAAAAAGAAAGACTTTGAAATAAGCCAGCTGCAAGGAAAGATAGAAGATGAACAGTCCCTGGGCATTCAGTTGCAGAAAAAGATCAAGGAACTGCAGGCTAGAATTGAAGAACTTGAGGAAGAAATTGAAGCTGAACGTGCAGCTCGTGCAAAGGTAGAGAAACAAAGGGCTGATCTTTCCAGGGAACTTGAGGAGATCAGTGAGAGACTTGAAGAAGCTGGAGGTGCAACATCTGCTCAGATTGAGATGAACAAAAAACGTGAAGCTGAGTTCCAGAAACTGAGACGTGACCTGGAGGAGGCAACCCTTCAGCATGAAGCCACTGCTGGTGCCCTGCGCAAAAAACACGCTGATAGCGTAGCTGAGCTTGGGGAGCAAATTGATAACCTGCAGCGGGTTAAACAAAAGCTTGAGAAAGAAAAGAGTGAACTGAAGATGGAGACTGATGATCTTGCCAGCAACTTGGAAAATGTATCCAAATCAAAGGCTAATCTTGAAAAGGTTAATCGTGTCCTTGAGGACCAACTTAGTGAAGTGAAGGCAAAGGATGATGAGCGCCAGCGTCTCCTCAATGACCTCACTACTCAAAAGGCTCGCTTGCAGACTGAGACTGGTGAGCTCTCCCGTCAGCTTGAAGAGAGGGAATCTCTAATTTCTCAGCTCTCAAGAGGAAAGCAGGGATTTACTCAGCAAGTTGAAGAACTGAAGAGGCAACTTGAAGAGGAAACAAAGGCTAAGAATGCCCTTGCTCATGCGCTACAATCATCCCGTCATGACTGTGACTTGCTTCGAGAACAATTTGAGGAAGAGCAGGAGGCCAAGGCTGAACTTCAGCGCTCACTGTCCAAAGCCAATGGTGAAGTTTCACAATGGAGGACCAAATATGAAACTGATGCAATTCAGCGTACTGAGGAGCTTGAAGAAGCCAAGAAGAAACTTGCTCAGCGTTTACAGGATGCTGAGGAGCAAGTTGAAGCTGTGAATTCCAAATGTGCCTCCTTGGAGAAGACTAAGCAGAGACTGCAATCTGAAGTTGAGGACTTGATGGTTGATGTTGAGAGAGCAAATGGTGCAGCAACTGCTCTTGATAAGAAGCAGAGAAACTTTGATAAGGTCCTGGTAGAATGGAAACAGAAGTATGAAGAGGGCCAGGCTGAATTGGAAGCAGCTCTGAAGGAATCTCGCAGCCTGAGCACTGAGATCTTCAAGATGAAGAATGCTTATGAGGAATCTCTGGAGCATGTTGAAACTCTGAAACGTGAAAACAAGAACCTTCAACAGGAGATTTCAGATCTGACAGAACAGATTGGTGAAAGTGGAAAATCAGTTATTGAATTGGAGAAGGTCAAGAAGCAGGTGGAGCAAGAAAAGAATGATCTCCAGGCTGCTCTGGAAGAAGCAGAGGGATCTCTGGAACATGAAGAAGCCAAGATTCTGCGCATCCAGCTTGAACTGAACCAGGTGAAATCTGAAGTGGACAGGAAAATTGCAGAGAAGGATGAGGAAATTGAACAGTTAAAGAGAAACAGCCAGAGGGCTATCGACACCATGCAGAGCACACTGGACTCTGAAATCAGGAGCAGAAATGATGCATTGAGACTGAAGAAGAAGATGGAAGGTGATCTGAATGAGCTTGAGATCCAGCTGGGTCACGCCAACCGTCAAGCTTCTGAAGCACAGAAACAGCTCAGGAATGTCCAGGCCCAGTTCAAGGAGTCCCAGCTCCAGTTGGATGATGCAGTTAGGGGACAGGAGGACCTGAAGGAACAGGTTGCTGTAATTGAGCGCAGAAATAACTTGTTTCAAGCTGAAATTGAAGAAAACAGGGCTGCTCTGGAACAGACAGAAAGATCTCGTAAGATTGCAGAACAGGAGCTCCTAGATGCAAGTGAACGTCTTCAGCTGTTTCATTCACAGAACACAAGTCTCATTAACAGCAAGAAGAAACTTGAAAGTGACATCAGTCAGCTACAGAATGAGGCTGAGGAAGCTGTCCAAGAATCCAGAAATGCTGAAGAGAAGGCAAAGAAGGCCATAACAGATGCTGCCCTGATGGCAGAAGAACTGAAGAAGGAACAGGACACCAGTGCTCACTTAGAAAGGATGAAGAAGAACCTTGAACAGACTGTGAAGGACCTGCAAAATCGCCTGGATGAAGCTGAACAACTGGCAATGAAGGGTGGCAAGAAGCAGCTCCAGAAACTGGAATCCAGGGTACGGGAACTGGAGAATGAAGTGGAGAACGAACAGAAACGTGGTGTTGATGCTGTGAAAGGTGTCCGTAAATATGAGAGGAGAGTGAAGGAACTCACATACCAGACTGAGGAAGATAAGAAGAACCTTCTGAGACTGCAGGACCTGGTGGACAAACTTCAGTCTAAAGTTAAAGCCTACAAGAGGCAGGCTGAGGAATCTGAGGAACAAGCCAATGCCCACTTGAGCCGCTTCCGTAAGGTTCAGCACGAGCTTGAAGAAGCAGAGGAAAGAGCCGATATTGCAGAGTCCCAAGTGAATAAGCTCAGGACCAAGAGCCGTGATGTTGGAGGCAAGAAAGAGTCTGAAGAGTGAAAACATAGAAGACTGAGGAATGTGACAATTTAGTTGTTTCCATTCCGAATATAGTTTATCAAATGAATTGTAAATAAATTACTTGAAGCCTAAGCCTAAAAAA
                                                  Xl3.1-CHK-1012721709                                                                                                                                                                                                                                                                                                                        TTTTTTCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGCCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTGAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCATCAGGATCCATTTTGGAACTACAGGAAAACTGTCTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAGCAGAAAGAAGTTATCACATCTTCTATCAGATCTTAACAAATAAGAAGCCAGAACTTGTTGAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGAGGAATTGATGGCCACAGATAATGCCATTGACATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACATGAAATTCAAGCAAAAGCAAAGGGAAGAGCAGGCTGAACCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGTCGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCTCAGGTCTATAACGCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTTGAAATCTTTGACTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGAGTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGACACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGCTCAACTTATTACTTGCACCCAAGCTCTTTGCAGAGGATTTTTGATGAGGGTTGAGTTCAAGAAAATGATGGAAAGAAGGGAGGCCATATATCTCATTCAGTACAATTTGAGGTCGTTCATGAATGTCAAACACTGGCCATGGATGAAACTGTACTTCAAGATCAAGCCTCTCCTGCAGAGTGCTGAGACTGAGAAAGAGATGGCAAACATGAAGGAAGAATTTGAGAAGACCAAGGAAGCACTGGTAAAAGCAGAAGCAAGAAAGAAAGAACTGGAGGAGAAAATGGTTTCCCTGCTCCAGGAAAAGAATGATCTAGTCCTGCAGGTTCAATCGGAAGGTGAAACCTTGGCTGATTCTGAGGAGAGATGTGAAGGGCTCATCAAAAGCAAAATTCAGCTGGAGTCTAAACTAAAGGAATTAACAGAAAGACTTGAAGATGAAGAAGAAAGCAATGCAGAACTAACAGCAAAGAAGAGGAAACTGGAGGATGAATGTTCTGAGCTTAAGAAAGACATTGATGACCTTGAACTTACGTTGGCCAAAGTAGAAAAGGAGAAGCATGCCACAGAAAACAAGGTCAAAAACCTTACTGAAGAAATGGCAGCTCTCGATGAGAACATTTCCAAACTGTCCAAAGAAAAGAAGGCCCTTCAAGAGGCTCACCAACAAACACTTGATGACCTGCAAGCTGAAGAGGACAAAGTCAGTTCTCTGTCAAAAGCAAAGACAAAGCTAGAACAGCAAGTTGATGATCTGGAAGGTTCCCTGGAACAAGAGAAGAAACTTCGTCTTGACTTTGAGAGAGCCAAGAGAAAGCTTGAAGGAGATCTGAAACTGACCCAGGAAACTGTTATGGACCTTGAGAATGATAAACAACAAACTGAAGAAAAACTTAAAAAGAAAGACTTTGAAATAAGCCAGCTGCAAGGAAAGATAGAAGATGAACAGTCCCTGGGCATTCAGTTGCAGAAAAAGATCAAGGAACTGCAGGCTAGAATTGAAGAACTTGAGGAAGAAATTGAAGCTGAACGTGCAGCTCGTGCAAAGGTAGAGAAACAAAGGGCTGATCTTTCCAGGGAACTTGAGGAGATCAGTGAGAGACTTGAAGAAGCTGGAGGTGCAACATCTGCTCAGATTGAGATGAACAAAAAACGTGAAGCTGAGTTCCAGAAACTGAGACGTGACCTGGAGGAGGCAACCCTTCAGCATGAAGCCACTGCTGGTGCCCTGCGCAAAAAACACGCTGATAGCGTAGCTGAGCTTGGGGAGCAAATTGATAACCTGCAGCGGGTTAAACAAAAGCTTGAGAAAGAAAAGAGTGAACTGAAGATGGAGACTGATGATCTTGCCAGCAACTTGGAAAATGTATCCAAATCAAAGGCTAATCTTGAAAAGGTTAATCGTGTCCTTGAGGACCAACTTAGTGAAGTGAAGGCAAAGGATGATGAGCGCCAGCGTCTCCTCAATGACCTCACTACTCAAAAGGCTCGCTTGCAGACTGAGACTGGTGAGCTCTCCCGTCAGCTTGAAGAGAGGGAATCTCTAATTTCTCAGCTCTCAAGAGGAAAGCAGGGATTTACTCAGCAAGTTGAAGAACTGAAGAGGCAACTTGAAGAGGAAACAAAGGCTAAGAATGCCCTTGCTCATGCGCTACAATCATCCCGTCATGACTGTGACTTGCTTCGAGAACAATTTGAGGAAGAGCAGGAGGCCAAGGCTGAACTTCAGCGCTCACTGTCCAAAGCCAATGGTGAAGTTTCACAATGGAGGACCAAATATGAAACTGATGCAATTCAGCGTACTGAGGAGCTTGAAGAAGCCAAGAAGAAACTTGCTCAGCGTTTACAGGATGCTGAGGAGCAAGTTGAAGCTGTGAATTCCAAATGTGCCTCCTTGGAGAAGACTAAGCAGAGACTGCAATCTGAAGTTGAGGACTTGATGGTTGATGTTGAGAGAGCAAATGGTGCAGCAACTGCTCTTGATAAGAAGCAGAGAAACTTTGATAAGGTCCTGGTAGAATGGAAACAGAAGTATGAAGAGGGCCAGGCTGAATTGGAAGCAGCTCTGAAGGAATCTCGCAGCCTGAGCACTGAGATCTTCAAGATGAAGAATGCTTATGAGGAATCTCTGGAGCATGTTGAAACTCTGAAACGTGAAAACAAGAACCTTCAACAGGAGATTTCAGATCTGACAGAACAGATTGGTGAAAGTGGAAAATCAGTTATTGAATTGGAGAAGGTCAAGAAGCAGGTGGAGCAAGAAAAGAATGATCTCCAGGCTGCTCTGGAAGAAGCAGAGGGATCTCTGGAACATGAAGAAGCCAAGATTCTGCGCATCCAGCTTGAACTGAACCAGGTGAAATCTGAAGTGGACAGGAAAATTGCAGAGAAGGATGAGGAAATTGAACAGTTAAAGAGAAACAGCCAGAGGGCTATCGACACCATGCAGAGCACACTGGACTCTGAAATCAGGAGCAGAAATGATGCATTGAGACTGAAGAAGAAGATGGAAGGTGATCTGAATGAGCTTGAGATCCAGCTGGGTCACGCCAACCGTCAAGCTTCTGAAGCACAGAAACAGCTCAGGAATGTCCAGGCCCAGTTCAAGGAGTCCCAGCTCCAGTTGGATGATGCAGTTAGGGGACAGGAGGACCTGAAGGAACAGGTTGCTGTAATTGAGCGCAGAAATAACTTGTTTCAAGCTGAAATTGAAGAAAACAGGGCTGCTCTGGAACAGACAGAAAGATCTCGTAAGATTGCAGAACAGGAGCTCCTAGATGCAAGTGAACGTCTTCAGCTGTTTCATTCACAGAACACAAGTCTCATTAACAGCAAGAAGAAACTTGAAAGTGACATCAGTCAGCTACAGAATGAGGCTGAGGAAGCTGTCCAAGAATCCAGAAATGCTGAAGAGAAGGCAAAGAAGGCCATAACAGATGCTGCCCTGATGGCAGAAGAACTGAAGAAGGAACAGGACACCAGTGCTCACTTAGAAAGGATGAAGAAGAACCTTGAACAGACTGTGAAGGACCTGCAAAATCGCCTGGATGAAGCTGAACAACTGGCAATGAAGGGTGGCAAGAAGCAGCTCCAGAAACTGGAATCCAGGGTACGGGAACTGGAGAATGAAGTGGAGAACGAACAGAAACGTGGTGTTGATGCTGTGAAAGGTGTCCGTAAATATGAGAGGAGAGTGAAGGAACTCACATACCAGACTGAGGAAGATAAGAAGAACCTTCTGAGACTGCAGGACCTGGTGGACAAACTTCAGTCTAAAGTTAAAGCCTACAAGAGGCAGGCTGAGGAATCTGAGGAACAAGCCAATGCCCACTTGAGCCGCTTCCGTAAGGTTCAGCACGAGCTTGAAGAAGCAGAGGAAAGAGCCGATATTGCAGAGTCCCAAGTGAATAAGCTCAGGACCAAGAGCCGTGATGTTGGAGGCAAGAAAGAGTCTGAAGAGTGAAAACATAGAAGACTGAGGAATGTGAxxxxxTxxxxxxTTCCATTCCGAATATAGTTTATCAAATGAATTGTAAATAAATTACTTGxAxxxxAAGCCTAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                      11    23    24    37    38    39    40    40    40    40    41    41    41    41    41    42    45    45    45    45    45    45    45    45    45    45    35    44    44    44    44    44    43    44    44    44    45    46    47    47    47    47    46    47    46    47    47    47    47    47    47    47    48    48    48    48    48    48    48    48    48    48    48    48    41    48    46    48    46    47    47    47    46    47    42    45    40    45    41    45    43    43    40    42    39    40    38    39    38    39    37    41    37    42    38    42    37    43    37    43    36    41    34    41    35    41    35    40    30    41    26    41    22    41    23    40    20    39    22    38    20    38    19    37    19    37    20    38    17    38    15    36    13    35    12    31    11    30    11    29    11    29    11    28    11    24    11    23     9    20    12    18    11    17    12    14    12    14    12    14    12    14    15    17    15    17    14    17    14    17    15    17    13    18    15    19    16    19    16    20    15    18    14    18    18    21    19    21    19    22    19    22    19    23    20    24    20    24    21    24    22    24    20    23    21    23    19    23    20    23    14    23    19    23    19    23    17    23    18    23    18    22    18    21    18    21    18    21    18    21    17    21    18    21    18    21    20    23    20    23    20    24    21    24    21    24    23    26    24    26    25    27    23    27    25    28    25    28    25    29    24    28    24    28    24    28    24    28    27    29    28    31    31    33    30    34    29    33    29    34    28    35    27    33    25    34    26    33    26    35    30    38    30    38    24    37    30    38    30    38    29    38    29    40    30    42    28    40    25    41    26    42    26    41    27    41    23    41    24    41    24    41    24    43    27    43    30    43    28    44    32    44    33    47    32    47    31    49    33    50    39    50    39    51    39    50    32    50    31    50    34    51    33    51    38    51    41    52    36    52    42    52    40    53    44    53    43    53    44    54    45    54    41    54    37    54    39    54    34    53    32    52    37    51    36    51    39    49    35    53    40    51    35    51    40    50    39    52    33    52    30    51    32    50    35    49    31    49    33    45    30    44    36    45    33    46    35    46    32    49    36    53    43    53    38    53    44    52    43    52    37    52    43    52    39    49    41    47    37    49    37    49    38    49    37    49    36    49    36    49    37    49    38    53    42    53    41    54    40    56    42    53    41    52    40    51    40    51    40    52    42    49    40    49    39    48    38    47    40    46    37    46    38    46    36    46    36    47    37    46    40    45    38    45    43    47    42    48    42    50    45    51    44    51    43    53    42    52    42    51    42    52    42    50    40    50    42    51    42    52    43    53    41    53    43    54    39    54    39    52    41    51    39    50    36    50    36    49    36    50    34    50    36    49    36    50    31    45    30    41    30    38    30    37    30    38    28    38    30    36    29    36    32    37    33    37    33    38    34    39    33    37    34    37    32    35    33    37    31    41    32    40    33    42    33    42    36    43    36    42    34    42    33    43    32    43    34    45    37    47    38    47    37    49    38    50    37    50    37    49    38    47    40    46    40    48    40    48    41    47    43    49    44    48    44    50    45    50    44    49    47    52    45    53    46    53    46    55    47    56    50    57    49    56    49    56    48    56    41    56    49    56    52    58    56    62    53    61    52    64    54    63    53    65    52    63    52    64    53    66    49    65    56    66    53    64    53    64    57    65    52    66    55    67    59    75    64    74    64    74    62    74    61    76    68    79    70    83    70    83    71    83    74    89    75    89    73    89    75    89    56    90    71    90    74    90    76    93    70    90    54    90    71    89    68    88    72    86    71    86    68    86    70    85    69    87    71    86    73    89    74    90    74    91    76    92    77    92    78    91    81    91    83    93    84    94    84    95    84    95    86   100    89   102    93   105    89   104    90   107    93   113    87   113    92   115    89   115    91   114    94   115    91   114    95   114    92   114    93   112    97   114    93   112    97   116    95   116    92   113    61   114    92   115    86   111    94   111    90   113    86   113    90   113    85   112    85   112    82   110    84   112    83   111    81   112    80   111    80   110    70   109    80   112    76   111    76   114    75   115    72   117    70   119    74   126    76   125    71   128    70   126    71   126    71   126    75   127    75   127    74   129    85   130    80   128    88   127    88   127    89   127    90   129    96   130    98   129    93   126    90   123    96   125    89   123    86   121    87   121    85   119    81   116    81   116    85   115    85   116    78   118    91   118    62   117    64   117    94   120    95   125   101   128    98   130    99   127   103   128   106   128   106   133   108   133   111   133   108   132   111   132   111   131   113   131   116   130   112   130   115   131   117   131   115   132   112   132   116   132   110   131    80   131    82   131   120   131   124   132   123   134   116   134   126   134   128   135   127   135    82   134   120   134   114   134   109   132    60   131    50   119    46   108    29    96    30    93    29    85    24    67     9    30
  5   1   2      en>5                            Xl3.1-IMAGE:5542292.5                                                                                                                                                                                                                                                                                                      CTCTGGGGGACTAACTTTTTTTTTCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTCAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAAT------------CCATTTTTGGAAAACTACAGGGAACTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAG
  5   1   2       e>3                            Xl3.1-IMAGE:4684082.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACTTATTCTGGCCTTTTCTGCGCCACTGTCAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGCTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGAAGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTGAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCATCAGGATCCATTTTGGAACTACAGGAAAACTGTCTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAGCAGAAAGAAGTTATCACATCTTCTATCAGATCTTAACAAATAAGAAGCCAGAACTTGTTGAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGAGGAATTGATGGCCACAGATAATGCCATTGACATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACATGAAATTCAAGCAAAAGCAAAGGGAAGAGCAGGCTGAACCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCCTCACTCTGCTGATTTG
  5   1   2       e>3                              Xl3.1-xlk117e20ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTGTTGAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGATGAATTGATGGCCACAGATAATGCCATTGACATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACTTGAAATTTAAGCAAAAGCAAAGGGAAGAGCAGGCTGAGCCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGTCGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCTCAGGTCTATAACTCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTTGAAATCTTTGACTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGAGTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGACACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGCTCAACTTATTACTTGCACCCAAGCTCTTTGCAGAGGATTTTTGATGAGGGTTGAGTTCAAGAAAATGATGGAAAGAAGGGAGGCCATATATCTCATTCAGTACAATTTGAGGTCGTTCATGAATGTCAAACACTGGCCATGGATGAAACTGTACTTCAAGATCAAGCCTCTCCTGCAGAGTGCTGAGACTGAGAAAGAGATGGCAAACATGAAGGAAGAATTTGAGAAGACCAAGGAAGCACTGGTAAAAGCAGAAGCAAGAAAGAAAGAACTGGAGGAGAAAATGGTTTCCCTGCTCCAGGAAAAGAATGATCTAGTCCTGCAGGTTCAATCGGAAGGTGAAACCTTGGCTGATTCTGAGGAGAGATGTGAAGGGCTCATCAAAAGCAAAATTCAGCTGGAGTCTAAACTAAAGGAATTAACAGAAAGACTTGAAGATGAAGAAGAAAGCAATGCAGAACTAACAGCAAAGAAGAGGAAACTGGAGGATGAATGTTCTGAGCTTAAGAAAGACATTGATGACCTTGAACTTACGTTGGCCAAAGTAGAAAAGGAGAAGCATGCCACAGAAAACAAGGTCAAAAACCTTACTGAAGAAATGGCAGCTCTCGATGAGAACATTTCCAAACTGTCCAAAGAAAAGAAGGCCCTTCAAGAGGCTCACCAACAAACACTTGATGACCTGCAAGCTGAAGAGGACAAAGTCAGTTCTCTGTCAAAAGCAAAGACAAAGCTAGAACAGCAAGTTGATGATCTGGAAGGTTCCCTGGAACAAGAGAAGAAACTTCGTCTTGACTTTGAGAGAGCCAAGAGAAAGCTTGAAGGAGATCTGAAACTGACCCAGGAAACTGTTATGGACCTTGAGAATGATAAACAACAAACTGAAGAAAAACTTAAAAAGAAAGACTTTGAAATAAGCCAGCTGCAAGGAAAGATAGAAGATGAACAGTCCCTGGGCATTCAGTTGCAGAAAAAGATCAAGGAACTGCAGGCTAGAATTGAAGAACTTGAGGAAGAAATTGAAGCTGAACGTGCAGCTCGTGCAAAGGTAGAGAAACAAAGGGCTGATCTTTCCAGGGAACTTGAGGAGATCAGTGAGAGACTTGAAGAAGCTGGAGGTGCAACATCTGCTCAGATTGAGATGAACAAAAAACGTGAAGCTGAGTTCCAGAAACTGAGACGTGACCTGGAGGAGGCAACCCTTCAGCATGAAGCCACTGCTGGTGCCCTGCGCAAAAAACACGCTGATAGCGTAGCTGAGCTTGGGGAGCAAATTGATAACCTGCAGCGGGTTAAACAAAAGCTTGAGAAAGAAAAGAGTGAACTGAAGATGGAGACTGATGATCTTGCCAGCAACTTGGAAAATGTATCCAAATCAAAGGCTAATCTTGAAAAGGTTAATCGTGTCCTTGAGGACCAACTTAGTGAAGTGAAGGCAAAGGATGATGAGCGCCAGCGTCTCCTCAATGACCTCACTACTCAAAAGGCTCGCTTGCAGACTGAGACTGGTGAGCTCTCCCGTCAGCTTGAAGAGAGGGAATCTCTAATTTCTCAGCTCTCAAGAGGAAAGCAGGGATTTACTCAGCAAGTTGAAGAACTGAAGAGGCAACTTGAAGAGGAAACAAAGGCTAAGAATGCCCTTGCTCATGCGCTACAATCATCCCGTCATGACTGTGACTTGCTTCGAGAACAATTTGAGGAAGAGCAGGAGGCCAAGGCTGAACTTCAGCGCTCACTGTCCAAAGCCAATGGTGAAGTTTCACAATGGAGGACCAAATATGAAACTGATGCAATTCAGCGTACTGAGGAGCTTGAAGAAGCCAAGAAGAAACTTGCTCAGCGTTTACAGGATGCTGAGGAGCAAGTTGAAGCTGTGAATTCCAAATGTGCCTCCTTGGAGAAGACTAAGCAGAGACTGCAATCTGAAGTTGAGGACTTGATGGTTGATGTTGAGAGAGCAAATGGTGCAGCAACTGCTCTTGATAAGAAGCAGAGAAACTTTGATAAGGTCCTGGTAGAATGGAAACAGAAGTATGAAGAGGGCCAGGCTGAATTGGAAGCAGCTCTGAAGGAATCTCGCAGCCTGAGCACTGAGATCTTCAAGATGAAGAATGCTTATGAGGAATCTCTGGAGCATGTTGAAACTCTGAAACGTGAAAACAAGAACCTTCAACAGGAGATTTCAGATCTGACAGAACAGATTGGTGAAAGTGGAAAATCAGTTATTGAATTGGAGAAGGTCAAGAAGCAGGTGGAGCAAGAAAAGAATGATCTCCAGGCTGCTCTGGAAGAAGCAGAGGGATCTCTGGAACATGAAGAAGCCAAGATTCTGCGCATCCAGCTTGAACTGAACCAGGTGAAATCTGAAGTGGACAGGAAAATTGCAGAGAAGGATGAGGAAATTGAACAGTTAAAGAGAAACAGCCAGAGGGCTATCGACACCATGCAGAGCACACTGGACTCTGAAATCAGGAGCAGAAATGATGCATTGAGACTGAAGAAGAAGATGGAAGGTGATCTGAATGAGCTTGAGATCCAGCTGGGTCACGCCAACCGTCAAGCTTCTGAAGCACAGAAACAGCTCAGGAATGTCCAGGCCCAGTTCAAGGAGTCCCAGCTCCAGTTGGATGATGCAGTTAGGGGACAGGAGGACCTGAAGGAACAGGTTGCTGTAATTGAGCGCAGAAATAACTTGTTTCAAGCTGAAATTGAAGAAAACAGGGCTGCTCTGGAACAGACAGAAAGATCTCGTAAGATTGCAGAACAGGAGCTCCTAGATGCAAGTGAACGTCTTCAGCTGTTTCATTCACAGAACACAAGTCTCATTAACAGCAAGAAGAAACTTGAAAGTGACATCAGTCAGCTACAGAATGAGGCTGAGGAAGCTGTCCAAGAATCCAGAAATGCTGAAGAGAAGGCAAAGAAGGCCATAACAGATGCTGCCCTGATGGCAGAAGAACTGAAGAAGGAACAGGACACCAGTGCTCACTTAGAAAGGATGAAGAAGAACCTTGAACAGACTGTGAAGGACCTGCAAAATCGCCTGGATGAAGCTGAACAACTGGCAATGAAGGGTGGCAAGAAGCAGCTCCAGAAACTGGAATCCAGGGTACGGGAACTGGAGAATGAAGTGGAGAACGAACAGAAACGTGGTGTTGATGCTGTGAAAGGTGTCCGTAAATATGAGAGGAGAGTGAAGGAACTCACATACCAGACTGAGGAAGATAAGAAGAACCTTCTGAGACTGCAGGACCTGGTGGACAAACTTCAGTCTAAAGTTAAAGCCTACAAGAGGCAGGCTGAGGAATCTGAGGAACAAGCCAATGCCCACTTGAGCCGCTTCCGTAAGGTTCAGCACGAGCTTGAAGAAGCAGAGGAAAGAGCCGATATTGCAGAGTCCCAAGTGAATAAGCTCAGGACCAAGAGCCGTGATGTTGGAGGCAAGAAAGAGTCTGAAGAGTGAAAACATAGAAGACTGAGGAATGTGGAGGAATGTGAATTTCCATTCCGAATATAGTTTATCAAATGAATTGTAAATAAATTACTTTGACTTGAAGCCTAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGATTACAACA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGACCCACTGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTAATGAGACAAAAACTCCAGGGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGAGGGCATTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGCTTATTAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACGTTTGGCCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCTCATGAGAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTTCTGCATCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GACAAGACAACAAAACTGAGGAATGTGAAAATAATTTTCCACTCCGAATATAGTTTATCAAATGAATTGTAAATAAATGACTTG
                                                                   SNP                                                                                                                                                                                                                                                                                                                              -----TG-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                          -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                              -----G-T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                  -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                              -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -C--------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----C----C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T--G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----T-----A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----G---A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --A----A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -A-----T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -T--T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------T-G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----C---T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----C--T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G---C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G--------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------AT---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----G----C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --A-T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------A--T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -A--------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------C---A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -A--T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---C----A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T--------C
                                               BLH ATG      47    3033                                                                                                                                                                                                                                                                                                                  
                                               BLH MIN      47     377                                                                                                                                                                                                                                                                                                                  
                                               BLH MPR      44     377                                                                                                                                                                                                                                                                                                                  
                                               BLH OVR      47      49                                                                                                                                                                                                                                                                                                                  
                                               CDS MIN      47      51                                                                                                                                                                                                                                                                                                                  
                                               EST CLI       0      51                                                                                                                                                                                                                                                                                                                  
                                               ORF LNG      47      29                                                                                                                                                                                                                                                                                                                  
  5   1   2      en>5                            Xl3.1-IMAGE:5542292.5                                                                                                                                                                                                                                                                                                      CTCTGGGGGACTAACTTTTTTTTTCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTCAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAAT------------CCATTTTTGGAAAACTACAGGGAACTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAG
                                                  Xl3.1-CHK-1012686800                                                                                                                                                                                                                                                                                                            GGGACTxxxxTTTTTTTTCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGCCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTCAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCATCATCAGAAxxxxxTTTxGxxAACTACAxxxxxCTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAGCAGAGA
  5   1   2       bld Sp1  5g                         IMAGE:4962837.5p AGAATCNATTTCGCAACACGGATTTTGTTTGAATTTCAGATTCCTGAGCTCAGTGAAACCCAACCCCACAGCAAGTGATAGGCTACAGATAGGAACAGTTGCTTTGAGCATCTCTGGGTACTTGAAACCTGAATAGTGCGTGTTATTTTTACTCGTGATGAAGAGGCAACTTTGGGTCTTGGTTTACCGTTATGGTAATATGGAAACCTCTTCCTTACGTGGAAAAACTGCTGAGCTCACACTGTTTGCTTTTTATATAAACCAGCCGTGGGGGCGGCAGTAGATTGCTCAGTCTCTGGGGGACTTTACttttttttCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGGAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTT
  5   1   2       bld Emb4 5g                         IMAGE:4970128.5p                                                                                                                                                                                                                                                                                          CGACCACGCGTCCGCCCACGCGTCCGAACTTTTTTTCTTATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAGGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATGCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATATACACCTATTCTGGCCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGACGCTGGAAAGAGAAGGAACTCTCCAACGCTTGCAGGAAATCTGGAGATCAATCTTCAGGCCACCCTCTCTGGAGCCTTGGTAATGCAG
  5   1   2       bld Tad1 5g                         IMAGE:6940232.5p                                                                                                                                                                                                                                                                                           GGGGCTCAGTCTCTGGGGGACTTAACtttttttttCTCATTGTCATCTCGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTGGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGTGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCATATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAATCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAAGAAAAACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCCTGGAAGAAGAAAGGAACTTCTCAACAGCTTGCAGGGA
  5   1   2       bld Tad1 5g                         IMAGE:6881110.5p                                                                                                                                                                                                                                                                                            GGGGCTCAGTCTCTGGGGGACTTTACttttttttCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGGAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTCGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTTACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACTTATTCTGGCCTTTTCTGCGCCACTGTCAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGCTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAAACCAGTCTGTCCTTATTACTGGAAAAATCTGGTGCAGGAAAAACTGTGAACACCAAGCGTGTCATCCAATAATTTTGCAACAAATGCAGCACTTTGGAGAAGCTGGGAAGAAAAAAGGAACTCTTCCAACAACTTTGCGGGGAAAACCTGGGAAAAAC
  5   1   2       bld Emb4 5g                         IMAGE:4679901.5p                                                                                                                                                                                                                                                                                             GAGTCACTGCCCTGGGGGACTTTACttttttttCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGGAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAATTTTTTGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTTACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACTTATTCTGGCCTTTTCTGCGCCACTGTCAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGCTACAGAGGGAAAAAGCGTATGGAAAccccccccTCACATTTT
  5   1   2       bld Emb4 5g                         IMAGE:5542959.5p                                                                                                                                                                                                                                                                                              CCACGCGTCCGGGGGGACTTAACtttttttttCTCGTTGTCATCTCGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGTGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGAAAAAAGCGTATGGAAACCCCCCCTCATATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAATCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTCAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAAATGACACTTCCTCTCGNTTTTGGGAAAATTCATCAGAAATCCATTTTTGGAACTTACACGGAAAAACTGTTCTTTCCACCTTGATAATTGAAAACATATCCCA
  5   1   2       bld Emb3 5g                         IMAGE:3399059.5p                                                                                                                                                                                                                                                                                               CACGCGTCCGCCCACGCGTCCGCttttttttCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGGAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTCGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTTACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACTTATTCTGGCCTATTCTGCGCCACTGTCAACCCCTACAAGTGGCTGCCAGTGCACAACCCTGAGGTTGTTCCGGCTACAGATGGAAAAAGCG
  5   1   2       bld Emb4 5g                         IMAGE:4724839.5p                                                                                                                                                                                                                                                                                                       CCACGCGTCCGAACtttttttttCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGGCTATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGATGATCCAAAGGAACTTTATGTCAAAGGTTTCGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTAAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGAGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGGAAAGAAGAAAGAACTCTCCCACAGCTTGCAGGGAAACCTGGGAGATCAATCATTGAGGCCAACCCTCTGCTGGGAGCCTTTGGGTAATGCCAAGACTGTGAAGAAATGACAACTCCCTCCTCGTTTTGGGAAATTTCATCACAAATCCATTTTTGGAACTACAGGGAAAACTGGCCTTCGCCTGAATATTGAAACCTTTTCTGCCTGGAAAAATCCCAAAGTTTAAATTCCCGGCTTT
  5   1   2      seed Emb4      in                    IMAGE:4957260.5p                                                                                                                                                                                                                                                                                                        GACGCGTGGGAACtttttttttCTCGTTGTCATCTCGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTGGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGTGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCATATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAATCAGTCTGTCCTTATTACTGGAGAATCCGGTGCA
  5   1   2       bld Emb4 5g                         IMAGE:4203462.5p                                                                                                                                                                                                                                                                                                         CCCACGCGTCCGACTTTTTTTCTTATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAGGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATGCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATATACACCTATTCTGGCCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGGCAGTGTACAACCCTTGAGTTGGTGCCGGGTACAGAGGGAAAAAGCGTATGGAA
  5   1   2       bld Emb4 5g                         IMAGE:5572553.5p                                                                                                                                                                                                                                                                                                         GGGGGTCTTAACtttttttttCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGGCTATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGATGATCCAAAGGAACTTTATGTCAAAGGTTTCGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTAAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGAGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAAGATCAAATCATTGAGGGCCAACCCTCTGCTGGGAGGCCTTTTGGTAATGCCAAAAACTGTGAAGAAATGACAACTTCCTCCTCGTTTTTGGGAAAAATTCATCCAAAC
  5   1   2       bld Emb4 5x3                        IMAGE:5570686.5p                                                                                                                                                                                                                                                                                                         TGGGGGACTTTACttttttttCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGGAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTCGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTTACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACTTATTCTGGCCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGAAGCTGGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAAACCTGGGAAGATNCAAATCATTGGAGGCCAACCCCTCTGCTGGGAAGCCCTTTGGGTAATGCCAAAGAACTGGTGAGAAAATGACANACTCCCTTCTCGGTTTTTGGTAAAATTTCATCANGGAATTCCATTTTTGGGGAACTACCAGGAAAAACT
  5   1   2       bld Emb4 5g                         IMAGE:5572295.5p                                                                                                                                                                                                                                                                                                          CCACGCGTCCGtttttttttCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGGAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTCGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTTACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACTTATTCTGGCCTTTTCTGCGCCACTGTCAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGCTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGAAGCTGGAAAGAAGAAGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTGAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCCAAGACTGGTGAGAAATGACAAACTCCTCTCGTTTTGGGTAATTTCCTCAGAAATCCATTTTGGGAACTACCGGGAAAAACTGGCCTTCCGCTGGATATTGAAACCTATCCGGCTGGGAAAAAGTCCAGAGGTTACATTCCCACC
  5   1   2       bld Emb4 5g3  in                    IMAGE:4203382.5p                                                                                                                                                                                                                                                                                                           CACGCGTCCGCttttttttCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGGAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTCGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTTACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACTTATTCTGGCCTTTTCTGCGCCACTGTCAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGCTACAGAGGGAAAAAGCGT
  5   1   2       bld Emb4 5g                         IMAGE:4682546.5p                                                                                                                                                                                                                                                                                                           GGGACTTAACtttttttttCTCGTTGTCATCTCGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGTGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCATATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAATCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGGAACTCTCNCACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTCAGGCCAACCCTCTGCTGGAAGGCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCNTCTCGGTTTTGGTAAATTCATCAGAATCCATTTTTGGAACTACAGGGAAAACTGTNCTTCAGCCTGATATTGAAACATATCCTTGCTGG
  5   1   2       bld Emb4 5g                         IMAGE:4681347.5p                                                                                                                                                                                                                                                                                                           TGGGGGACTTAACTTTTTTCTTATCTTCATCTGGACTGAAAGAAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAGGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATGCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGCCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCCTCCAGTATTTTTGCAACAATTGCAGCACTTGGGAGACGCTGGAAAGAAGAAGGAAACTCTCCAACAGGCTTGCAGGGGAAACCCTGGAAAGATCCAAATCATTTCAGGGCCAACCCCTCCTGCTGGGAAAGCCTTTTGGGAAATGGCCCAAGAACTTGGGGAGAAAATGGACAAACTCCTTTCTCCGTTTTTGGGGTAAATTTCATCTAAAAAATCCATTTTTTGGGGAACCAACCACGGGAAAAACCTGGGCTCTTCCCACCTGGGAATAATTGGAAAA
  5   1   2       bld Emb4 5g                         IMAGE:5572588.5p                                                                                                                                                                                                                                                                                                            GGGACTTTACttttttttCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGGAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTCGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTTACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACTTATTCTGGCCTTTTCTGCGCCACTGTCAACCCCTACAAGTGGCTGCCAGTGTACAACCCCTGAGTTGTTGCCGGCTACAGAGGGAAAAAGCGTATGGAAAACCCCCCCTCACATTTTCTCCCCTTTCTGATAACGCCCTATCAAGCCATGTTAAACAGAATCGTGGAAAAACCAGTCCTGTCCCTTATTTACCTGGNAAAAATCTTGGTTGCCAAGGAAAAGAACTGGTGAAACCACCCAAAGGCGGGGTCCATTCCCAAAGTTAttttttttGCCAAACCAAATTTGGCCAGC
  5   1   2       bld Emb4 5g                         IMAGE:5542870.5p                                                                                                                                                                                                                                                                                                            GGGACTTAACttttttttCTCATTGTCATCTCGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTGGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGTGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCATATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAATCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGAACTCTCCCACAGCTTGCAAGGAAACCTGGAAAGATCAAATCATTCAGGCCAACCCCTCCTGCTGGAAGCCTTTTGGGAAATGCCCAAGACTGTGGAAAAATGGACAACCTCCCTCTCCGTTTTTGGGGAAAAATTTCCTCCAGAAATCCCCTTTTTTGGGAAACCTACAGGGGAAAAAACCTGGTGCCTCTA
  5   1   2       bld Emb4 5g                         IMAGE:5543439.5p                                                                                                                                                                                                                                                                                                             GACTTAACtttttttttCTCGTTGTCATCTCGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGTGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCATATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAATCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTCAGGCCAACCCTCTGCTGGAAACCCTTTGGTAATGCCAAGACTGGTGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCCTCAAGAATCCATTTTGGAACTACAGGGAAAACTGTCTTCACGCTGATATTGAAACATATCCTGCTGGAAAAAGTCCAGAAGTACAATTCCACCTTTCAACCA
  5   1   2       chi Emb4                            IMAGE:5571708.5p                                                                                                                                                                                                                                                                                                              GGGACTTAACTTTTTTCTTATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAGGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTCGTAGACGATGCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGCCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTTAACAGATCGTGNAAAACCAGTCTGGCCCTTAATTACTGGAAAAATCCGGGGGCAGGAAAAGACTGTGAACCCCCAAGCGTGGTCATCCCAGTAATTTTTGCAAACCAATTGGCAGGAACTTTGGAAAAACCCTGGGAAAGGAAAGAAAGGGAATTCTTCCCAAAAAGCTTTGCCAGGGGAAAACCCTTGGAAAGAAATCAAATTTCCTTTCCGGGGCCAaaaccccctttgccttgggaaaaccccttttgggaaaagggccccaaaaaattggggggaaaaaaaaTG
  5   1   2       bld Emb4 5g                         IMAGE:5537064.5p                                                                                                                                                                                                                                                                                                               CTTAACtttttttttCTCGTTGTCATCTCGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGTGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCATATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAATCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGGAAAGAAGAAGGAACTCTCCCACAGCTTTGCAGGGAAACCTGGAAGATCAAATCATTCAGGCCCAACCCTCTGCTGGAAACCTTTGGTAATGCCCAGACTGGGGAAAAATGACAACTTCTTCTCGTTTTGGTAAAATCCTTCAGAATCCCTTTTTGGAACTACCGGAAAACGGTCTTCCGCCTGAAATTGAAACTTATCTGCTGGGAAAAATCC
  5   1   2       bld Emb4 5g                         IMAGE:5541838.5p                                                                                                                                                                                                                                                                                                                  AACtttttttttCTCGTTGTCATCTCGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTGGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGTGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCATATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAATCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTCAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCCAGACTGTGGAGAAATGACAACTCCTCCTCGTTTTGGGAATTTCCTCAGAATCCCATTTTTGGAACTACAGGGAAAACTGGCCTTCAGCTTGATATTGGAAACATATCCTGCTTGGGAAAAAGTCCAAAAGTTACATTTCCAGGTTTTTCCGCTAGAGAACAAAGTTTATCCCCCTTCC
  5   1   2       bld Emb4 5g                         IMAGE:5542225.5p                                                                                                                                                                                                                                                                                                                  AACtttttttttCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGGCTATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGATGATCCAAAGGAACTTTATGTCAAAGGTTTCGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTAAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGACAATCTGGCGCAGGAAAGACTGTGAACACCAAGCGCGCCATCCAGCATTTTGCCACCATTGCACCACTTGGGAGATGCTGCGACACACCAAGGAACTCTCCCACACCTCTGCAGGGGAAACCTTGCCAAGATCCAACCCATTGGAGGCCCAACCCCTCCGCTTGGAAAACCTTTTTGGTCATCGGCCAAAACCTGGTCCGAAACATCGAACAACCTCCCTCTTTGGCTTTCCTGTGTTACATTCTACGTCACTTACAGCCCACGTTCTCCGGGTCACATCTCCCCTAGGGGTCCAGAAATCTGCCGCACCTTCACGAGCCATAGGGGAATCAC
  5   1   2       bld Emb4 5g                         IMAGE:5572402.5p                                                                                                                                                                                                                                                                                                                   ACtttttttttCTCGTTGTCATCTCGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGTGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCATATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAATCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAAAACCCAGCGTGTCATCCAGTATTTTGCAACAATTGCACCACTTGGAGATGCTGGGAAAGAAGAAGGAACTCTCCCACAGCTTTGCAAGGGAAACCTGGGAAGATCAAATCATTTCAGGCCAACCCCTTCTGCTGGAAACCCTTTTGGTAAAGCCCAAGACTGGGGAAAAATGACAAACTTCCTCTCCGTTTTTGGGAAAATTTCTTCAGAAATCCATTTTTGGAAACTTCCAGGGAAAAATGGGCCTTCCAGCCTGAATAATGGAAACAATAATCTTGGCTGGAGAAAACGTCACAAAAGTTTCCATTTCCCAGCCT
  5   1   2       bld Emb4 5g                         IMAGE:5513890.5p                                                                                                                                                                                                                                                                                                                   ACtttttttttCTCGTTGTCATCTCGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGTGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCATATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAATCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGGAACTCTCACAGCTTGCAGGNAAACTGGAGATCAATCATCAGGCCACCTCTGCTGGAGCCTTNGGTATGCAGACTGGAGATGACACTCTCTCGTTTGGTAATCTCAGATCATTTGAA
  5   1   2       bld Emb4 5g                         IMAGE:5514733.5p                                                                                                                                                                                                                                                                                                                   AACttttttttCTCCTTGTCATCTCGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGTGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCATATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAATCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGGAACTCTCCNACAGCTTGCAGGGAAACCTGGAAAGATCAATCATTCAGGCCACCCNTCTGCTGGNAAGCTNNTGGTATGCCNAGACTGTGAGAAATGACNACTCCTCTCGTTTTGGTAATTCAT
  5   1   2       bld Emb4      in                    IMAGE:4202462.5p                                                                                                                                                                                                                                                                                                                    CtttttttttCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGGCTATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGATGATCCAAAGGAACTTTATGTCAAAGGTTTCGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTAAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTT
  5   1   2       bld Emb4 5g                         IMAGE:5542292.5p                                                                                                                                                                                                                                                                                                                    AACTTTTTTTCTTATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAGGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATGCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATATACACCTATTCTGGCCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGACGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAATCTGGAAGATCAAATCATTCAGGCCAACCCTCTTCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGGTAAATTCATCAGAAATCCATTTTGGAACAACCAGGAAAACTGGTCTTCCACCTGATATTTGAAACATATTCCTGCTGGGAAAAATCCCAAAAGTTACATTTCCAGCTTTTTAAA
  5   1   2       bld Emb4 5g                         IMAGE:5514689.5p                                                                                                                                                                                                                                                                                                                    CtttttttttCTCACCTTTATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGGCTATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGATGATCCAAAGGAACTTTATGTCAAAGGTTTCGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTAAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGAGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGGAACTCTCNCACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTGAGGGCAATCCTCTGCTGGAAGCCTTTGGGTATGCCAGACTGTGAGAAAATGACACTCCTCTCGTTTT
  5   1   2       bld Emb4 5g                         IMAGE:5537170.5p                                                                                                                                                                                                                                                                                                                     CttttttttCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGGAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTCGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTTACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACTTATTCTGGCCTTTTCTGCGCCACTGTCAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGCTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGAAGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCANGGAAACCTGGAAGATCAAATCATTGAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTTGGTAAATTCATCAGAAATCATTTTTGGAACTACAGGAAAACTGTCTTCAGCTGATATTGAAACATANTCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCCGNCAGAAAGAAGTTATCACCATCTTCTATCAGATCTTTAACAAAC
  5   1   2       bld Emb4 5g                         IMAGE:5543467.5p                                                                                                                                                                                                                                                                                                                     tttttttttCTCGTTGTCATCTCGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTGGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGTGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCATATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAATCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCCACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGGAACTCTCCACAGCTTGCAGGGAAACCCTGGAAATCAAATCATTCAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAAACTTGGGAGAATTGACAACTTCTTCTCGGTTTGGAAAATTCCATCAAAATCCATTTTTGGAAACACCGGGAAAACTGGTCCTCCGCCTGAATATTGAAACATCTTCTGCTTGGAAAAGTCCCAAAATTACATTTCCACCTTTCGGCCAAAAGGAATTTTCCCCATCCTTCA
  5   1   2       bld Emb4 5g                         IMAGE:5514181.5p                                                                                                                                                                                                                                                                                                                     ACTTTTTTTCTTATCTTTATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAGGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATGCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATATACACCTATTCTGGCCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGACGCTGGANAGAAGAAGAACTCTCCACAGCTGCAGGNAATCTGGAGATCAATCATTCAGCCACCTCTCTGGAGCTTGGTATGCAGACGTGAAATGCACTCTCTCGTTGTAATCTC
  5   1   2       bld Emb4      in                    IMAGE:4957011.5p                                                                                                                                                                                                                                                                                                                      CTTTTTTTCTTATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAGGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATGCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATATACACCTATTCTGGCCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAA
  5   1   2       bld Emb4 5g                         IMAGE:5542963.5p                                                                                                                                                                                                                                                                                                                      ttttttttCTCATTGTCATCTCGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTGGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGTGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCATATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAATCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTCAGGCCAACCCTCTGCTGGAAGCCCTTTGGTAATGGCCAGACTGTGAGAAATGACACTCCCTCTCGNTTTTTGGTAAATTCATCAGAAATCCATTTTGGAACTACAGGGAAAACTGTCTTCAGCCTGATATTGGAACATATCCTGCCTGGAAAAAGNTCCAGAAGTTACATTCCAAGCTT
  5   1   2       bld Emb4      in                    IMAGE:4201811.5p                                                                                                                                                                                                                                                                                                                       TTTTTTTCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGGAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAACAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTCGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTTACTGTCAAAGACAGTCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACTAATTCTGGCCTTTTCTGCGCCACTGTCAACCCCTACAAGTGGGTGACAGTGTACAACCGTGAAGATGTTGCCGGGGTACGGAGGAAAAAGGGTTTGGAAGCCCCCCCTCAAATTTTT
  5   1   2       bld Emb4 5g                         IMAGE:4930134.5p                                                                                                                                                                                                                                                                                                                       TTTTTTTCTCATCTTCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGGAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTCGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTTACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACTTATTCTGGCCTTTTCTGCGCCACTGTCAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGCTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGAAGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAAACTGGAAGATCAAATCATTGAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCCAGACTGTGAGAAATGACAACTCCTCTCCTTTTTGGTAAAATTCATCANGGATCCATTTTTTGGGAACTACAGGGAAAAACTGTCCTTCACCCTGGATAATTGGAACCATATTCCTGCCTGGGAAAAA
  5   1   2       bld Emb4      in                    IMAGE:4960269.5p                                                                                                                                                                                                                                                                                                                            GACGCGTGGGCTTCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAGGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATGCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATATACACCTATTCTGGCCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCCAGGCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAAC
  5   1   2       bld Emb4 5g                         IMAGE:4680391.5p                                                                                                                                                                                                                                                                                                                                CTTCGCCATCTCGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTGGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCATATAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGTGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAAGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCATATTTTCTCCCTTTCTGATTACGCCTATCAAGCCATGTTAACAGATCGTGAAAATCAGCCTGGCCTTATTACTGGAGAATCCGGTGCAAGAAAGACTGCGAAC
  5   1   2       bld Li1  5g3  in                    IMAGE:3398152.5p                                                                                                                                                                                                                                                                                                                                     TCATCTGGACTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGGAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACAATCCAAAGGAACTTTATGTCAAAGGTTTCGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTTACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAAGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACTTATTCTGGCCTTTTCTGCNCCACTGTCAACCCCTACAAGTGGCTGCCAGTGTACAACCC
  5   1   2       bld Emb4 5g                         IMAGE:4724650.5p                                                                                                                                                                                                                                                                                                                                              CTGAAAGCAACCAGCAATCATGGGTGATGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGGAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTCGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTTACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACTTATTCTGGCCTTTTCTGCGCCACTGTCAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGCTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGAAGCTGGAAAGAAGAAAGGACTCTCCCACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTGAGGGCAACCCTCTGCTGGAAGCCCTTTGGTAATGGCCAGACTGGTGAGAAATGACAACTCCTCTCGGTTTGGTAAAATTCCTCAGGAATCCTTTTTGGGAACTACAGGGAAAACTGGGCTTCAGCTGATATTGAAACATATCTGCCTGGGAAAAGTCCAGAGTTACATTTCCAGGTTTTCGGCAGAAAGGAAGTTTTTCCCATCCTTTTAATCGGATTCTTTAACAATAAGAAAGCCCGGACCTT
  5   1   2       bld Emb4      in                    IMAGE:4203751.5p                                                                                                                                                                                                                                                                                                                                                                      TGAAGGAGAGATGTCCATCTTCGGCGAGGCCGCACAATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTNTTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTTTGATGACCCATTTGAATGAAGCTTCTGGCCTGTATAACCTCAAAGAGCGTTATGCTGGATGGATGATCTACACCTATGCTGGTCTTTTC
  5   1   2       bld Emb4                            IMAGE:4970434.5p                                                                                                                                                                                                                                                                                                                                                                                                  CGGACGCGTGGGCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTGGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGTGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAAC
  5   1   2       bld Emb4                            IMAGE:4970470.5p                                                                                                                                                                                                                                                                                                                                                                                                          ATTTCTCAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTGGACGATCCAAAGGAACTTTATGTCAAAGGTTTGGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGTGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCATATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAATCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTCAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAATTCATCAGAATCCATTTTGGACTAN
  5   1   2       bld Emb4                            IMAGE:4957457.5p                                                                                                                                                                                                                                                                                                                                                                                                                CAGAAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGATGATCCAAAGGAACTTTATGTCAAAGGTTTCGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTAAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACCCCCACCGTGTCATCCAGTATTTTGCAACCATTGCA
  5   1   2       bld Tbd3      in                    IMAGE:3548434.5p                                                                                                                                                                                                                                                                                                                                                                                                                  GGAAAAGTGATAAAGAACGTTTGGAGGCACAGAGCAAGCCTTTTGATGCCAAGAACACTGTATTTGTAGACGATCCAAAGGAACTTTATGTCAAAGGTTTCGTTACAGCCAGGGAAGATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTTACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACTTATTCTGGCCTTTTCTGCGCCACTGTCAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGCTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGAAGCTGGAAAGAAGAAAGAACTCTCCAACAGCTTGCAAGGAAACCTGGTAGATCAAATCATGGATGCCAACCCTGTGCTGGATACCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTTCGTTTGGTAAATTTCTCATGGTCCATTTT
  5   1   2       bld Emb4                            IMAGE:4724657.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACGCGTCCGGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGTGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCTGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCATATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAATCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTCAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCATCAGAATCCATTTTGGAACTACAGGAAAACTGTCTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAGCAGAGAGAAGTTATCACATCTTCTATCAGATCTTATCAAATAAGAAGCCAGAACTTGTTGAGATGCTTCTGGTCACACCAACCCATATGACTTCCCTCCATCAGTCAGGGAGAGATCGTTGTGAAGAGTATTAGTGATGAAGAGGAATTGATGGCCCCAGATAGTGCCCATGGATATCTTGGGTTTTCATCCAGGAAGAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCA
  5   1   2       bld Emb4                            IMAGE:4682395.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTAACTGTCAAAGAAAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATAGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTAAAAGAGCGTTATGCTGCATGGATGATCTACACCTATTCTGGTCTTTTCTGCGCCACTGTAAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGTTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGAGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTGAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCATCAGAATCCATTTTGGAACTACAGGAAAACTGTCTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAGCAGAAAGAAGTTATCACATCTTTCTATCAGATCNTAACAAATAAGAAGCCAGAGCTTTGTTGAGATGCTTNCTGGTCACCACCCACCCATATGACTTCCCATCCATCAGTCAAGGTGGAGATCCGTTGTGAAAAAGTATTTAATGGATGAAGGATGAATTTGATGGGCCACCAGATAATGCCCATTGGACCATCCTTGGGGTTTTCAATCAAGAAA
  5   1   2       e>3                            Xl3.1-IMAGE:4684082.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACTTATTCTGGCCTTTTCTGCGCCACTGTCAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGCTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGAAGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTGAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCATCAGGATCCATTTTGGAACTACAGGAAAACTGTCTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAGCAGAAAGAAGTTATCACATCTTCTATCAGATCTTAACAAATAAGAAGCCAGAACTTGTTGAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGAGGAATTGATGGCCACAGATAATGCCATTGACATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACATGAAATTCAAGCAAAAGCAAAGGGAAGAGCAGGCTGAACCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCCTCACTCTGCTGATTTG
                                                  Xl3.1-CHK-1012696377                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACTTATTCTGGCCTTTTCTGCGCCACTGTCAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGCTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGAAGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTGAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCATCAGGATCCATTTTGGAACTACAGGAAAACTGTCTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAGCAGAAAGAAGTTATCACATCTTCTATCAGATCTTAACAAATAAGAAGCCAGAACTTGTTGAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGAGGAATTGATGGCCACAGATAATGCCATTGACATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACATGAAATTCAAGCAAAAGCAAAGGGAAGAGCAGGCTGAACCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCxxxACTCTGCTGATTTGCTCAAG
  5   1   2       bld Emb4                            IMAGE:4680045.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATGGCAAAGTAACTGTGAAGACTGATGATGGAAGAACAGTTACTGTCAAAGACAGCCAAATTTACCCCCAGAACCCTCCCAAGTATGATAAAATTGAAGACATGGCTATGATGACCCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACTTATTCTGGCCTTTTCTGCGCCACTGTCAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGCTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGAAGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTGAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCATCAGAATCCATTTT
  5   1   2       bld Tbd2                            IMAGE:3200128.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAATTGAAGACATGGCTATGATGACTCATTTGAATGAGGCTTCTGTCCTGTATAACCTCAAAGAGCGTTATGCTGCATGGATGATCTACACTTATTCTGGCCTTTTCTGCGCCACTGTCAACCCCTACAAGTGGCTGCCAGTGTACAACCCTGAGGTTGTTGCCGGCTACAGAGGGAAAAAGCGTATGGAAACCCCCCCTCACATTTTCTCCCTTTCTGATAACGCCTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGAAGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTGAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCATCAGGATCCATTTTGGAACTACAG
  5   1   2      seed Emb4      in                    IMAGE:4959244.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTATCAAGCCATGTTAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGAAGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTGAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCATCAGGATCCATTTTGGAACTACAGGAAAACTGTCTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAGCAGAGAGAAGTTATCACATCTTCTATCAGATCTTAACAAATAAGAAGCCAGAACTTGTTGAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGAGGAATTGATGGCCACAGATAATGCCATTGACATCTTGGGTTTCAATC
  5   1   2       bld Emb4                            IMAGE:5514838.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTATCAAGCCATGCTATAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGACGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTCAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCATCAGAATCCATTTTGGAACAACAGGAAAACTGTCTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAGCAGAGAGAAGTTATCACATCTTCTATCAGATCTTAACAAATAAGAAGCCAGAACTTGTTGAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATTGTTGTGAAGAGTATTAATGATGAAGATGAATTGATGGCCACAGATAGTGCCATTGATATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACTTGAAATTTAAGCAAAAGCAAAGGGAAGAGCAGGCTGAGCCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCCTCACTCTGCTGATTTGCTCANGGGCTTGTGTTACCCAGN
  5   1   2       bld Emb4                            IMAGE:5513985.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGACGCGTCCGCCCACGCGTCCGGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGAGTCATCCANGTATTTTGCAACAATTGCAGCACTTGGAGATGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTGAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCATCAGAATCCATTTTGGAACTACAGGAAAACTGTCTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAGCAGAAAGAAGTTATCACATCTTCTATCAGATCTTAACAAATAAGAAGCCAGAGCTTGTTGAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGATGAATTGATGGCCACAGATAATGCCATTGACATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACATGAAATTCAAGCAAAAGCAAAGGGAAGAGCAGGCTGAACCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCCTCACTCTGCTGATTTGCTCAAGGGCTTGTGTTACCCAGAGTCAGGNTGGGCATGATTNGTCACAANNGACGACTGTCCTCAGTCTATACGCTGTAGTGCCTGAGCA
  5   1   2       bld Emb3      in                    IMAGE:3400254.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAACAGATCGTGAAAACCAGTCTGTCCTTATTACTGGAGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGAAGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTGAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCATCAGGATCCATTTTGGAACTACAGGAAAACTGTCTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAACAGAAAGAAATTATCACATCTTCTATCAGATCTTAACAAATAAGAAGCCAGAACTTGTTGAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAAGGTGAGATCATTGTAAAGAATATTAATGATGAAGAGGAATTAATAACCACAGATAATACCAATTACATTGTTAATTTTAATCAAGaaaaaaaa
  5   1   2      skin Tad1      in                    IMAGE:6877610.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGAGAATCCGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGACGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTCAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCTTCTCGTTTTGGTAAATTCATCAGAATCCATTTTGGAACAACAGGAAAACTGTCTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAGCAGAGAGCAGTTATCACATCTTCTATCAGATCTTAACAAATAAGAAGCCAGAACTTGTTGAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGATGAATTGATGGCCACAGATAGTGCCATTGATATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGGCATNCTACAAAAATGACTTGGTGGCTGGTCATGCCATTATGGGCAACCTTGgaaaatccaggcaaaaaccaaaagggaaaaaaccgggcctaaccctgaaaaaccgtttaaagggggggcgaacaaaaaatttgcgcttatccccgagggggggggcgcccccccaaaaaaaattttgggtgtgggggggggtggggAAAAGAAATTAATATNAATGTTTTCTCACACCCAATCAACCCGCCCCGCCTCTATTATTGCTTGTGTTTTTTGGAGNCGCTCTATTCATACCCCCGGGTAC
  5   1   2       bld Tad1      in                    IMAGE:6880118.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGAATCTGGTGCAGGAAAGACTGTGAACACCAAGCGTGTCATCCAGTATTTTGCAACAATTGCAGCACTTGGAGAAGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTGAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCATCAGGATCCATTTTGGAACTACAGGAAAACTGTCTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAGCAGAAAGAAGTTATCACATCTTCTATCAGATCTTAACAAATAAGAAGCCAGAACTTGTTGAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGAGGAATTGATGGCCACAGATAATGCCATTGACATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACATGAAATTCAAGCAAAAAGCAAGGGGAAAAGCAGGCTGAACCTGATAGCGTTTGAGGTGGCTGAACAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAAGCTTTGGTGTTACCCCAAAGTCAAGGTCGGGCAATGAATTTGTCACCCAAAGAACAGACTGTCCCCTCAGGTTCTATAACGCCTGTAGGTGC
  5   1   2       bld Emb4                            IMAGE:4684082.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGGAGAAGCTGGAAAGAAGAAGGAACTCTCCAACAGCTTGCAGGGAAACCTGGAAGATCAAATCATTGAGGCCAACCCTCTGCTGGAAGCCTTTGGTAATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCATCAGGATCCATTTTGGAACTACAGGAAAACTGTCTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAGCAGAAAGAAGTTATCACATCTTCTATCAGATCTTAACAAATAAGAAGCCAGAACTTGTTGAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGAGGAATTGATGGCCACAGATAATGCCATTGACATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACATGAAATTCAAGCAAAAGCAAAGGGAAGAGCAGGCTGAACCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGTCGGCAATGAATTTGTCCACAAAGGACAGACTGTCCCTCAGGTCTATAACGCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGGGGATGGCCACTCGTATTAACCACAGCTGGATACTAAGCAACAAGACAATTCTTCCTTGGGGTGGCTGGATATTGCCTGGGTTCCAAATCTTTGACTTTACCAGCTTGGAGCAACTCTGGATCAACTTTACCATGAAAACTGGACAGGTTTTCCATCACCCCATGGTCCGTCCTGGAACCGGAAGAATTCCCAAAAGGAACGAATT
  5   1   2       bld Emb4                            IMAGE:5572839.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATGCCAAGACTGTGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCATCAGGATCCATTTTGGAACTACAGGAAAACTGTCTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAGCAGAAAGAAGTTATCACATCTTCTATCAGATCTTAACAAATAAGAAGCCAGAACTTGTTGAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGAGGAATTGATGGCCACAGATAATGCCATTGACATCTTGGGTTTNCATCAAGAAGAANAGCTTGGCATCTACNAAATGACTGGTGCTGTCATGCATTATGGGCAACATGAAATTCAAGCAAAAGCAAAGGGAAGAGCAGGCTGAACCTGATAGCGTTGAAGTGGCTGACAAATTGCTTATCTGAGGGGCCTCAACTCTGCTGANTTGCTCAGGGCTTGTGGTACCCAAGAGCCAGGTCCGCAATGAATTTGTCAACAAAGGACGAACTGTCCCTCAGGGCTATAAACCCTTAAAGGGGCCCGAAACAAAGCTGGGTTTTTAAAAAAAGGGGTTTTGGGGGGAGGCGGCCCTCGCATTTAAACCAAAGGCGGGGGATTCTTAAGGCACCCCAGGAAAATTACTTCTTCTTTgggggggggggggggaaaaaatgtggcgggggggtccccaaaaaatctttgtggcccttttaaaaaccccccGTTGGGGAAACCCATCCTTTTCA
  5   1   2       e>3                              Xl3.1-xlk117e20ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTGTTGAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGATGAATTGATGGCCACAGATAATGCCATTGACATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACTTGAAATTTAAGCAAAAGCAAAGGGAAGAGCAGGCTGAGCCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGTCGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCTCAGGTCTATAACTCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTTGAAATCTTTGACTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGAGTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGACACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGCTCAACTTATTACTTGCACCCAAGCTCTTTGCAGAGGATTTTTGATGAGGGTTGAGTTCAAGAAAATGATGGAAAGAAGGGAGGCCATATATCTCATTCAGTACAATTTGAGGTCGTTCATGAATGTCAAACACTGGCCATGGATGAAACTGTACTTCAAGATCAAGCCTCTCCTGCAGAGTGCTGAGACTGAGAAAGAGATGGCAAACATGAAGGAAGAATTTGAGAAGACCAAGGAAGCACTGGTAAAAGCAGAAGCAAGAAAGAAAGAACTGGAGGAGAAAATGGTTTCCCTGCTCCAGGAAAAGAATGATCTAGTCCTGCAGGTTCAATCGGAAGGTGAAACCTTGGCTGATTCTGAGGAGAGATGTGAAGGGCTCATCAAAAGCAAAATTCAGCTGGAGTCTAAACTAAAGGAATTAACAGAAAGACTTGAAGATGAAGAAGAAAGCAATGCAGAACTAACAGCAAAGAAGAGGAAACTGGAGGATGAATGTTCTGAGCTTAAGAAAGACATTGATGACCTTGAACTTACGTTGGCCAAAGTAGAAAAGGAGAAGCATGCCACAGAAAACAAGGTCAAAAACCTTACTGAAGAAATGGCAGCTCTCGATGAGAACATTTCCAAACTGTCCAAAGAAAAGAAGGCCCTTCAAGAGGCTCACCAACAAACACTTGATGACCTGCAAGCTGAAGAGGACAAAGTCAGTTCTCTGTCAAAAGCAAAGACAAAGCTAGAACAGCAAGTTGATGATCTGGAAGGTTCCCTGGAACAAGAGAAGAAACTTCGTCTTGACTTTGAGAGAGCCAAGAGAAAGCTTGAAGGAGATCTGAAACTGACCCAGGAAACTGTTATGGACCTTGAGAATGATAAACAACAAACTGAAGAAAAACTTAAAAAGAAAGACTTTGAAATAAGCCAGCTGCAAGGAAAGATAGAAGATGAACAGTCCCTGGGCATTCAGTTGCAGAAAAAGATCAAGGAACTGCAGGCTAGAATTGAAGAACTTGAGGAAGAAATTGAAGCTGAACGTGCAGCTCGTGCAAAGGTAGAGAAACAAAGGGCTGATCTTTCCAGGGAACTTGAGGAGATCAGTGAGAGACTTGAAGAAGCTGGAGGTGCAACATCTGCTCAGATTGAGATGAACAAAAAACGTGAAGCTGAGTTCCAGAAACTGAGACGTGACCTGGAGGAGGCAACCCTTCAGCATGAAGCCACTGCTGGTGCCCTGCGCAAAAAACACGCTGATAGCGTAGCTGAGCTTGGGGAGCAAATTGATAACCTGCAGCGGGTTAAACAAAAGCTTGAGAAAGAAAAGAGTGAACTGAAGATGGAGACTGATGATCTTGCCAGCAACTTGGAAAATGTATCCAAATCAAAGGCTAATCTTGAAAAGGTTAATCGTGTCCTTGAGGACCAACTTAGTGAAGTGAAGGCAAAGGATGATGAGCGCCAGCGTCTCCTCAATGACCTCACTACTCAAAAGGCTCGCTTGCAGACTGAGACTGGTGAGCTCTCCCGTCAGCTTGAAGAGAGGGAATCTCTAATTTCTCAGCTCTCAAGAGGAAAGCAGGGATTTACTCAGCAAGTTGAAGAACTGAAGAGGCAACTTGAAGAGGAAACAAAGGCTAAGAATGCCCTTGCTCATGCGCTACAATCATCCCGTCATGACTGTGACTTGCTTCGAGAACAATTTGAGGAAGAGCAGGAGGCCAAGGCTGAACTTCAGCGCTCACTGTCCAAAGCCAATGGTGAAGTTTCACAATGGAGGACCAAATATGAAACTGATGCAATTCAGCGTACTGAGGAGCTTGAAGAAGCCAAGAAGAAACTTGCTCAGCGTTTACAGGATGCTGAGGAGCAAGTTGAAGCTGTGAATTCCAAATGTGCCTCCTTGGAGAAGACTAAGCAGAGACTGCAATCTGAAGTTGAGGACTTGATGGTTGATGTTGAGAGAGCAAATGGTGCAGCAACTGCTCTTGATAAGAAGCAGAGAAACTTTGATAAGGTCCTGGTAGAATGGAAACAGAAGTATGAAGAGGGCCAGGCTGAATTGGAAGCAGCTCTGAAGGAATCTCGCAGCCTGAGCACTGAGATCTTCAAGATGAAGAATGCTTATGAGGAATCTCTGGAGCATGTTGAAACTCTGAAACGTGAAAACAAGAACCTTCAACAGGAGATTTCAGATCTGACAGAACAGATTGGTGAAAGTGGAAAATCAGTTATTGAATTGGAGAAGGTCAAGAAGCAGGTGGAGCAAGAAAAGAATGATCTCCAGGCTGCTCTGGAAGAAGCAGAGGGATCTCTGGAACATGAAGAAGCCAAGATTCTGCGCATCCAGCTTGAACTGAACCAGGTGAAATCTGAAGTGGACAGGAAAATTGCAGAGAAGGATGAGGAAATTGAACAGTTAAAGAGAAACAGCCAGAGGGCTATCGACACCATGCAGAGCACACTGGACTCTGAAATCAGGAGCAGAAATGATGCATTGAGACTGAAGAAGAAGATGGAAGGTGATCTGAATGAGCTTGAGATCCAGCTGGGTCACGCCAACCGTCAAGCTTCTGAAGCACAGAAACAGCTCAGGAATGTCCAGGCCCAGTTCAAGGAGTCCCAGCTCCAGTTGGATGATGCAGTTAGGGGACAGGAGGACCTGAAGGAACAGGTTGCTGTAATTGAGCGCAGAAATAACTTGTTTCAAGCTGAAATTGAAGAAAACAGGGCTGCTCTGGAACAGACAGAAAGATCTCGTAAGATTGCAGAACAGGAGCTCCTAGATGCAAGTGAACGTCTTCAGCTGTTTCATTCACAGAACACAAGTCTCATTAACAGCAAGAAGAAACTTGAAAGTGACATCAGTCAGCTACAGAATGAGGCTGAGGAAGCTGTCCAAGAATCCAGAAATGCTGAAGAGAAGGCAAAGAAGGCCATAACAGATGCTGCCCTGATGGCAGAAGAACTGAAGAAGGAACAGGACACCAGTGCTCACTTAGAAAGGATGAAGAAGAACCTTGAACAGACTGTGAAGGACCTGCAAAATCGCCTGGATGAAGCTGAACAACTGGCAATGAAGGGTGGCAAGAAGCAGCTCCAGAAACTGGAATCCAGGGTACGGGAACTGGAGAATGAAGTGGAGAACGAACAGAAACGTGGTGTTGATGCTGTGAAAGGTGTCCGTAAATATGAGAGGAGAGTGAAGGAACTCACATACCAGACTGAGGAAGATAAGAAGAACCTTCTGAGACTGCAGGACCTGGTGGACAAACTTCAGTCTAAAGTTAAAGCCTACAAGAGGCAGGCTGAGGAATCTGAGGAACAAGCCAATGCCCACTTGAGCCGCTTCCGTAAGGTTCAGCACGAGCTTGAAGAAGCAGAGGAAAGAGCCGATATTGCAGAGTCCCAAGTGAATAAGCTCAGGACCAAGAGCCGTGATGTTGGAGGCAAGAAAGAGTCTGAAGAGTGAAAACATAGAAGACTGAGGAATGTGGAGGAATGTGAATTTCCATTCCGAATATAGTTTATCAAATGAATTGTAAATAAATTACTTTGACTTGAAGCCTAAAAAAAAAAA
                                                  Xl3.1-CHK-1012685002                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGAGGAATTGATGGCCACAGATAATGCCATTGACATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACTTGAAATTTAAGCAAAAGCAAAGGGAAGAGCAGGCTGAGCCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGTCGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCTCAGGTCTATAACTCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTTGAAATCTTTGACTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGAGTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGACACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGCTCAACTTATTACTTGCACCCAAGCTCTTTGCAGAGGATTTTTGATGAGGGTTGAGTTCAAGAAAATGATGGAAAGAAGGGAGGCCATATATCTCATTCAGTACAATTTGAGGTCGTTCATGAATGTCAAACATTGGCCATGGATGAAACTGTACTTCAAGATCAAGCCTCTCCTGCAGAGTGCTGAGACTGAGAAAGAGATGGCAAACATGAAGGAAGAATTTGAGAAGACCAAGGAAGCACTGGTAAAAGCAGAAGCAAGAAAGAAAGAACTGGAGGAGAAAATGGTTTCCCTGCTCCAGGAAAAGAATGATCTAGTCCTGCAGGTTCAATCGGAAGGTGAAACCTTGGCTGATTCTGAGGAGAGATGTGAAGGGCTCATCAAAAGCAAAATTCAGCTGGAGTCTAAACTAAAGGAATTAACAGAAAGACTTGAAGATGAAGAAGAAAGCAATGCAGAACTAACAGCAAAGAAGAGGAAACTGGAGGATGAATGTTCTGAGCTTAAGAAAGACATTGATGACCTTGAACTTACGTTGGCCAAAGTAGAAAAGGAGAAGCATGCCACAGAAAACAAGGTCAAAAACCTTACTGAAGAAATGGCAGCTCTCGATGAGAACATTTCCAAACTGTCCAAAGAAAAGAAGGCCCTTCAAGAGGCTCACCAACAAACACTTGATGACCTGCAAGCTGAAGAGGACAAAGTCAGTTCTCTGTCAAAAGCAAAGACAAAGCTAGAACAGCAAGTTGATGATCTGGAAGGTTCCCTGGAACAAGAGAAGAAACTTCGTCTTGACTTTGAGAGAGCCAAGAGAAAGCTTGAAGGAGATCTGAAACTGACCCAGGAAACTGTTATGGACCTTGAGAATGATAAACAACAAACTGAAGAAAAACTTAAAAAGAAAGACTTTGAAATAAGCCAGCTGCAAGGAAAGATAGAAGATGAACAGTCCCTGGGCATTCAGTTGCAGAAAAAGATCAAGGAACTGCAGGCTAGAATTGAAGAACTTGAGGAAGAAATTGAAGCTGAACGTGCAGCTCGTGCAAAGGTAGAGAAACAAAGGGCTGATCTTTCCAGGGAACTTGAGGAGATCAGTGAGAGACTTGAAGAAGCTGGAGGTGCAACATCTGCTCAGATTGAGATGAACAAAAAACGTGAAGCTGAGTTCCAGAAACTGAGACGTGACCTGGAGGAGGCAACCCTTCAGCATGAAGCCACTGCTGGTGCCCTGCGCAAAAAACACGCTGATAGCGTAGCTGAGCTTGGGGAGCAAATTGATAACCTGCAGCGGGTTAAACAAAAGCTTGAGAAAGAAAAGAGTGAACTGAAGATGGAGACTGATGATCTTGCCAGCAACTTGGAAAATGTATCCAAATCAAAGGCTAATCTTGAAAAGGTTAATCGTGTCCTTGAGGACCAACTTAGTGAAGTGAAGGCAAAGGATGATGAGCGCCAGCGTCTCCTCAATGACCTCACTACTCAAAAGGCTCGCTTGCAGACTGAGACTGGTGAGCTCTCCCGTCAGCTTGAAGAGAGGGAATCTCTAATTTCTCAGCTCTCAAGAGGAAAGCAGGGATTTACTCAGCAAGTTGAAGAACTGAAGAGGCAACTTGAAGAGGAAACAAAGGCTAAGAATGCCCTTGCTCATGCGCTACAATCATCCCGTCATGACTGTGACTTGCTTCGAGAACAATTTGAGGAAGAGCAGGAGGCCAAGGCTGAACTTCAGCGCTCACTGTCCAAAGCCAATGGTGAAGTTTCACAATGGAGGACCAAATATGAAACTGATGCAATTCAGCGTACTGAGGAGCTTGAAGAAGCCAAGAAGAAACTTGCTCAGCGTTTACAGGATGCTGAGGAGCAAGTTGAAGCTGTGAATTCCAAATGTGCCTCCTTGGAGAAGACTAAGCAGAGACTGCAATCTGAAGTTGAGGACTTGATGGTTGATGTTGAGAGAGCAAATGGTGCAGCAACTGCTCTTGATAAGAAGCAGAGAAACTTTGATAAGGTCCTGGTAGAATGGAAACAGAAGTATGAAGAGGGCCAGGCTGAATTGGAAGCAGCTCTGAAGGAATCTCGCAGCCTGAGCACTGAGATCTTCAAGATGAAGAATGCTTATGAGGAATCTCTGGAGCATGTTGAAACTCTGAAACGTGAAAACAAGAACCTTCAACAGGAGATTTCAGATCTGACAGAACAGATTGGTGAAAGTGGAAAATCAGTTATTGAATTGGAGAAGGTCAAGAAGCAGGTGGAGCAAGAAAAGAATGATCTCCAGGCTGCTCTGGAAGAAGCAGAGGGATCTCTGGAACATGAAGAAGCCAAGATTCTGCGCATCCAGCTTGAACTGAACCAGGTGAAATCTGAAGTGGACAGGAAAATTGCAGAGAAGGATGAGGAAATTGAACAGTTAAAGAGAAACAGCCAGAGGGCTATCGACACCATGCAGAGCACACTGGACTCTGAAATCAGGAGCAGAAATGATGCATTGAGACTGAAGAAGAAGATGGAAGGTGATCTGAATGAGCTTGAGATCCAGCTGGGTCACGCCAACCGTCAAGCTTCTGAAGCACAGAAACAGCTCAGGAATGTCCAGGCCCAGTTCAAGGAGTCCCAGCTCCAGTTGGATGATGCAGTTAGGGGACAGGAGGACCTGAAGGAACAGGTTGCTGTAATTGAGCGCAGAAATAACTTGTTTCAAGCTGAAATTGAAGAAAACAGGGCTGCTCTGGAACAGACAGAAAGATCTCGTAAGATTGCAGAACAGGAGCTCCTAGATGCAAGTGAACGTCTTCAGCTGTTTCATTCACAGAACACAAGTCTCATTAACAGCAAGAAGAAACTTGAAAGTGACATCAGTCAGCTACAGAATGAGGCTGAGGAAGCTGTCCAAGAATCCAGAAATGCTGAAGAGAAGGCAAAGAAGGCCATAACAGATGCTGCCCTGATGGCAGAAGAACTGAAGAAGGAACAGGACACCAGTGCTCACTTAGAAAGGATGAAGAAGAACCTTGAACAGACTGTGAAGGACCTGCAAAATCGCCTGGATGAAGCTGAACAACTGGCAATGAAGGGTGGCAAGAAGCAGCTCCAGAAACTGGAATCCAGGGTACGGGAACTGGAGAATGAAGTGGAGAACGAACAGAAACGTGGTGTTGATGCTGTGAAAGGTGTCCGTAAATATGAGAGGAGAGTGAAGGAACTCACATACCAGACTGAGGAAGATAAGAAGAACCTTCTGAGACTGCAGGACCTGGTGGACAAACTTCAGTCTAAAGTTAAAGCCTACAAGAGGCAGGCTGAGGAATCTGAGGAACAAGCCAATGCCCACTTGAGCCGCTTCCGTAAGGTTCAGCACGAGCTTGAAGAAGCAGAGGAAAGAGCCGATATTGCAGAGTCCCAAGTGAATAAGCTCAGGACCAAGAGCCGTGATGTTGGAGGCAAGAAAGAGTCTGAAGAGTGAAAACATAGAAGACTGAGGAATGTGxxxxxxTxxxxxTTTCCATTCCGAATATAGTTTATCAAATGAATTGTAAATAAATTACTTxxAxxxGAAGCCTAAAAAAAAAAAAAAAAA
  5   1   2       bld Emb3      out                   IMAGE:3399052.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGACAACTCCTCTCGTTTTGGTAAATTCATCAGGATCCATTTTGGAACTACAGGAAAACTGTCTTCAGCTGATATTGAAACATATCTGCTGGAAAAGTCCAGAGTTACATTCCAGCTTTCAGCAGAAAGAAGTTATCACATCTTCTATCAGATCTTAACAAATAAGAAGCCAGAACTTGTTGAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGAGGAATTGATGGCCACAGATAATGCCATTGACATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACATGAAATTCAAGCAAAAGCAAAGGGAAGAGCAGGCTGAACCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATG
  5   1   2       bld Emb4                            IMAGE:5542726.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAAGTTATCACATCTTCTATCAGATCTTAACAAATAAGAAGCCAGAACTTGTTGAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGAGGAATTGATGGCCACAGATAATGCCATTGACATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACATGAAATTCAAGCAAAAGCAAAGGGAAGAGCAGGCTGAACCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGTTGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCTCAGGTCTATAACGCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTCGAAATCTTTGACTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTTGAGTGGGAGGTTATCGAACTTTGGTATGGATTTGGGCTGGCCGCATTGAACCTTATTGAGAAAGCCCCCTGGGGGATCTTTCCTCCATCCCTTGAAAAACCAATGGCCTTGGTTCCCCCCAAGTCCCACTGGACAAATTCCTTTCCCAGGACCCACACTTATATTGGACCAAACATTTCTGGCGGCAAAGAAGGCA
  5   1   2       bld Emb4                            IMAGE:5515312.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACAAATAAGAAGCCAGAGCTTGTTGAGATGCTTCTGGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGATGAATTGATGGCCACAGATAATGCCATTGACATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACATGAAATTCAAGCAAAAGCAAAGGGAAGAGCAGGCTGAACCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGTTGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCTCAGGTCTATAACGCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTCGAAATCTTTGACTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGAGTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAAGCACTGGGTATCTTCTCCATCCTTTGAGAACAGTGCATGTTTCCCAAGTCCACTGACTATTTCTTTCAGGAA
  5   1   2       bld Emb4                            IMAGE:4680586.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTCACCACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGATGAACTGATGGCCACAGATAGTGCCATTGACATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACTTGAAATTTAAGCAAAAGCAAAGGGAAGAGCAGGCTGAGCCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAAGTTGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCACAGGTCTATAACTCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTTGAAATCTTTGACTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTTCATCACCACATGTTCGTCCTGGAGCAGGAGGGATACNAGAAA
  5   1   2       bld Tbd4                            IMAGE:4059121.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGGACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGTTTATTAATGATGAAGAGGAATTGATGGCCACAGATAATGCCATTGACATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACATGAAATTCAAGCAAAAGCAAAGGGAAGAGCAGGCTGAACCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGTCGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCTCAGGTCTATAACGCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTCGAAATCTCTGACTTTAACAGCTTGGAGCAGCTCTGCATCAACTGTACCAATGAAAAACTGCAACAGTTGTTCAATCACCACATGTTCGTCACTGAGCACGATGAATACAAGAAGGAATGAATTGAGTGGGAGTTTATCGACTCTAGTATGGATTATGCTGCCTGCATTGAGCTTATTGACACGCCACTGGGTATCTTCTGCATCCTTGAAGAGCAGTGCATGTACCGCTAGTCCACTGACAATGCTTTCAGGGACGATATATGTGAGACACATATTGGCAAATGCGAGAAC
  5   1   2       bld Emb4                            IMAGE:5572681.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGATGAATTGATGGCCACAGATAATGCCATTGACATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACATGAAATTCAAGCAAAAGCAAAGGGAAGAGCAGGCTGAACCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGTTGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCTCAGGTCTATAACGCTGTAGGTGCCCTNAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTTGAAATCTTTGACTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTTGAGTGGGAGTTTATCGACTTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTTCAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAAGAAAAGGCAGAAGCTC
  5   1   2       bld Emb4                            IMAGE:4679966.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAACCCATATGACTTCCCATCCATCAGTCAGGGTGAGATCGTTGTGAAGAGTATTAATGATGAAGATGAACTGATGGCCACAGATAGTGCCATTGACATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACTTGAAATTTAAGCAAAAGCAAAGGGAAGAGCAGGCTGAGCCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAAGTTGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCACAGGTCTATAACTCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTTGAAATCTTTGACTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAC
  5   1   2       bld Emb4      in                    IMAGE:4959667.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAAGAGGAATTGATGGCCACAGATAGTGCCATTGATATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACTTGAAATTTAAGCAAAAGCAAAGGGAAGAGCAGGCTGAGCCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGTCGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCTCAGGTCTATAACTCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTTGAAATCTTTGATTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGATTGGGAGTTTATTGACTTTGGTATGGATTTGGCT
  5   1   2       chi Emb4      in                    IMAGE:4202334.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACGCGTGGGTGCAGAGTGCCATTGATATCTTGGGTTTCAATCAAGAAGAAAAGCTTGGCATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACTTGAAATTTAAGCAAAAGCAAAGGGAAGAGCAGGCTGAGCCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGGTCGGAATGAATTTGTCACCAAAGGACAGACTGTCCCTCAGGTAATATTCTGAAAAAATGATAGAAGCAATTGTGATCTTATGGACTTTATGCTCTAATGAACGTTTTCTTTATTTTAGGTCTATAACTCTGTAGGGTGCCCTGACAAGTCTGTTTTTTGAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCCAC
  5   1   2       add Emb4      in                    IMAGE:4957667.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACGGCGTCCGCGGACGCGTGGGTGGACGCACGCGTCCGCTACAAAATGACTGATGCTGACATGTATTATGGCGACTTTATATTCAAACAAAATCAAAAGGAACAGCAAGATAAGCCTGATAGCGATAGATGTGTCTTACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGTCGGCAATGAATTTGTCACCAAAGGACAGACTGTACCACAGGTCTATAACTCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTCGAAATCTTTGATTTTA
  5   1   2       bld Emb4                            IMAGE:4681288.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATCTACAAAATGACTGGTGCTGTCATGCATTATGGCAACTTGAAATTTAAGCAAAAGCAAAGGGAAGAGCAGGCTGAGCCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGTCGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCTCAGGTCTATAACTCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTTGAAATCTTTGATTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGATTGGGAGTTTATTGACTTTGGTATGGATTTGGCTGCCTGCATTGAACTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCATTTGAACGAGTCAGTTATCCAACTCTTCCAGAAGTCTTCTGGTAAACTGCTGTCCATGCTCTACTCTACCTTTGCTGCAGCTG
  5   1   2       bld Emb4                            IMAGE:5570835.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAAAATGACTGGTGCTGTCATGCATTATGGCAACTTGAAATTTAAGCAAAAGCAAAGGGAAGAGCAGGCTGAGCCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAAGTTGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCACAGGTCTATAACTCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTTGAAATCTTTGACTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGATTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGGACTGTGGATTACAACATCNTCTGGCTGGCTTGAAAAGAACAAGGACCACTTGGACGAGTCAGTTATCCACCTCCTTCAGAGGTCTTCTGGTTAAACTGCTGTCCATGCTCTACTCTNACTTTTGCTGCACCTGAACCATGC
  5   1   2       bld Tad1                            IMAGE:6938335.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAAATGACTGGTGCTGTCATGCATTATGGCAACTTGAAATTTAAGCAAAAGCAAAGGGAAGAGCAGGCTGAGCCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAAGTTGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCACAGGTCTATAACTCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTTGAAATCTTTGATTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGATTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGGCAAATGCAAGAAACTTTGAAAAACCCCAAGCCCTGGCAAAAGGAAAAGCCAGAAGCTTCACTTCTCCCCTTGTGGCAATTATGCCTGGGGACTGTTGGATTAACAACATTCTCTGGG
  5   1   2       bld Emb4      in                    IMAGE:4958888.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATGACTGGTGCTGTCATGCATTATGGCAACATGAAATTCAAGCAAAAGCAAAGGGAAGAGCAGGCTGAACCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGTCGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCTCAGGTCTATAACGCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTCGAAATCTTTGACTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAAGAAGGAATTGAGTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCA
  5   1   2       bld Emb4                            IMAGE:4680190.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACGCGTCCGGTCATGCATTATGGCAACTTGAAATTTAAGCAAAAGCAAAGGGAAGAGCAGGCTGAGCCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGTCGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCTCAGGTCTATAACTCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTTGAAATCTTTGATTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGATTGGGAGTTTATTGACTTTGGTATGGATTTGGCTGCCTGCATTGAACTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGAC
  5   1   2       add Emb4                            IMAGE:5440265.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGCATTATGGCAACTTGAAATTCAAGCAAAAGCAAAGGGAAGAGCAGGCTGAGCCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGTCGGCAATGAATTTGTCACCAAAGGACAGACTGTACCACAGGTCTATAACTCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTCGAAATCTTTGATTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGATTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTGTATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGANAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAA
  5   1   2       bld Tad1      in                    IMAGE:6879528.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTCAAGCAAAAGCAAAGGGAAGAGCAGGCTGAACCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGTCGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCTCAGGTCTATAACGCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTCGAAATCTTTGACTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGAGTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAACCCCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATTTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGGAACGAGTCAGTTATCCAACTCTACCAGGAAGTCTTCTGGTTAAACTGCCTGTN
  3  -1   2       bld Tbd3      in                    IMAGE:3549581.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGTTCTCTAGCAGGCTGAACCTGATAGCGTTGAGGTGGCTGACAAAATTGCTTATCTGATGGGCCTCAACTCTGCTGATTTGCTCAAGGCTTTGTGTTACCCAAGAGTCAAGGTTGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCTCAGGTCTATAACGCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTTGAAATCTTTGACTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGAGTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTG
  5   1   2       bld Emb4                            IMAGE:5537142.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGTCAAGGTTGGCAATGAATTTGTCACCAAAGGACAGACTGTCCCTCAGGTCTATAACGCTGTAGGTGCCCTGAGCAAGTCTGTTTTTGAAAAACTGTTCTTGTGGATGGTCACTCGTATTAACCAACAGCTGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTCGAAATCTTTGACTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGAGTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTNGAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAACTGAAACTGATGGCTGCTGGTAAAGGTGGGAAAGaaaaaaaaGGGATCCTCTTTCCAGACTGGGGTCTGGTCTCTTTCGGGAAAAATCTGGGCAAACTTATGACAAACTTGGAGAAACACTCCCCCCTCACCTTTTGGCCGTTGGTTTGAATTCCCAATGAATTCCAAAAATCCCGGGAATCATGGGACAAATCATCTCCCTTTTCCACCC
  5   1   2       bld Tad1                            IMAGE:6939179.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGATACTAAGCAACCAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTTGAAATCTTTGATTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGATTGGGAGTTTATTGACTTTGGTATGGATTTGGCTGCCTGCATTGAACTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCCTTGAACGAGTCAGTTATCCAACTCTTCCAGAAGTCTTCTGTTAAACTGCTGGTCCATGCTCTACTCTACCTTTGCTGCAACTGATGCTGATGCTGGTgggaaaagggtggaaaaagaaaaagaaagGGCATCCGCTTTCCCGACTGGGGTCTGGGTCTCTTTCCAGGGAAAATCCGTGGGCCAAACCTTATTGTCTAACCTTCAGAAAATGCATccccccccTAACTTTTGAGGCCGTTTGTTATATATTTCCCCCAATGGAAAATCCCAAAGCAACCCCCTGGGCAGTCTATTGGTCACCTAC
  5   1   2       bld Emb4                            IMAGE:5543227.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTTGAAATCTTTGATTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGATTGGGAGTTTATTGACTTTGGTATGGATTTGGCTGCCTGCATTGAACTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCATTGAACGAGTCAGTTATCCAACTCTTCCAGAAGTCTTCTGTTAAACTGCTGTCCATGCTCTACTCTACCTTTGCTGCAGCTGATGCTGATGCTGGTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCGCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAAAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCACACCACGGTTACAAAGTTCTGGAATGCCCGTGCCACTTCCAGAAGGGCCAATTTTATTGCACAACAAAACAAGGGCTCTGGTGATAAACCTTT
  5   1   2       bld Emb4      in                    IMAGE:4960167.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGACAATTCTTCATTGGTGTGCTGGATATTGCTGGGTTTGAAATCTTTGATTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGATTGGGAGTTTATTGACTTTGGTATGGATTTGGCTGCCTGCATTGAACTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCATTGAACGAGTCAGTTATCCAACTCTTCCAGAAGTCTTCTGTTAAACTGCTGTCCATGCTCTACTCTACCTTTGCTGCAGCTGATGCTGATGCTGGTGGGTAAGGTGGAAAGAAA
  5   1   2       bld Emb4                            IMAGE:4682629.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTGGGTTCGAAATCTTTGACTTTAACAGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGAGTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATTTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGACAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCAGGTATCATGGACAACCATCTCCTCATCCACCAGCTGAGATGTAATGGTGTGCTGGAAAGTATTAGAATCTGCAGGAAAAGGATTTCCAGCAGAATCCTCTATGGTGATTTCCAACAACGTTACAAAGTTCTGAATGGCAGTGGCCTTTCCAGAAGGGCATTTTATTGACCACAAGAAAGGCTTGGGAGAAACTTCCTAGGCCCCAATTGATATCCACCCCCCCTT
  5   1   2       bld Emb4                            IMAGE:4930475.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCACGCGTCCGGTTGATGCAGAGCTGCTCCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGAGTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATTTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTANACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAATCTGGGCAAACTTATGACAAACTTGAGAAGCACTCACCCTCACTTTTGTGCGTGTTTGATTTCCCATGATCAAGACTCCAGGTATCATGGACAACCATCTCCTCATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGGAAGGATTTCAAGCAGAATCTCCTATGGGTGATTTCAACACGTTACAAAGTTCTGAATGGCAGTGCCCATTCAGAAGGGGCATTTATTGACAACAAGAAAGGTTTGTTGAGAAGCTTCTAGGGCTCCAATTGATATCCGACCACACTCAGTATTAACTTGGAccccccccAAGGTAATTTTTCAA
  5   1   2       bld Emb4      out                   IMAGE:4960292.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACGCGTCCGCCCACGCGTCCGTTCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGAGTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGACAAACTTGAGAAGCACTCACCCTCACTTTGTGCGA
  5   1   2       bld Emb3      out                   IMAGE:3398840.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGAGTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATTTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTG
  5   1   2       bld Emb4                            IMAGE:4679995.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTGGAGCAGCTCTGCATCAACTTTACCAATGAAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGAGTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATTTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGACAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCA
  5   1   0       add Emb4      in                    IMAGE:4201981.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAACTGCAACAGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGGAATTGATTGGGGAGTTTATTTGACTTTGGTATGGGGATTTGGCTGCCTGCANNTTGAACTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGGACCCATTGAACGAGTCAGTTATCCAACT
  5   1   2       add Tad2      in                    IMAGE:6874040.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCAATGAGAAACTGCAACAGTTTTTTAACCATCACATGTTTGTCCTGGAGCAAGAGGAGTACAAGAAGGAAGGGATTGACTGGGAGTTCATTGACTTCGGCATGGACTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCAATGGGCATTTTCTCCATCCTTGAAGAGGAGTGCATGTTCCCCAAGGCAACAGACACTTCTTTCAAGAACAAGTTGCATGACCAACATCTGGGCAAGTGCAATAACTTCCAGAAACCCAAGCCTGGAAAAGGCAAAGCTGAGGCTCACTTCTCTCTTGTCCACTATGCTGGGACAGTGGATTACAACATCTCTGGTTGGCTTGATAAGAACAAGGACCCACTGAATGAAACTGTCATTGGACTCTACCAGAAGTCTTCTGTCAAACTGCTCTGCTTCCTCTACGCTGCACACGCTGGTGCAGAAGCAGATGCTGGAAAGAAGGGTGCCAAGAAGAAGGGTTCCTCTTTCCAGACCGTGTCTGCTCTTTTCAGGGAGAATCTGAACAAGCTGATGAGCAACCTTAGAAGCACTCACCCCCACTTTGTACGTTGCCTGATCCCCTAATGAGACAAAAACTCCAGGGGCCATGGACCACTATCTGGTTATGCACCAGCTTTAGTTGTAATGGTGTCCTTGNAAGGCATTCGAATTTGCAGAAAGGGATTCCCCAAGCAGGATCATCTATGGGTGACTTTCAAACAACGTTACAAGATTCTAAATGCAAGTGCCTATTTCCTGATGGGGCCATTTATTGGATAGCAAAAAAACCTT
  5   1   2       bld Emb4                            IMAGE:5570740.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTTTTTCAATCACCACATGTTCGTCCTGGAGCAGGAGGATACAAGAAGGAAGGAATTGAGTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATTTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGACAAACTTGAGAAGCACTCACCCTCACTNTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCAGGTATCATGGACAACCATCTCCTCATCCACCAGCTGAGATGTAATGGTGTGCTAGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCCTTCCAGAAGGGGCATTTTATTGAACACAAGAAGGGTTGGTGAGAAAGCTTCTAGGCTCAATTTGATTATCGACCACACTTCAGTATAAACTTGGGACACACCCCAAGGGATTTTTTCCAAAGCTGGGTCTTTTTGGGGGCACCTCTGGGAGGGAAATTGA
  5   1   2       bld Emb4                            IMAGE:4682609.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACATGTTCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGATTGGGAGTTTATTGACTTTGGTATGGATTTGGCTGCCTGCATTGAACTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCATTGAACGAGTCAGTTATCCAACTCTTCCAGAAGTCTTCTGTTAAACTGCTGTCCATGCTCTACTCTACCTTTGCTGCAGCTGATGCTGATGCTGGTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCGCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGACTCCCAGCAGAATCCTCTATGGTGATTTCAAACCACGTTACAAAGTTCTGAATGCCCGTGCCATTCCAGAAAGGGAATTTATTGACCAACAAAAGGGTTGTGGAAAAGCTTCTAAGGCTCATTGGATATCCGACCCCCCTCCGGTATAAACCTGGGGGCACCCCCAAAGGGATTTTTTTACAAAGCTTGGGGCTCTTTTGGGGGACCCCCCTGGAAGGGAAAATGGAGAAGAATTGAAAAAGTTTAAGCTCCACACTT
  5   1   2       bld Emb4                            IMAGE:5542073.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCGTCCTGGAGCAGGAGGAATACAAGAAGGAAGGAATTGATTGGGAGTTTATTGACTTTGGTATGGATTTGGCTGCCTGCATTGAACTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCATTGAACGAGTCAGTTATCCAACTCTTCCAGAAGTCTTCTGTTAAACTGCTGTCCATGCTCTACTCTACCTTTGCTGCAGCTGATGCTGATGCTGGTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCGCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAAGCTTGTGAGAAGCTTCTANGCTCAATTGATATCGACCACACTCAGTATAAACTTGGGCACACCCAGGTATTTTTCAAAGCTGGGCTTTTGGGGTACTCTGGGAGGAAATGAGCAGATGGAAAAGGTTAGCTCAACCTTATTACTTGGCACCCCAAGCTCTTTTGCAGAAAGATTCTTA
  5   1   2       bld Emb4                            IMAGE:5542846.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCACGCGTCCGAGGAATACAAGAAGGAAGGAATTGAGTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGACAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAATCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAAGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAAGGCAAATTATTGACCACAAGAAAGGCTGGTGAAAAACTTCTAGGCTCAATTTGATTATCGAACCACACTCAGAATAAACTTGGAACACACCCCAGGGTATTTTTTCCAAAGCCTGGGTCCTTTTTGGGGATACTCCCGGGA
  5   1   2       bld Emb4                            IMAGE:5515445.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGAAGGAAGGAATCGACTGGGAGTTTATCGACTTTGGTATGGATTTGGCTGCCTGCATTGAGCTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATTTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGACAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCAGGTATCATGGACAACCATCTCCTCATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCATTNATTGACACAAGAAGGCTGTGAGAAGCTCTAGGCTCATTGATATCGACACACTCAGTATAAACTGGACCACCAGGTATTTTCAAGCTGGTCTTT
  5   1   2       bld Tad1                            IMAGE:6938606.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGGATTTGGCTGCCTGCATTGAACTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCATTGAACGAGTCAGTTATCCAACTCTTCCAGAAGTCTTCTGTTAAACTGCTGTCCATGCTCTACTCTACCTTTGCTGCAGCTGATGCTGATGCTGGTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCGCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCCATCTCCCTTATCCACCCAGCTGAAGATGTAAATGGGTGTTGCTGGGAAGGGTATTTAGAAATCCTGGCAGGGGAAAAGGATATTTCCAAGGCCAGAAATTCCCTCCTATTGGGTTGAATTTTCCAAAAACAAACCGTTTTACCAAAAGGGTTTCCTGGAAAATGGCCCCAGTTGGGCCCAATTTTCCCAAGAAAAAAGGGGGCT
  5   1   2       bld Emb4      in                    IMAGE:4958052.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTGGCTGCCTGCATTGAACTTATTGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCATTGAACGAGTCAGTTATCCAACTCTTCCAGAAGTCTTCTGTTAAACTGCTGTCCATGCTCTACTCTACCTTTGCTGCAGCTGATGCTGATGCTGGTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCGCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTTATCCACCAGCTGAGA
  5   1   2       add Tad2                            IMAGE:6875137.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATTGAGCTTATTGAGAAGCCAATGGGCATTTTCTCCATCCTTGAAGAGGAGTGCATGTTCCCCAAGGCAACAGATACTTCTTTCAAGAACAAGTTGCATGACCAACATCTGGGCAAGTGCAATAACTTCCAGAAACCCAAGCCTGGAAAAGGCAAAGCTGAGGCTCACTTCTCTCTTGTCCACTATGCTGGGACAGTGGATTACAACATCTCTGGTTGGCTTGATAAGAACAAGGACCCACTGAATGAAACTGTCATTGGGCTCTACCAGAAGTCTTCTATCAAACTGCTCTGCTTCCTCTACGCTGCACACGCTGGTGCAGAAGCAGATGCCGGAAAGAAGGGTGCCAAGAAGAAGGGTTCCTCTTTCCAGACCGTGTCTGCTCTTTTCAGGGAGAATCTGAACAAGCTGATGAGCAACCTTAGAAGCACTCACCCCCACTTTGTACGTTGCCTGATCCCTAATGAGACAAAAACTCCAGGGGCCATGGACCACTATCTGGTTATGCACCAGCTTAGGTGTAATGGTGTCCTTGAGGGCATTCGAATTTGCAGAAAGGGATTCCCAAGCAGGATCATCTATGGTGACTTCAAACAACGTTACAAGATTCTAAATGCAAGTGCTATTCCTGATGGGCAATTTATTGATAGCAAGAAAGCTTCAGAGAAACTTCTTGGGATCCATTTGATGGTAGAACACCACTCCGGTAACAAATTTTGGGACACACCTTAAGGGTTA
  5   1   2       bld Tad1      in                    IMAGE:6878453.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAGAAGCCACTGGGTATCTTCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAGGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCATTGAACGAGTCAGTTATCCAACTCTTCCAGAAGTCTTCTGTTAAACTGCTGTCCATGCTCTACTCTACCTTTGCTGCAGCTGATGCTGATGCTGGTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCGCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTTATCCACCACCTGAGAAGTAATGGTGTGCTGGAAGGGATTAGAATCTGCAAGAAAGGATTTCCAAGCAGAAACCTCTATGGTGATTTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCCTTTCCAGAAGGGGCAATTTTTTTGAACACAAAAAAGGCTTGCGTAAAAACCTTCTAAGGCTCAATTTGGATATTTGACCCCCCACTTCAGTTATATAACTTGAGGGCACACCCCAAGGGCAATTATTTTCCAAAAGCCTGGAGCCCTTCTTGGGGTGACCTCCCGGGGAGGCAAAAATGTTGAAAGGAATTGGAAATAGTTTGTGATCTCC
  5   1   2       add Tad2      out                   IMAGE:6875178.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAAGCCAATGGGCATTTTCTCCATCCTTGAAGAGGAGTGCATGTTCCCCAAGGCAACAGACACTTCTTTTAAGAACAAGTTGCATGACCAACATCTGGGAAAGTCCAATAACTTCCAGAAACCCAAGCCTGGAAAAGGCAAAGCTGAGGCTCACTTCTCTCTTGTCCACTATGCTGGGACAGTGGATTACAACATCTCTGGTTGGCTTGATAAGAACAAGGACCCACTGAATGAAACTGTCATTGGACTCTACCAGAAGTCTTCTGTCAAACTGCTCTGCTTCCTCTACGCTGCACACGCTGGTGCAGAAGCAGATGCCGGAAAGAAGGGTGCCAAGAAGAAGGGTTCCTCTTTCCAGACCGTGTCTGCTCTTTTCAGGGAGAATCTGAACAAGCTGATGAGCAACCTTAGAAGCACTCACCCCCACTTTGTACGTTGCCTGATCCCTAATGAAACAAAAACTCCAGGGGCCATGGACCACTATCTGGTTATGCACCAGCTTAGGTGTAATGGTGTCCTTGAGGGCATTCGAATTTGCAGAAAGGGATTCCCAAGCAGGATCATCTATGGTGACTTCAAACAACGTTACAAGATTCTAAATGCAAGTGCTATTCCCGATGGGCAATTTATTGATAGCAAGAAAGCTTCAGAGAAGCTTCTTGGATCCATTGACGTAGACCACCCTCCGTACAAATTTTGGACACACCTAAGGTTTTCTTTAAAAGCTGGCCTAATTAGGGTACTCCTGGGAAGAAATGCGCAAAATGGAACGTTTTGGGCCCCAGGTTAATA
  5   1   2       bld Emb3      in                    IMAGE:3399985.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTCCATCCTTGAAGAGCAGTGCATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATNCTGGGCNAAATGCAAGAAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATTTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGACAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCAGGTATCATGGACAACCATCTCCTCATCCAC
  5   1   2       bld Tad2      in                    IMAGE:6873907.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGTTCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGATCAAGGACCCATTGAACGAGTCAGTTATCCAACTCTTCCAGAAGTCTTCTGTTAAACTGCTGTCCATGCTCTACTCTACCTTTGCTGCAGCTGATGCTGATGCTGGTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCGCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAAGGCAATTTATTGACAACAAGAAAGCTTGTGAGAACCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGGCACACCAAGGTATTTTTCCAAGCTGGGTCTTTTGGGTACTCTGGGAGGAAATGAGAGATGCAAAGGTTACCTCCAACTAATTAT
  5   1   2       add Emb4                            IMAGE:4684272.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCCCAAGTCCACTGACAATTCTTTCAAGGACAAACTATATGAACAACATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTTCCAGAAGTCTTCTGTTAAACTGCTGTCCATGCTCTACTCTACCTTTGCTGCAGCTGACGATGCTGGTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCGCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGAAAACTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGACACACCAAGGTATNTTTCAAAGCTGGGTCTTTTGGGGTACTCTGGGAGGAATGAGAGATGAAAAGTTAGCTCAACTTATCACTTGCACCCAGCTCTTTGCAGGGATTTTTTGAATGAAGGGTGAAGTCAAGAAATGATGGAAAAGAGGGAAGCCATTATGTCTCGNNNAAACATTTGAGGCCGTTCATGAATGTCAACCCGTGGCCTGGATGAAACTGTACTTCAGAATCAGCCTCTCCTGCAAAATGCCCAAAACTGAAAAAGAATGGCCAACCTGAAGGGA
  3   1   2       add Tad2      out                   IMAGE:6874571.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGAGGAGGAGGAGGGTCGAATAAGAGGGAAGTCTTTCGTTCTGGTGTAAGAGGGAGCGTACGTATTATAGGAATTGACAGGGGCTAGCGGGTATTAGGGGTGTTTAGTTGACCAGGGGTTTACAATCGAAATAGAGCGAGGGCGAGTGGCAATGTTGGGGGGTGTTTTTTGTGTGTACAAAAGTGCGTGTGAATTCGTGGGGGGTTTCAACGCGGTTAAGTGCAGAGAGCCAGGATTTGGAAAAAGAAGGATTGCCAAGAAGAAAGGGTTCCTTTTTTCCAAAGCGGGTTCTGTTTTGTTCAGTGAGGAATTATAACAAGCTGATGGGCAACTTTAGAAGCACTCACCCCCACTTTGTACGTTGCCTGATCCCTAATGAGACAAAAACTCCAGGGGCCATGGACCACTATCTGGTTATGCACCAGCTTAGGTGTAATGGTGTCCTTGAGGGCATTCGAATTTGCAGAAAGGGATTCCCAAGCAGGATCATCTATGGTGACTTCAAACAACGTTACAAGATTCTAAATGCAAGTGCTATTCCTGATGGGCAATTTATTGATAGCAAAAAAGCTTCAGAGAAGCTTCTTGGATCCATTGACGTAGACCACACTCAGTACAAATTTGGACACACTAAGGTTTTCTTTAAAGCTGGCTTATTAGGTACTCTGGAAGAGATGCGAGATGAACGTTTGGCCCAATTAATTACTCGTACTCAAGCCATGTGCAGAGGTTACCTCATGAGAGTTGAGTTTAAGAAGATGATGGAAAGAAGAGAATCCATCTTCTGCATCCAGTACAATGTCCGTTCATTCATGAATGTCAAGCACTGGCCATGGATGAAACTTTACTTTAAGATCAAGCCTCTCCTGAAGAGTGCAGAGTCTGAGAAAGAGATGCAAAACATGAAGGAG
  5   1   2       bld Emb4      in                    IMAGE:4957617.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACGCGTCCGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTTCCAGAAGTCTTCTGTTAAACTGCTGTCCATGCTCTACTCTACCTTTGCTGCAGCTGACGATGCTGGTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCGCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAAAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACCAAGTTCTGAATGCCAGTGCCATTCCGAAGGGGCATTTATTGACCACAAGAAGG
  5   1   2       bld DMZ       in                         xl280j07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATCTGGGCAAATGCAAGAACTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGACAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAATCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAACTTCTAGGCTCAATTGATATTGACCACACTCAGTATAAACTTGGACACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGA
  5   1   2       add Tad2                            IMAGE:6931580.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGAAAGTCCAATAACTTCCAGAAACCCAAGCCTGGAAAAGGCAAAGCTGAGGCTCACTTCTCTCTTGTCCACTATGCTGGGACAGTGGATGACATCTCTGGTTGGCTTGATAAGAACAAGGACCCACTGAATGAAAACTGTCATTGGACTCTACCAGAAGTCTTCTGTCAAACTGCTCTGCTTCCTCTACGCTGCCAACGCTGGTGCAGAAGCAGATGCCCGAAAGAAGGGTGCCCAGAAGAAGGGTTCCTCTTTCCAGACCGCGTCTGCCCCTTTTAGGGAGAATCCTGACCCGACTGATGAGCCCACCTTAGCCGCCCTcccccccccTTTGTCACGTTCCCCGGTCCCCCACTCTATCCACAACCCTCCACGCGCCCATGGTACCTCATATTCCTGGGTTATCGGATTCGCGCTTCAGTGGTGTCAACGGCGGCCCCCTTGCACCGCCAATATCCACCTCCTCGCCCGCACAGGCCACGTATACCACCCCGAAGGACCGTATTCACCAATGAACACATTTTTGCGaccccgccccctattcaccccccccttttaccccACGCCTCATGTTCTAATCCCACCGGAACAAGGGTTGTATAGCTGCGTCCTCTCCTTTGCTTCTAACCCACCCAACGCCCGTGTCACCTGACTTATACACCTCCCCTTGCCCTTAATTCAATTTTGACCCCGCCCATTCCTNTCTCCCCCTCTCGCTGCTCCCACACTCTCTCCGCATTTCATATCACCTTCCCCCGCCATGCGCNTGAACTCCCCTATACACTATCCGCCTCATATCTCATCTACGCCCGGCCACTTTGCTATTTTACACAACCCTCGCTCCACAATGTTTACTCCCCCTACCCAGCGTCTGCCATCCACCGCTTAAGCGACCCCCCTCGCCATTTCGCCCACCGAATCTGACCCCCCCGCCTGCATGCTTGATTCCGTCCACCCTAGGCATATCTCGCTTCATTGCTTCCTGTCCCATGCCTACCCTCCCGACTATACTAATCATCCCT
  3   1   2       add Tad2      in                    IMAGE:6874040.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAATACTTTCCAGAAACCCCAAGCCTGAAAAAGGCAAAGCTGAGGCTCACTTCTCTCTGTCCCACTATGCTGGGACAGTGGATTACAACATCTCTGGTTGGCTTGATAAGAACAAGGCCCCACTGAATGAAACTGTCATTGGACTCTACCAGAAGTCTTCTGTCAAACTGCTCTGCTTCCTTTACGCTGCACACGCTGGTGCAGAAGCAGATGCTGGAAAGAAGGGTGCCAAGAAGAAGGGTTCCTCTTTCCAGACCGTGTCTGCTCTTTTCAGGGAGAATCTGAACAAGCTGATGAGCAACCTTAGAAGCACTCACCCCCACTTTGTACGTTGCCTGATCCCTAATGAGACAAAAACTCCAGGGGCCATGGACCACTATCTGGTTATGCACCAGCTTAGGTGTAATGGTGTCCTTGAGGGCATTCGAATTTGCAGAAAGGGATTCCCAAGCAGGATCATCTATGGTGACTTCAAACAACGTTACAAGATTCTAAATGCAAGTGCTATTCCTGATGGGCAATTTATTGATAGCAAAAAAGCTTCAGAGAAGCTTCTTGGATCCATTGACGTAGACCACACTCAGTACAAATTTGGACACACTAAGGTTTTCTTTAAAGCTGGCTTATTAGGTACTCTGGAAGAGATGCGAGATGAACGTTTGGCCCAATTAATTACTCGTACTCAAGCCATGTGCAGAGGTTACCTCATGAGAGTTGAGTTTAAGAAGATGATGGAAAGAAGAGAATCCATCTTCTGCATCCAGTACAATGTCCGTTCATTCATGAATGTCAAGCACTGGCCATGGATGAAACTTTACTTTAAGATCAAGCCTCTCCTGAAGAGTGCAGAGTCTGAGAAAGAGATGCAAAACAGTAA
  3   1   2       bld Tad1      in                    IMAGE:6880118.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGAGAAGGCCCCAAGCCTGGCCAAAGGAAAAGGCAAAAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATTTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTGTGACAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGATTCCAAGAATCCAGGTATCATGGACAACCATCTCCTCATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGACACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGCTCAACTTATTACTTGCACCCAAGCTCTTTGCAGAGGATTTTTGATGAGGGTTGAGTTCAAGAAAATGATGGAACGAAGGGAGGCCATATATCTCATTCAGTACAATTTGAGGTCGTTCATGAATGTCAAACACTGGCCATGGATGAAACTGTACTTCAAGATCAA
  5   1   2       bld Emb4                            IMAGE:5570687.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTTGAGAAGCCCAAGCCTGGCAAAGGAAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGACAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCAGGTATCATGGACAACCATCTCCTCATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGACACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGCTCAACTTATTACTTGCACCCAAGCTCTTTGCAGAGGATTTTTTGATGAAGGGTTGAGTTCAAGAANATGATGGAACGAAGGGAGGCCATATATCTCATTCAGTACCATTTTGAGGGGCGTTCATGAATGTCCAAACACTGGCCCATGGGATGAAAACTGTAACTTCCAGAACCAAAGCCTTCCCCCTGcaaaagaggcccgaaaactgaaaaaaagaaaaGGGGCAAAA
  5   1   2       bld Tail                            IMAGE:8544513.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAANNNNCCTTTGTGGANAGAAGTACTACATCTATTCGTCCCGTGGATTACACATTTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGACAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCAGGTATCATGGACAACCATCTCCTCATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGACACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGCTCAACTTATTACTTGCACCCAAGCTCTTTGCAGAGGATTTTTGATGAGGGTTGAGTTCAAGAAAATGATGGAACGAAGGGAGGCCATATATCTCATTCAGTACAATTTGAGGTCGTTCATGAAATGTCAACACTGGCCATGGATGAAACTG
  5   1   2       add Tad2                            IMAGE:6936396.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAGGCAGAAGCTCACTTCTCTCTTGTGCATTATGCTGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTTCCAGAAGTCTTCTGTTAAACTGCTGTCCATGCTCTACTCTACCTTTGCTGCAGCTGACGATGCTGGTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCGCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGAAAACTTATGTCAAACTTGAGAAGCACTCATCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCCTTCCAGAAAGGCAATTTTATTGACAACAAGAAAGGCTTGTGAGGAAAGCTTTTANGGCTCAATTGGATATTTGACCACCCCTCAGTTATAAAACTTGGGAACCCCCCCAAAGGGAAttttttttCAAAAGCCTTGGGTCCTTTTTGGGGGTTACCTCCTTGGGGAAGGGAAAAATGGAAGAAGAATTTGAAAAAAGGGTTTAAT
  5   1   2       bld Emb4      in                    IMAGE:4956972.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGGACTGTGGATTACAACATCTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGACAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAATCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAACTTCTAGGCTCAATTGATATTGACCACACTCAGTATAAACTTGGACACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGCTCAA
  5   1   2       add Tad2                            IMAGE:6932834.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGGGACAGTGGATTACAACATCTCTGGTTGGCTTGATAAGAACAAGGACCCACTGAATGAAACTGTCATTGGGCTCTACCAGAAGTCTTCTATCAAACTGCTCTGCTTCCTCTACGCTGCACACGCTGGTGCAGAAGCAGATGCCGGAAAGAAGGGTGCCAAGAAGAAGGGTTCCTCTTTCCAGACCGTGTCTGCTCTTTTCAGGGAGAATCTGAACAAGCTGATGAGCAACCTTAGAAGCACTCACCCCCACTTTGTACGTTGCCTGATCCCTAATGAGACAAAAACTCCAGGGGCCATGGACCACTATCTGGTTATGCACCAGCTTAGGTGTAATGGTGTCCTTGAGGGCATTCGAATTTGCAGAAAGGGATTCCCAAGCAGGATCATCTATGGTGACTTCAAACAACGTTACAAGATTCTAAATGCAAGTGCTATTCCTGATGGGCAATTTATTGATAGCAAGAAAGCTTCAGAGAAGCTTCTTGGATCCATTGATGTAGACCACACTCAGTACAAATTTGGACACACTAAGGTTTTCTTTAAAGCTGGCTTATTAGGTACTCTGGAAGAGATGCGAGATGAACGTTTGGCCCAGTTAATTACTCGTACTCAGGCCATGTGCAGAGGTTACCTCATGAGAGTTGAGTTTNAGAAGATGATGGAAAGAAGAGAATCCATCTTCTGCATCCAGTACAACGTCCGTTCATTCATGAATGTCAAGCACTGGCCATGGAATGAAACTTTACTTTAAGATCAAAGCCTCTTCTGAAGAAGTGCANAAGTCTTGAAAAGGAAGATGCCAAACATTGAAAGGAGGAATTTTTGAGAAAGAACCAAGGAAACCTTTTTGG
  5   1   2       bld Emb4                            IMAGE:5572855.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACATTTCTGGCTGGCTTGAAAAGAACAAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGACAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCAGGTATCATGGACAACCATCTCCTCATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGACACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGCTCAACTTATTACTTGCACCCAAGCTCTTTGCAGAGGATTTTTGATGAGGGTTGAGTTCAAGAAAATGATGGAACGAAGGGAGGCCATATATCTCATTCAGTACAATTTGAGGTCGTTCATGAATGTCAAACACTGGCCATGGGATGAACTGTACTTCAAGATCAAGCCTCTCCTGCAGAGTGCTGANACTGTAAAAAGAGATGGCAAACCTGAAGGGAAGAATTTGAGAAGAACAAGGGAACCATTGGA
  5   1   2       add Tad2      in                    IMAGE:6872775.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAACATCTCTGGTTGGCTTGATAAGAACAAGGACCCACTGAATGAAACTGTCATTGGGCTCTACCAGAAGTCTTCTATCAAACTGCTCTGCTTCCTCTACGCTGCACACGCTGGTGCAGAAGCAGATGCCGGAAAGAAGGGTGCCAAGAAGAAGGGTTCCTCTTTCCAGACCGTGTCTGCTCTTTTCAGGGAGAATCTGAACAAGCTGATGAGCAACCTTAGAAGCACTCACCCCCACTTTGTACGTTGCCTGATCCCTAATGAGACAAAAACTCCAGGGGCCATGGACCACTATCTGGTTATGCACCAGCTTAGGTGTAATGGTGTCCTTGAGGGCATTCGAATTTGCAGAAAGGGATTCCCACGCAGGATCATCTATGGTGACTTCAAACAACGTTACAAGATTCTAAATGCAAGTGCTATTCCTGATGGGCAATTTATTGATAGCAAGAAAGCTTCAGAGAAGCTTCTTGGATCCATTGATGTAGACCACACTCAGTACAAATTTGGACACACTAAGGTTTTCTTTAAAGCTGGCTTATTAGGTACTCTGGAAGAGATGCGAGATGAACGTTTGGCCCAGTTAATTACTCGTACTCAGGCCATGTGCAGAAGGTACCTCATGAGAATTGAGTTTAAGAAAATGATGGGAAAGAAGAGAATCCTTCTTCTGCATCCAGTACCACGTCCCGTTCATTCCTGAATGGTCAAGCCCTGGGCCATGGGATGGAAACTTTTACCTTTAAGAATCAAGCCCCTCTTCCTTaaaaaaatgccaaaaatcctgaaaaaaaaGAAT
  3   1   2       bld Emb3      in                    IMAGE:3400254.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGCAAACACAGGGACCCATTGACGAGTCAGTTATCCAATTGTACCAGAGTTCTTTGGTAACCTGCTGTCCTTGTCTATTCCGCCTTTGCTGAAGCTGAAGCTAATGCTGCTGGTAAAGGTGAAAAGCAAAGCAAGGGATCCTCTTCCCAGACTGTGTCTGGTCTCTCCAGGGAATATCTGGGCAAACTTATCCAACCTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCAGGTATCATGGACAACCATCTCCTCATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGACACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGNCTCAACTNTATTACNTTGCACCCAAGCTCTTTGCAGAGGATTTTTGATGAGGGTTGAGTTCA
  5   1   2       bld Emb4                            IMAGE:5542818.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGGACCCACTGAACGAGTCAGTTATCCAACTCTACCAGAAGTCTTCTGTTAAACTGCTGTCCTTGCTCTACTCTGCCTTTGCTGCAGCTGAAGCTGATGCTGCTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGACAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAATCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAACTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGACACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGCTCAACTTATTACTTGCACCCAAGCTCTTTGCAGAGGATTTTTGATGAGGGTTGAGTTCAAGAAAATGATGGAAAGAAGGGAGGCCATATATGTCATCCAGTACAATTTGAGGTCGTTCATGAATGTCAAACATTGGCCATGGATGAAACTGTACTTTAAGATCAAGCCTCTCCTGCAGAGTGCTGAGACTGAGAAAGAGATGGCAAACATGAAAGGAGAATTTGAGAAGACCCAAGAAGCCACTGGGTAAAAGTANGAAGCAAGAAAAGAAAGAACCTGGAAGGGAGAAAATGG
  5   1   2       bld Emb4                            IMAGE:5543048.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGACGCGTGGGCTACCTTTGCTGCAGCTGATGCTGATGCTGGTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCGCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCATCCTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGGCACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGCTCAACTTATTACTTGCACCCAAGCTCTTTGCACAGGATTTTTGATGAGGGTTGAGTTCAAGAAAATGATGGAAAGAAGGGAGGCCATATATCTCATTCAGTACACTTTGAGGTCATTCCTGAACTGTCAACATTGGCCATGGATGAAACTGTACTTCAAGATCAAGCCCTCTCCTGCAGAGTGCTGAAACTGACAAAAGCCATGGCAAACATGTAAGGAACAATTTGAGAAGACCCAAGAAGCACTTGGTAAAACCCACAACCTTACAAAAGATAAGAACTGGGAAGaaaaaaaaGGGTTTCCCCTGGCTCCACGGAAAAAGAATTGAATCTTAGTCCCCTGCCAGGGTTCAAACCTCGGAAGGGGTGCAAAAACCCCTTGCGCCGGGATTTCTCTGACGCCACAAAAAATTGCCTAAACCGGCGCTCTA
  3   1   2       add Tad2      in                    IMAGE:6872775.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGGTTCTCCCAGTAAGAGATGGTTTTTCTTTTTTTTCCCGGACCCGTTGTTATGCGTTTTTTGCAGCGGGAGAATTCGTGAACCCAACTTCGATTGGGCCAACCTTTAGAAAGCCGTTCAACCCCCCATTTTGGAACGTTGCCTTGATCCCTTAAGGAAGACAAAAACTCCCGGGGGTCCATGGACCAAATTTCGGTTAAGGCCCCAGCTTAAGGCGTAAAGGTGTCCTAAGGGGGCATTCGAATTTGCCGAAAGGAGTTCCCCACGCAGGATCATCTATGGTGACTTCAAACAACGTTACAAGATTCTAAATGCAAGTGCTATTCCTGATGGGCAATTTATTGATAGCAAGAAAGCTTCAGAGAAGCTTCTTGGATCCATTGATGTAGACCACACTCAGTACAAATTTGGACACACTAAGGTTTTCTTTAAAGCTGGCTTATTAGGTACTCTGGAAGAGATGCGAGATGAACGTTTGGCCCAGTTAATTACTCGTACTCAGGCCATGTGCAGAGGTTACCTCATGAGAGTTGAGTTTAAGAAGATGATGGAAAGAAGAGAATCCATCTTCTGCATCCAGTACAACGTCCGTTCATTCATGAATGTCAAGCACTGGCCATGGATGAAACTTTACTTTAAGATCAAGCCTCTTCTGAAGAGTGCAGAGTCTGAGAAAGAGATGCAAAACATGAAGGAGGAGTTTGAGAAGACCAAGGAACTTTTGGCAAAATCAGAAGCAAAGAAAAAGGAACTGGAGGAAAAAATGGTTTCCATTCTTCAGGAGAAGAATGATCTTCAGCTCCAAGTTACATCTGAATCAGAGACTCTGGCAGATGCAGAGGAAAGATGTGAAGGTCTGATCAAAGCTAAAATACAACTGGAGGCATAAATTAAGG
  3   1   2       bld Tad1      in                    IMAGE:6879528.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCAGTTGAAAGGTGATTGCTTGCTGGTAAAAGGTGGAAAGAAAAGGAAAGGGATCCTCTTTCCCGGACTGTGTCTGGTCTCTTCAGGGAAAATTTGGGCAAATTTATGACAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAAATGAATCCAAGACTCCAGGTATCATGGACAACCATCTCCTCATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCGTTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGACACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGCTCAACTTATTACTCGCACCCAAGCTCTTTGCAGAGGATTTTTGATGAGGGTTGAGTTCAAGAAAATGATGGAACGAAGGGAGGCCATATATCTCATTCAGTACAATTTGAGGTCGTTCATGAATGTCAAACACTGGCCATGGATGAAACTGTACTTCAAGATCAAGCCTCTCCTGCAGAGTGCTGAGACTGAGAAAGAGATGGCAAACATGAAGGAAGAATTTGAGAAGACCAAGGAAGCATTGGTAAAAGCAGAAGCAAGAAAGAAAGAACTGGAGGAGAAAATGGTTTCCCTGCTCCAGGAAAAGAATGATCTAGTCCTGCAGGTTCAATCGGAAGGTGAAACCTTGGCTGATTCTGAGGAGAGATGTAAG
  3   1   2       bld Tad1      in                    IMAGE:6877610.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGCTGCAGCAGACGATGCTTGTTGTAAAAGGTGAAAAGAAAAAAGAAGGGATCCGCCTTTCCAGACTGTGTTCTGGTCTCTCCAGGGAAAAATTTGGGCAAACTTATGTCAAACTTGAGAAGTACTCACCTTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTCATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATTGACCACACTCAGTATAAACTTGGACACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGCTCAACTTATCACTTGCACCCAAGCTCTTTGCAGAGGATTTTTGATGAGGGTTGAGTTCAAGAAAATGATGGAAAGAAGGGAGGCCATATATGTCATCCAGTACAATTTGAGGTCATTCATGAATGTCAAACACTGGCCATGGATGAAACTGTACTTCAAGATCAAGCCTCTCCTGCAGAGTGCTGAGACTGAGAAAGAGATGGCAAACATGAAGGAAGAATTTGAGAAGACCAAGGAAGCACTGGTAAAAGCAGAAGCAAAGAAAAAAGAACTGGAGGAGAAAATGGTTTCCCTGCTCCAGGAAAAGAATGATCTAGTCCTGCAGGTTCAATCGGAAGGTGAAACCTTGGCNGATTCTGAGGAGAGATGGAAGGGC
  3   1   2       bld Tad1      in                    IMAGE:6878453.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              NGCGATGGCTGGTGGTAAAGGGTGAAAAGAAAAAGAAAGGGATCCGCTTTCCAGAGCTGTGTCTGGTCTCTTCCAGGGAAAATCTGGGCAAACTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCTTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGGCACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGCTCAACTTATTACTTGCACCCAAGCTCTTTGCAGAGGATTTTTGATGAGGGTTGAGTTCAAGAAAATGATGGAAAGAAGGGAGGCCATATATCTCATTCAGTACAATTTGAGGTCATTCATGAATGTCAAACATTGGCCATGGATGAAACTGTACTTCAAGATCAAGCCTCTCCTGCAGAGTGCTGAAACTGAGAAAGAGATGGCAAACATGAAGGAAGAATTTGAGAAGACCAAGGAAGCACTGGTAAAAGCAGAAGCAAGAAAGAAAGAACTGGAGGAGAAAATGGTTTCCCTGCTCCAGGAAAAGAATGATCTAGTCCTGCAGGTTCAATCGGAAGGTGAAACCTTGGCNTATTCTTAGGAGA
  5   1   2       bld Emb4      in                    IMAGE:4202535.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGACGATGCTGGTGGTAAAGGTGGAAAGAAAAAGAAGGGATCCGCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGAAAACTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGACACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGCTCAACTTATCACTTGCACCCAAGCTCTTTGCAGAGGATTTTTGATGAGGGTTGAG
  3   1   2       bld Emb3      out                   IMAGE:3398852.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGTAAAGGTGAAAAGAAAAGAAGGGATCTTCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAATTCTGGGCACACTTATGACAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTNCAGGTATCATGGACAACCATCTCCTCATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGACACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGCTCAACTTATTACTTGCACCCAAGCTCTTTGCAGAGGATTTTTGATGAGGGTTGAGTTCAAG
  3   1   2       bld Emb4                            IMAGE:4202517.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAAGAAGGGATCCGCTTTCCAGACTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGGCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGGCACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAGCTCAACTTATTACTTGACCCAAGCTCTTTGCAGAGGATTTTTGATGAGGGTTGAGTTCAA
  5   1   2       add Tad1                            IMAGE:6939907.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGTGTGTCTGGTCTCTTCAGGGAAAATCTGGGCAAACTTATGTCAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAACCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGATTTCAAACAACGTTACAAAGTTCTGAATGCCAGTGCCATTCCAGAAGGTCAATTTATTGACAACAAGAAGGCTTGTGAGAAGCTTCTAGGCTCAATTGATATCGACCACACTCAGTATAAACTTGGGCACACCAAGGTATTTTTCAAAGCTGGTCTTTTGGGTACTCTGGAGGAAATGAGAGATGAAAAGTTAACTCAACTTATTACTTGCACCCCAGCTCTTTGCAGAGGATTTTGGATGAGGGGTTGAGTTCCAAGAAAATGATGGAAAAAAAGGGAGGCGCATATATCTTCAATTCAGTAACAATTTGAAGGTCCATTAATGAAATGGTCAAACCATTTGGCCCTTGGGATGAAAAACTGTAACTTCAAAGAATCAAGGCCTCTCCCTGCCAAAGTGCCTGAAAACTGaaaaaaaaaaaTGGCCAAACTTTGAAGGGAAGAATTTTGAGAAGAACCAAGGGAAGCCCTGTGTTAAAAAGCCTAAgcccggaaaagaaaagaaactggggggagaaaaaagggttttcccggcctccccggaaaaaaaaaTGATTCCTAATCCCGTGCAGGGTTCAAATCTGAAAAGGGAAAACACTTTGGCTGAAATTCGAAAGAAAAGAATA
  5   1   2       bld Emb4                            IMAGE:5570807.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCACGCGTCCGTCTTCAGGGAAAATCTGGGCAAACTTATGACAAACTTGAGAAGCACTCACCCTCACTTTGTGCGTTGTTTGATTCCCAATGAATCCAAGACTCCTGGTATCATGGACAATCATCTCCTTATCCACCAGCTGAGATGTAATGGTGTGCTGGAAGGTATTAGAATCTGCAGGAAAGGATTTCCAAGCAGAATCCTCTATGGTGAT