Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8737686.5                    1011 END     2           1        0                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:3474399.5                       2 END     2           1      100                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-xlk65o01ex.3.5                       97 PI      93         68     1632                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:8463340.5.5                    19 PI      81        169     1436                (no blast hit)
     5   0.0    0Xl3.1-IMAGE:3474399.5                       2 PI      93       1628     1870                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012837264 Xl3.1-IMAGE:5155727.5 - 113 ESTs
                                                                       ..-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5155727.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTTGCCTGCATTTTGCACCAATACTTACCTCTGTCCCCCTTACGTCATTAGTGGGCGGTCCACCCTGTGATTGGCCGGGCCTTGTAAGCACGTATCCTGACTCCGCGCCGGTCAAAGTAGTAGTAGGTCTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAACCAGTAATGTCCAAAGTTATGGAAATGTTTCAGCCCAGTGCAGTGGTCTTACAGTGCGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATTAAGGGACATGCGAAGTGTGTGGAGTTTATAAAGACCTTTAACTTGCCACTGTTGATGTTAGGAGGTGGAGGTTACACTATCCGGAATGTGGCTCGTTGCTGGACATATGAAACAGCTGTGGCTCTGGACTCTGAGATCCCCAATGAGCTTCCATATAATGATTATTTTGAATATTTTGGTCCGGACTTCAAGCTTCACATCAGCCCATCCAACATGACTAATCAGAACACTAATGAATATCTGGAGAAAATTAAGCAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCTGGAGTTCAGATGCAAGCCGTTGCAGAGGACTCCATACACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAAAAACGTGGCCAATTTCAAAAAAGTAAAACGGGTTAAAACTGAAGAGGAAAAGGAAGGAGAGGACAAGAAAGATGTTAAAGAAGAGGAGAAAGCTAAAGATGAGAAGACGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCGACATAAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCAACCCACTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATTCCGTAATGCATTGCACCACCGATGATTACAGAGGCACAGGAAAACATGGAAAGTTTTTG
                                                  Xl3.1-CHK-1012722163                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGCATTTTGCACCAATACTTACCTCTGTCCxCCxTACGTCATTAGTGGGCGGTCCACCCTGTGATTGGCCGGGCCTTGTAAGCACGTATCCTGACTCCGCGCCGGTCAAAGTAGTAGTAGGTCTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAACCAGTAATGTCCAAAGTTATGGAAATGTTTCAGCCCAGTGCAGTGGTCTTACAGTGCGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATTAAGGGACATGCGAAGTGTGTGGAGTTTATAAAGACCTTTAACTTGCCACTGTTGATGTTAGGAGGTGGAGGTTACACTATCCGGAATGTGGCTCGTTGCTGGACATATGAAACAGCTGTGGCTCTGGACTCTGAGATCCCCAATGAGCTTCCATATAATGATTATTTTGAATATTTTGGTCCGGACTTCAAGCTTCACATCAGCCCATCCAACATGACTAATCAGAACACTAATGAATATCTGGAGAAAATTAAGCAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCTGGAGTTCAGATGCAAGCCGTTGCAGAGGACTCCATACACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAAAAACGTGGCCAATTTCAAAAAAGTAAAACGGGTTAAAACTGAAGAGGAAAAGGAAGGAGAGGACAAGAAAGATGTTAAAGAAGAGGAGAAAGCTAAAGATGAGAAGACGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCxxxxxxAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCAACCCACTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATxCxxxAATGCATTGCACCACCGATGATTACAGAGGCACAGGAAAACATGGAAAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      3     3     3     3     3     3     4     9     4     9     6    11     8    14     9    15    12    16    12    17    13    18    23    28    37    41    40    43    41    44    41    44    41    44    42    44    42    44    42    44    42    44    42    44    42    44    44    46    44    46    43    45    45    45    44    45    45    45    45    45    45    45    45    45    45    45    45    45    46    46    47    47    46    47    47    47    47    47    47    47    47    47    47    48    45    48    46    48    47    49    47    49    46    48    48    49    47    49    47    50    49    50    49    50    49    50    49    50    47    50    48    50    44    48    44    47    41    45    41    44    32    44    33    43    31    42    31    40    25    34    23    34    23    34    24    34    23    34    23    33    18    31    15    30    16    30    15    29    15    27    14    26    14    26    13    24    14    25    12    25    14    27    14    24    13    19    13    20    14    20    13    19    11    17    11    15    10    15    10    13    10    13    10    13    10    13    10    13    10    13    10    12    10    11    10    11    11    12    11    12    11    12    11    12    13    14    11    13    11    13    12    14    13    14    13    14    15    17    16    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    16    18    16    18    17    19    17    19    18    22    18    24    19    28    19    30    18    32    18    33    18    37    18    40    18    40    21    41    21    43    22    44    22    44    18    44    22    47    24    48    26    47    21    46    22    46    27    44    24    44    23    45    27    48    33    50    28    50    33    49    30    43    32    38    31    38    23    37    21    37    20    37    21    36    21    33    18    32    20    32    20    32    17    31    19    30    16    29    18    28    17    27    14    24     6    17     4    11     4     6     4     6     4     6
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCCATACTTAGTTCTGTAGGAAACCATAGCAGTTCTTGGCATTTATTGCCTGCACTTTACTTTTAAATATGTTTGGGGAGAAAAAAAAACCCCGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTATTACAAAGCTTTTCTACAACTCAACCATAAAAAAAAAAAAAAAAAAGAAATTTCCCATCACAAAAATTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCATGGTTTTATATTTTGTATATGCCCTGTACAGAGCCCTACTATGAAATATAAGTCCACACATTCTAAATTATTTCTGTCCCACTGGTTGAGGGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGTGAAGTTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCTGTAGTGGATTAAGCTTCACATCTGTTACCTTTTTTTAAGATTCACATCTGTTACCTTTTTACCAGATGTTTCCAGCTCTTTGGCTTTTTTTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------CT
                                               BLH ATG     147    3495                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH MIN     147     403                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH MPR     135     403                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH OVR     147      69                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               CDS MIN     147      31                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               EST CLI     127      31                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               ORF LNG     147       7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
  5   1   1       add DMZ                                  xl244o05.5p GAGAAACTGAAGGTTATCAGAGCACAAGTCACATCACTGGGGACCCCTGGGAAATGGGCATCATGTCTAGCAGCATGCCAAATTTTCATTCTGACTAATACTTGTggggggggggCTAATGGAACCTGTTGAACAGCAGAGTAACATGTGCCTCTTCATTTATTTTTTGTAGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTGTGAGTATGAGGCACATGGGTTCAGTGTGGGAAAACAAGGGTTCTAAAGGGACATTGAATATGATGTATaaaaaaaaaaaTTAACCGTGAATGGATTTGCAATTTGGGTAATGCNCNCATCCCAGTTTTCTATTTTGACAGNGTTATCNCNCAGTAGTAGTTTTGTCAACTTATTAATCAGTAGGAAATGTACAAGAATGTTATAGAATCAGTTGTANCCTAAAACNCCTTGCCTGCATTTTGCACCAATACTTACCTCTGTCCGCCATACTTAGTTCTGTAGGAAACCATAGCAGTTCTTGGCATTTATTGCCTGCACTTTACTTTTAAATATGTTTGGGGAGaaaaaaaaaCCCCGCAAAAACCC
  5   1   2       chi Tbd3                   IMAGE:3548797-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTCCCCGGGGGGGTAGGAAATGTACAAGAATGTTATAGAATCAGTTGTAGCCTAAAACACCTTGCCTGCATTTTGCACCAATACTTACCTCTGTCCGCCATACTTAGTTCTGTAGGAAACCATAGCAGTTCTTGGCATTTATTGCCTGCACTTTACTTTTAAATATGTTTGGGGAGaaaaaaaaaCCCCGCAAAAACCCTCTTTCATGTTTGGTTATACATTTGTCTCATGCTCATCAGAATATAACTAAACGAATTGTAATCTAAACTAGCCTGTTCTGTCTGACATGGCTGCATCCACTGAAGAACATTCATGCTTTAGGGATGGTTGTATATGTTCTTTCTATTCCTCACTTTGTCGTACTACAGAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCCGATAGGGTTATGACTGTGTCCTTCCCATAAGTATGGAGAGTATTTTCCCTGG
  5   1   2       chi Tbd3      out                   IMAGE:3548797.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGGAAATGTACAAAAATGTTATANAATCAGTTGTAGCCTAAAACACCTTGCCTGCATTTTGCTCTTATACTTACCTCTGTCCGCCATACTTAGTTCTGTAGGAAACCATAGCAGTTCTTGGCATTTATTGCCTGCACTTTACTTTTAAATATGTTTGGGGAGaaaaaaaaaCCCCGCAAAAACCCTCTTTCATGTTTGGTTATACATTTGTCTCATGCTCATCAGAATATAACTAAACGAATTGTAATCTAAACTAGCCTGTTCTGTCTGACATGGCTGCATCCACTGAAGAACATTCATGCTTTAGGGATGGTTGTATATGTTCTTTCTATTCCTCACTTTGTCGTACTACAGAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTATTGTTATGTCAACGATATTGTCCTTGCCATGCTGTAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATT
  5   1   2       bld Ga15 5g                            XL475b10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCCGCGTTCCCCTTACGTCATTAGTGGGCGGTCCACCCTGTGATTGGCCGGGCCTTGTAAGCACGTATCCTGACTCCGCGCCGGTCAAAGTAGTAGTAGGTCTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATA
  5   1   2       bld DMZ  5g                              xl233f13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGCGTTCCCCTTACGTCATTAGTGGGCGGTCCACCCTGATGATTGGCCGGGCCTTGTTAAGCACGTATCCTGACTCCGCGCCGGTCAAAGTAGTAGTAGGTCTTAGACGCGGAAGGAAAATGGCGCTGACTCTNGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCNGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCANATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATNCAGTANACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCNGCTCTCTGCAGGGGGTTCTGTANCANGTGCTGTTAAACTAAACAAACAGCANACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACNTTCNCCACGGTGATGGTGTTGAGGA
  5   1   2       bld DMZ  5g                              xl277p19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGCGTTCCCCTTACGTCATTAGTGGGCGGTCCACCCTGTGATTGGCCGGGCCTTGTAAGCACGTATCCTGACTCCGCGCCGGTCAAAGTAGTAGTAGGTCTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACAC
  5   1   2       bld Ga15 5g   in                       XL416m01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGTTCCCCTTACGTCATTAGTGGGCGGTCCACCCTGTGATTGGCCGGGCCTTGTAAGCACGTATCCTGACTCCGCGCCGGTCAAAGTAGTAGTAGGTCTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATANGGTTATGACTGTGTCCTTCCATAAGTATGGANAGTATTTTCC
  5   1   2       bld Emb1 5g3  out                   IMAGE:3403130.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTCCCCTTACGTCATTAGTGGGCGGTCCACCCCGTGATTGGCCGGGCCTTGTAAGCACTTATCCTGACTCCGCGCCGGTCAAAGTAGTAGTAGGTCTTATACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGATGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTTAACTAACAAACAGCAGACTGACATTTTAGTGAACTGGGGTGGA
  5   1   2       bld Oo1  5g                         IMAGE:6862376.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCTTACGTCATTAGTCGGGCGGTCCACCCTGTGATTGGCCGGGCCTTGTAAGCACGTATCCTGACTCCGCGCCGGTCAAAGTAGTAGTAGGTCTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGGAAGCAAATTTTTTAAACCAGTAATGGTCCAAAGTTATGGCAAATTGGTGTTCAGCCCCAGTTGCCAGTGGGTCC
  5   1   2       bld Ga15 5g   in                       XL443c20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGCGGTCCACCCTGTGATTGGCCGGGCCTTGTAAGCACGTATCCTGACTCCGCGCCGGTCAAAGTAGTAGTAGGTCTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCANAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTAT
  5   1   2       bld Ov1  5g                IMAGE:6318157-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGGAATTTTTCGGGCCAGGGCCTTTGTAAGCACTTATCCTGACCTCCGCGCCGGTCAAAGTAGTAGTAGGTCTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTC
  5   1   2       bld Emb1 5g                         IMAGE:6866041.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACCCTGTGATTGGCCGGGCCTTGTAAGCACGTATCCTGACTCCGCGCCGGTCAAAGTAGTAGTAGGTCTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGNAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACCGGGAGGGGATTGACGATGAGTCCTAGAGCATTTTTAACGTATGTCAAGTATGAATGTTCAGCCGTGCATGTCTACN
  5   1   2       bld Ga18 5g                           xlk117g20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACCCTGTGATTGGNCGGNCTTGTAAGCACGTATCCTGACTCCGCGCCGGTCAAAGTAGTAGTAGGTCTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAANTCTGAGGCATCTGGNTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACNNTCACCACNNTGATNGNTGTTGAGGAGGCATTTTACACNACCGATANNNTATGACTGTNTCCTNNCATA
  5   1   2       bld Ga15 5g                            XL435d11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGTGATTGGCCGGGCCTTGTAAGCACGTATCCTGACTCCGCGCCGGTCAAAGTAGTAGTAGGTCTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAANTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTG
  5   1   2       bld Ga18 5g                           xlk161p13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAAGCACGTATCCTGACTCCGCGCCGGNCAAAGNAGTAGTAGGTCTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGNTGGAAATTATTATTATGGNCAAGGGCATCCCATGAAACCTCATAGAANTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAA
  5   1   2       bld Oo1  5g                         IMAGE:6859163.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACGTATCCTGACTCCGCGCCGGTCAAAGTAGTAGTAGGTCTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCNAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTTAACCAGTAATGTCCNAAGTTATGGAAATGTTTCAGCCCAGTGCAGTGGTCTTACAGTGCGGGAGCAGATTCATTATTCTGGGGGAATAGACTTTGGATGCCTTC
  3  -1   2       bld Ga11                            IMAGE:3474893.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCTCAGAATAAACGCTCAACTTTTGCTGATCCGAATAACCCGGGATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGTTTTTTTTACAAAGTATCACAGTGATGATTATATCAAATTCCTGCTCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACCGTGATGGTGTT
  5   1   2       bld Emb1 5g                         IMAGE:6865599.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGCGTCCGTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAAATATTGGTGCAGGGAAAAGCAAATACTATGCTGTAAATTAAGCCTTACGGGATGGGAATTGACGATGAAGTCCTATGAAGCCAATTTTTAAACCAGGTAATGGCCCAAAGTTATGGAAAATGGTTTCACACCCAGTGCAATGGGTTCTTACCAGGGCCGGAACCAAAAATCCCTTTATCCGGGGGGAAAAGACCTGGG
  5   1   2       chi Oo1                             IMAGE:6639514.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCATGTCTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGGTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCCAGAGAGGTGTGGTATATTGATATAAACATTCCCCACGNGGATTGTGGTTTAAGGAGGCATTTTTACACAACCCGATAGGGTTATGACCTGTGCCCCTTCCATAAGTATGGGAAAGGAATTTTCCctggaactgggaaaatctgaaaaaaaatttggtggcaggggaaaagggaaaaaACCTAAGGCGTGGAAATTTATTGCCCTTTACCGGAATTGGGAATTTGGCCCAATAAAATCCCCTATGGaaacccaatttttttaaaaaccccacaaaaagggtcccaaaagttttttggggaaaaaggtttttccaacccccccaggggcaaaaggggggctttttaaacaaggggcgggggaaacccaaaaaattcttttttatttttggggggggA
  5   1   2       bld DMZ  5g   in                         xl253h16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTAGGTCTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACNGGATG
  5   1   2       bld Oo1  5x                         IMAGE:5083860.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGGTCTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGCAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAAGGCAAATACTATGCCTGTAAAATTATGCCCTTACCGGGATGGGAATTGACCAATGAAGTCCCTATGAAAGCAACTTTTTTAAACCACGTAATGGTCCAAAAGGTTATGGGAAAATGTTCTCAACCCCCACTGCCAAAGGGGCCCTTAACGGTGCGCGGGACCAAGAATTTCATTAATCCCTGGGGGAAACAAAACCTTGGGAAGGCCTTTCCAAATTTTGAACCCTTTTCAAGGGGGCACCTTGCCCAAAGAGGTGGGGCGGGACAACTTA
  5   1   2       bld Emb1 5g                         IMAGE:6863451.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGACGCGTGGGCGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGAACCATGAGTCCTATGAAAGCAATTTTAAACCCGTAATGTCCCAAGTTTATGGAAAATGTTTCACCCCCACTGGCATGGGTCCAAACAGTGGCGGACCAGATTCCTTTATCTGGGGGAAAAGACTTTGGAATGCTTTCAATTTGTAACCA
  5   1   2       bld Egg3 5g                         IMAGE:3379173.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGGGAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTTTTTGTTATGTCAACGATAT
  5   1   2       bld Ga18 5g   in                        xlk8o04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GNCTTAGACGCGGAAGGNAAATGGNGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGNTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCANATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGNGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTNCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGNCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGNATCACCAGAGAGNTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGNNNNTTTACACAACCGATAGNNTATGACTGTGTCCTTCCAT
  5   1   2       bld DMZ  5g                              xl301e22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTCTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGG
  5   1   2       bld Oo1  5g                         IMAGE:5079490.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAACCAGTAATGGTCCAAGTTATGGAAATGTTTCAGCCCAGTGCAGTGGTCTTACAGTGCGGAGCAGATTCATTATCTGGGGGATAGACTTGGATGCTTTCATTTGACCATTAGGGC
  5   1   2      seed DMZ  5g                              xl279k22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGA
  5   1   2       bld DMZ  5g                              xl241d22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTAGACGCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGAT
  5   1   2       bld Emb1 5g                         IMAGE:5155234.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACGCGTCCGGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGGATTGACGATGAGTCCTATGAAGCCATTTTTAAACCAGTAATGTCCAAAGGTTATGGAAATGTTTCAGCCCCAGTGCAGTGGTCCTTACAGNTGCGGAAGCAGAATTCCTTTATCCTGGGGGAAATAGAACCTTGG
  5   1   2       bld Ga18 5g   in                      xlk156h01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGNCNNNNAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGNTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGNAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGNCCTATGAAGCAATTTTTAAACCAGTAATGTCCAAAGTTATGGAAATGTTTCAGCCCAGTGCAGTGGNCTTACAGTGCNNNNNNNTCATTATCTGGGGNTAGACTTGGNTGCTTCAATTTGACCATTNAGGGACATGCGAAG
  5   1   2       bld Ga18 5g   ?                        xlk63m23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGNNNNNAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGNCATTTTACACAACCGATAGNTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGANATTGGTNCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTNCGGGNNGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAACCAG
  5   1   2       bld Emb1 5g                         IMAGE:5155727.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAACCAGTAATGTCCAAAGTTATGGAAATGTTTCAGCCCAGTGCAGTGGTCTTACAGTGCGGAGCAGATTCATTATCTGGGGAATAGACTTGGATGCTTCAATTTGACCATTAA
  5   1   2       bld Emb1 5g                         IMAGE:6865521.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAAGATATTGGGTGCAGGGAAAAGGCAAATACTATGCTGTAAATTATGCCCTTACGGGATGGGATTGNACGATGAAGTCCTAAGAAAGCAATTTTTTAAACCAGTAATGGTCCAAAGTTATGGAAAATGTTTTCAGCCCAANTGCAATGGTTCTTACAATGGCGGGAACAAAATTCATTTATCTGGGGGATAAAACTTGGGAAGGCTTTCAATTTTGACCAATTAAGGGAACATGCG
  5   1   2       bld Thy  5g                         IMAGE:8547507.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGGAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAACCAGTAATGTCCAAA
  5   1   2       bld DMZ  5x3  out                        xl259c18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATAACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGA
  5   1   2       bld DMZ  5x3  out                        xl268k09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATAACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCT
  5   1   2       chi Emb4                            IMAGE:5572075.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAAGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGCATGGAGAGTATTTTCCCTGGAACTGGAGATCTGAGAAATATTGGGCGCACGGGAAAAGGAAAATACTATGCCGGGACCCCTAATGCCTCACCGGAATAGCGGATCGAATAATAGAATAACGAAGGAGCCCACCCTCCTTGCCCCCCTATCCCTGGGTCCACAATCTGATGGCGCCAGTGATTTCCCCCGCCAGTAACCCGTATCGCCCCGCCACCATGCGGCTCGGGCCGCAGATTCCCCCTATGTTTAGCGGTTTATACTGACCCCTGACCCTCGTGCTACCGACCCTCCCAACATCACGCCGCGGCTACATTCAGCCACCTAACTAGCCGGCTCCAGTGACCACAACAAGACAAACCGCCAGAATAACCACTTTCCGCTACCCCGTGTATC
  5   1   2       bld Ga18 5g   in                      xlk155i16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGNTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGNGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAACCAGTAATGTCCAAAGNTATGGAAATGTTTCAGCCCAGTGCAGTGGTCTTACAGTGC
  5   1   2       bld Emb1 5g                         IMAGE:6631365.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATCGGTGATGTTAGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCCGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAATTAATGCCTTACGGGATGGGATTGACGATGAGCCCTATGAAGCAATTTTTAAACCAGTAATGTCCAAAGTTATGGAAAATGTTCACCCCCATGCAATGGTCCTTACAGTGCCGGAACAAAATCATTTATCCTGGGGATAAACTTGGAATGCTTCAATTTGGACCATTAAAGGGACATGCGAAATggggggggAGGCTATTAAAAAACCTTTTAACTTTGCCCCC
  5   1   2       bld DMZ  5g                              xl308g07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAG
  5   1   2       bld DMZ  5g                              xl316j15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGAT
  5   1   2       bld Ga18 5g   in                      xlk166n17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAAATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGNCATTTTACACAACCGATANNNTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGANATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAANTATGCCTTANGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAANCAGTAATGTCCAAAGTT
  5   1   2       bld Ga15 5g   in                       XL423l05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGGCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAG
  5   1   2       bld Oo1       in                    IMAGE:5078572.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGCTGACTCTAGGAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGG
  5   1   2       bld DMZ                                  xl318o22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAACAAAGAAGAAAGTGTGCTACTACTATGATGGTGATGTTGGAAATTATTATTATGGTCAAGGGCATCCCATGAAACCTCATAGAATTCGCATGACACACAACCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGA
  5   1   2       bld Ga18      in                      xlk160k09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTGCTGCTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAACCAGTAATGTCCAAAGTTATGGAAATGTTTCAGCCCAGTGCAGNGGNCTTACAGTGCNNNNNNNTTCATTATCTGGGGATAGANTTGGATGCTTCAATTTGACCATTAAGGGACATGCGAAGNGTGTGGAGTTTATAAAGACCTTTAACTTGCCACTGTTGATGTTAGGNGGNGGNGGTTACNCTATCCNGNANGTG
  5   1   2       bld Ga15                               XL500d05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCAACTATGGACTTTACCGAAAAATGGAAATCTTTAGGCCCCACAAAGCCAGCGCCGAGGATATGACAAAGTATCACAGTGATGATTATATCAAATTCCTGCGCTCCATACGACCAGACAATATGTCCGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAACCAGTAATGTCCAAAGTTATGGAAATGTTTCAGCCCAGTGCAGTGGTCTTACAGTGCGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATTAAGGGACATGCGAAGTGTGTGGAGTTTATAAAGACCTTTAACTTGCCACT
  5   1   2       bld Ga12                                 XL216c22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGAATACAGTAAACAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAACCAGTAATGTCCAAAGTTATGGAAATGTTTCAGCCCAGTGCAGTGGTCTTACAGTGCGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATTAAGGGACATGCGAAGTGTGTGGAGTTTATAAAGACCTTTAACTTGCCACTGTTGATGT
  5   1   2       bld DMZ                                  xl308k07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGATGCAGAGATTTAATGTTGGTGAGGACTGTCCTGTGTTTGATGGCCTATTTGAGTTCTGCCAGCTCTCTGCAGGGGGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAACCAGTAATGTCCAAAGTTATGGAAATGTTTCAGCCCAGTGCAGTGGTCTTACAGTGCGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATTAAGGGACATGCGAAGTGTGTGGAGTTTATAAAGACCTTTAACTTGCCACTGTTGATGTTA
  5   1   2       bld Ga15                               XL416n15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCGTTCTGTAGCAAGTGCTGTTAAACTAAACAAACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAACCAGTAATGTCCAAAGTTATGGAAATGTTTCAGCCCAGTGCAGTGGTCTTACAGTGCGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATTAAGGGACATGCGAAGTGTGTGGAGTTTATAAAGACCTTTAACTTGCCACTGTTGATGTTAGGAGGTGGAGGTTACACTATCCGGAATGTGGCTCGTTGCTGGACATATGAAACAGCTGTGGCTCTGGACTCTGAGATCCCCAATGAGCTTCCATATAATGATTATTTTGAATATTTTGGTCCGGACTTCAAGCTTCACATCANCCCATCCAACATGACTAATCANAAC
  5   1   2       bld Emb1                            IMAGE:3401189.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACAGCAGACTGACATTTCAGTGAACTGGTCTGGTGGCCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAACCAGTAATGTCCAAAGTTATGGAAATGTTTCAGCCCAGTGCAGTGGTCTTACAGTGCGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATTAAGGGACATGCGAAGTGTGTGGAGTTTATAAAGACCTTTAACTTGCCACTGTTGATGTTAGGAGGTGGAGGTTCACTATCCCGAATGTGGCTCGTTGCCTGACATATGAATCAGCCTGTGCTCTTGACTCTGACATCCCCTATGAAGCTTCATATAATGATTATTTTGAATATT
  5   1   2       bld DMZ                                  xl261e13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAACCAGTAATGTCCAAAGTTATGGAAATGTTTCAGCCCAGTGCAGTGGTCTTACAGTGCGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATTAAGGGACATGCGAAGTGTGTGGAGTTTATAAAGACCTTTAACTTGCCACTGTTGATGTTAGGAGGTGGAGGTTACACTATCCGGAATGTGGCTCGTTGCTGGACATATGAAACAGCTGTGGCTCTGGACTCTGAGATCCCCAATGAGCTTCCATATAATGATTATTTTGAATATTTTGGTCCGGACTTCAAGCTTCACATCAGCCCATCCAACATGACTAATCAGAACACTAATGAATATCTGGAGAAAATTAAGCAGCGC
  5   1   2       bld DMZ                                  xl261e14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTTCATCATGCAAAGAAATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTCCATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAACCAGTAATGTCCAAAGTTATGGAAATGTTTCAGCCCAGTGCAGTGGTCTTACAGTGCGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATTAAGGGACATGCGAAGTGTGTGGAGTTTATAAAGACCTTTAACTTGCCACTGTTGATGTTAGGAGGTGGAGGTTACACTATCCGGAATGTGGCTCGTTGCTGGACATATGAAACAGCTGTGGCTCTGGACTCTGAGATCCCCAATGAGCTTCCATATAATGATTATTTTGAATATTTTGGTCCGGACTTCAAGCTTCACATCAGCCCATCCAACATGACTAATCAGAACACTAATGAATATCTGGAGAAAATTAAGCAGCGCCTC
  5   1   2       bld Tbd3                            IMAGE:3549050.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCTGAGGCATCTGGTTTTTGTTATGTCAACGATATTGTCCTTGCCATCCTGGAACTACTAAAGTATCACCAGAGAGTTGTGTATATTGATATAGACATTCACCACGGTGATGGTGTTGAGGAGGCATTTTACACAACCGATAGGGTTATGACTGTGTCCTTACATAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGATAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTTCTATGAAGCAATTTTTAAACCAGTAATGTCCAAAGTTATGGAAATGTTTCAACCCAATGCACTGGTCTTACAGTGCGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATTAAGGGACATGCT
  5   1   2       bld Tbd7                                 XL091o17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGTCCTTCCTAAGTATGGAGAGTATTTTCCTGGAACTGGAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAACCAGTAATGTCCAAAGTTATGGAAATGTTTCAGCCCAGTGCAGTGGTCTTACAGTGCGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATTAAGGGACATGCGAAGTGTGTGGAGTTTATAAAGACCTTTAACTTGCCACTGTTGATGTTAGGAGGTGGAGGTTACACTATCCGGAATGTGGCTCGTTGCTGGACATATGAAACAGCTGTGGCTCTGGACTCTGAGATCCCCAATGAGCTTCCATATAATGATTATTTTGAATATTTTGGTCCGGACTTCAAGCTTCACATCAGCCCATCCAACATGACTAATCAGAACACTAATGAATATCTGGAGAAAATTAAGCAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCTGGAGTTCAGATGCAAGCCGTTGCAGAGGACTCCATACACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGAC
  5   1   2       bld Ga15      in                       XL445k18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGATCTGAGAGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAACCAGTAATGTCCAAAGTTATGGAAATGTTTCAGCCCAGTGCAGTGGTCTTACAGTGCGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATTAAGGGACATGCGAAGTGTGTGGAGTTTATAAAGACCTTTAACTTGCCACTGTTGATGTTAGGAGGTGGAGGTTACACTATCCGGAATGTGGCTCGTTGCTGGACATATGAAACAGCTGTGGCTCTGGACTCTGAGATCCCCAATGAGCTTCCATATAATGATTATTTTGAATATTTTGGTCCGGACTTCAAGCTTCACATCAGCCCATCCAACATGACTAATCAGAACACTAATGAATATCTGGAGAAAATTAAGCAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCTGGAGTTCAGATGCAAGCCGTTGCAGAGGACTCCATACACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAAAAACGTGGCCAATTTCANAAAAGTAAAACGGGTTAAAACTGAA
  5   1   2       bld Ga15      in                       XL506p18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGATATTGGTGCAGGGAAAGGCAAATACTATGCTGTAAATTATGCCTTACGGGATGGGATTGACGATGAGTCCTATGAAGCAATTTTTAAACCAGTAATGTCCAAAGTTATGGAAATGTTTCAGCCCAGTGCAGTGGTCTTACAGTGCGGAGCAGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATTAAGGGACATGCGAAGTGTGTGGAGTTTATAAAGACCTTTAACTTGCCACTGTTGATGTTAGGAGGTGGAGGTTACACTATCCGGAATGTGGCTCGTTGCTGGACATATGAAACAGCTGTGGCTCTGGACTCTGAGATCCCCAATGAGCTTCCATATAATGATTATTTTGAATATTTTGGTCCGGACTTCAAGCTTCACATCAGCCCATCCAACATGACTAATCAGAACACTAATGAATATCTGGAGAAAATTAAGCAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCTGGAGTTCAGATGCAAGCCGTTGCAGAGGACTCCATACACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAAAAACGTGGCCAATTTCAAA
  5   1   2       bld Ga18      in                      xlk129j02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGTGCNNNGATTCATTATCTGGGGATAGACTTGGATGCTTCAATTTGACCATTAAGGGACATGCGAAGTGTGTGGAGTTTATAAAGACCTTTAACTTGCCACTGTTGATGTTAGGAGGTGGAGGTTACACTATCCGGAATGTGGCTCGTTGCTGGACATATGAAACAGCTGTGGNTCTGGACTCTGAGATCCCCAATGAGCTTCCATATAATGATTATTTTGAATATTTTGGTCCGGACTTCAAGCTTCACATCAGCCCATCCAACATGACTAATCAGAACACTAATGAATATCTGGAGAAAATTAAGCAGNNNNCTTTGAGAACTTGCGCNNNNCCCCCATGCTCCTGGAGTTCAGATGCAAGCCGTTGCAGAGGACTCCATACACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGNTCTCAGATTCTGAGGATGAAGGGGAGGGAGGNCGCAAAAACGTGGNCAATTTCAAAAAAGTAAAACGGGttaaaactgaagaggaaaaggaaggagaggnnaagaaagannttaaagaagaggagaaagCTAAAGATGA
  5   1   2       bld Emb9                            IMAGE:7978624.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTGGATGCTTCAATTTGACCATTAAGGGACATGCGAAGTGTGTGGAGTTTATAAAGACCTTTAACTTGCCACTGTTGATGTTAGGAGGTGGAGGTTACACTATCCGGAATGTGGCTCGTTGCTGGACATATGAAACAGCTGTGGCTCTGGACTCTGAGATCCCCAATGAGCTTCCATATAATGATTATTTTGAATATTTTGGTCCGGACTTCAAGCTTCACATCAGCCCATCCAACATGACTAATCAGAACACTAATGAATATCTGGAGAAAATTAAGCAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCTGGAGTTCAGATGCAAGCCGTTGCAGAGGACTCCATACACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAAAAACGTGGCCAATTTCAAAAAAGTAAAACGGGTtaaaactgaagaggaaaaggaaggagaggacaagaaagatgttaaagaagaggagaaaGCTAAAGATGAGAAGACGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCTCATGGGTTTTATATTTTGTATATGCCCTGTACAGAGCCCTACTATGAAATATAAGTCCACACATTCTAAATTAATTTCTGTCCCACTGGTT
  5   1   2       bld Thy       in                    IMAGE:8546618.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTGGATGCTTCAATTTGACCATTAAGGGACATGCGAAGTGTGTGGAGTTTATAAAGACCTTTAACTTGCCACTGTTGATGTTAGGAGGTGGAGGTTACACTATCCGGAATGTGGCTCGTTGCTGGACATATGAAACAGCTGTGGCTCTGGACTCTGAGATCCCCAATGAGCTTCCATATAATGATTATTTTGAATATTTTGGTCCGGACTTCAAGCTTCACATCAGCCCATCCAACATGACTAATCAGAACACTAATGAATATCTGGAGAAAATTAAGCAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCTGGAGTTCAGATGCAAGCCGTTGCAGAGGACTCCATACACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAAAAACGTGGCCAATTTCAAAAAAGTAAAACGGGTtaaaactgaagaggaaaaggaaggagaggacaagaaagatgttaaagaagaggagaaaGCTAAAGATGAGAAGACGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCTCATGGGTTTTATATTTTGTATATGCCCTGTACAGAGCCCTACTATGAAATATAAGTCCACACATTCTAAATTATTTCTGTCCACTTGATGAGGGGGGTGAGTGGTCGCTGTAGTGATAAAGCTCACATCTGTTACATTTTTTTAGATCACATCCTGTTACCTTTTTACCAGAATGTTCCAGCTCCTTTGGGCT
  5   1   2       bld Ga18      in                       xlk57h14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GANATGCGAAGTGTGTGGAGTTTATAAAGACCTTTAACTTGCCACTGTTGATGTTAGGAGGTGGAGGTTACACTATCCGGAATGTGGCTCGTTGCTGGACATATGAAACAGCTGTGGNTCTGGACTCTGAGATCCCCAATGAGCTTCCATATAATGATTATTTTGAATATTTTGGTCCGGACTTCAAGCTTCACATCAGCCCATCCAACATGACTAATCAGAACACTAATGAATATCTGGAGAAAATTAAGCAGNNNNCTTTGAGAACTTGCGNNNNNCCCCCATGCTCCTGGAGTTCAGATGCAAGCCGTTGCAGAGGACTCCATACACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGNCGCAAAAACGTGGCCAATTTCAAAAAAGTAAAACGGGTTAAAACTgaagaggaaaaggaaggagaggacaagaaagatgttaaagaagaggagaAAGCTAAAGATGAGAAGACGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCTCATGGNTTTATATTTTGTATATGCCCTGTACAGNGCCCTACTATGAAATATNAGTCCACACATTCTAAATTATTTCTGTCCCNCNGNNGAGGGGGGNNGAAGTTGTCNCTGTAGTGGATTA
  5   1   2       bld Emb9                            IMAGE:7978414.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTGGAGTTTATAAAGACCTTTAACTTGCCACTGTTGATGTTAGGAGGTGGAGGTTACACTATCCGGAATGTGGCTCGTTGCTGGACATATGAAACAGCTGTGGCTCTGGACTCTGAGATCCCCAATGAGCTTCCATATAATGATTATTTTGAATATTTTGGTCCGGACTTCAAGCTTCACATCAGCCCATCCAACATGACTAATCAGAACACTAATGAATATCTGGAGAAAATTAAGCAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCTGGAGTTCAGATGCAAGCCGTTGCAGAGGACTCCATACACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAAAAACGTGGCCAATTTCAAAAAAGTAAAACGGGTTAAACtgaagaggaaaaggaaggagaggacaagaaagatgttaaagaagaggagaaagctaaagaTGAGAAAGACGGATAGCAAACGGGTTAAAAGAAGAGACCAAATCAGTCTGATCCTTTCAACTATGGGGAGAAAATCCCGAGGACCAAACTAATTTCTCATGGTTTTATATTTTGTATATGCCCTGGTACAGAGCCCTACTTATGAATATAAGTCCAACACATTCCTAAATTATTTTCTGTCCCCCTTGGTTGAGGGGGGGTGAATTGTTCGCTGTTATT
  5   1   2       bld Ga15                               XL409c03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTCACATCAGCCCATCCAACATGACTAATCAGAACACTAATGAATATCTGGAGAAAATTAAGCAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCTGGAGTTCAGATGCAAGCCGTTGCAGAGGACTCCATACACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAAAAACGTGGCCAATTTCAAAAAAGTAAAACGGGTTAAAACTGAAGAGGAAAAggaaggagaggacaagaaagatgttaaagaagaggagaaagctaaagatgagaagaCGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCTCATGGTTTTATATTTTGTATATGCCCTGTACAGAGCCCTACTATGAAATATAAGTCCACACATTCTAAATTATTTCTGTCCCACTGGTTGAGGGGGGGTGAAGTTGTCGCTGTANTGGATTAAGCTTCACATCTGTTACCTTTTTTTAAGATTCACATCTGTTACCTTTTTACCANATGTTTCCAGCTCTTTGGCtttttttttttttttNCCC
  5   1   2       bld Ga15      in                       XL444f21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTAATCAGAACACTAATGAATATCTGGAGAAAATTAAGCAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCTGGAGTTCAGATGCAAGCCGTTGCAGAGGACTCCATACACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAAAAACGTGGCCAATTTCaaaaaagtaaaacgggttaaaactgaagaggaaaaggaaggagaggacaagaaagatgttaaagaagaggagaaagctaaagatgagaagaCGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCTCATGGTTTTATATTTTGTATATGCCCTGTACAGAGCCCTACTATGAAATATAAGTCCACACATTCTAAATTATTTCTGTCCCACTGGTTGAGGGGGGGTGAAGTTGTCGCTGTAGTGGATTAAGCTTCACATCTGTTACCTTTTTTTAAGATTCACATCTGTTACCTTTTTACCAGATGTTTCCAGCTCTTTGGCtttttttttttttttGNCCAAAANTT
  5   1   2       bld DMZ       out                        xl330p06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGGAGAAAATTAAGCAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCTGGAGTTCAGATGCAAGCCGTTGCAGAGGACTCCATACACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAAAAACGTGGCCAATTTCAAAAAAGTAAAACGGGTTAAAACtgaagaggaaaaggaaggagaggacaagaaagatgttaaagaagaggagaaagctaaagaTGAGAAGACGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCTCATGGTTTTATATTTTGTATATGCCCTGTACAGAGCCCTACTATGAAATATAAGTCCACACATTCTAAATTATTTCTGTCCCACTGGTTGAGGGGGGGTGAAGTGGTCGCTGTAGTGGATTAAGCTTCACATCTGTTACCTTTTTTTAAGATTCACATCTGTTACCTTTTTACCAGATGTTTCCAGCTCTTTGGCtttttttttttttttttNG
  5   1   2       bld DMZ       out                        xl328h03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGGAGAAAATTAAGCAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCTGGAGTTCAGATGCAAGCCGTTGCAGAGGACTCCATACACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAAAAACGTGGCCAATTTCAAAAAAGTAAAACGGGTTAAAACtgaagaggaaaaggaaggagaggacaagaaagatgttaaagaagaggagaaagctaaagaTGAGAAGACGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCTCATGGTTTTATATTTTGTATATGCCCTGTACAGAGCCCTACTATGAAATATAAGTCCACACATTCTAAATTATTTCTGTCCCACTGGTTGAGGGGGGGTGAAGTGGTCGCTGTAGTGGATTAAGCTTCACATCTGTTACCTTTTTTTAAGATTCACATCTGTTACCTTTTTACCAGATGTTTCCAGCTCTTTGGCttttttttttttttttt
  5   1   2       bld Ga15      in                       XL462l22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCAGCGCCTCTTTGAGAACTTGCGCATGCTCCCCCATGCTCCTGGAGTTCAGATGCAAGCCGTTGCAGAGGACTCCATACACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAAAAACGTGGCCAATTTCaaaaaagtaaaacgggttaaaactgaagaggaaaaggaaggagaggacaagaaagatgttaaagaagaggagaaagctaaagatgagaagaCGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCTCATGGTTTTATATTTTGTATATGCCCTGTACAGAGCCCTACTATGAAATATAAGTCCACACATTCTAAATTATTTCTGTCCCACTGGTTGAGGGGGGGTGAAGTTGTCGCTGTANTGGATTAAGCTTCNCATCTGTTACCTTTTTTTANNATTCNCATCTGTTACCTTTTTACCANATGTTTCCNGCTCTTTGGCttttcttttttttttNCNC
  5   1   2       bld Egg1                               PBX0127B07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGCGCATGCTCCCCCATGCTCCTGGAGTTCAGATGCAAGCCGTTGCAGAGGACTCCATACACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAAAAACGTGGCCAATTTCAAAAAAGTAAAACGGGTTAAAACtgaagaggaaaaggaaggagaggacaagaaagatgttaaagaagaggagaaagctaaagaTGAGAAGACGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCTCATGGTTTTATATTTTGTATATGCCCTGTACAGAGCCCTACTATGAAATATAAGTCCACACATTCTAAATTATTTCTGTCCCACTGGTTGAGGGGGGGTGAAGTGGTCGCTGTAGTGGATTAAGCTTCACATCTGTTACCTTTTTTTAAGATTCACATCTGTTACCTTTTTACCAGATGTTTCCAGCTCTTTGGCttttttttttttt
  5   1   2       chi Ov1                             IMAGE:8331760.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATGCAAGCCGTTGCAGAGGACTCCATACACGAGGACAGTGGTGAAGAAGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAAAAACGTGGCCAATTTCAAAAAAGTAAAACGGGTTAAAACTGAAGAGGAAAAggaaggagaggacaagaaagatgttaaagaagaggagaaagctaaagatgagaagaCGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCTCATGGTTTTATATTTTGTATATGCCCTGTACAGAGCCCTACTATGAAATATAAGTCCACACATTCTAAATTATTTCTGTCCCACTGGTTGAGGGGGGGTGAAGTGGTCGCTGTAGTGGATTAAGCTTCACATCTGTTACCTTTTTACCAGATGTTTCCAGCTCTTTGGCtttttttttttttttttGACCAAAAACTTTCCATGTTTTCCTGTGCCTCTGTAATCTTCGGTGGTGCAATGCATTACGGATTTATTTCCCTGCTCCCTTCTATACACACTTTTGCTGTCAGACTACAAGACTTTTTTGCTACAGTACATTGGAAATATGTACACCTTATGCTAG
  5   1   2       bld Ga18                              xlk134e15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGCAAGCCGTTNNAGAGGANTCCATACACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAAAAACGTGGCCAATTTCAAAAAAGTAAAACGGGTTAAAACtgaagaggaaaaggaaggagaggacaagaaagatgttaaagaagaggagaaagctaaagaTGAGAAGACGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCTCATGGTTTTATATTTTGTATATGCCCTGTACAGAGCCCTACTATGAAATATAAGTCCACACATTCTAAATTATTTCTGTCCCACTGGTTGAGGGGGGGTGAAGTGGTCGCTGTAGTGGATTAAGCTTCACATCTGTTACCTTTTTTTAAGATTCACATCTGTTACCTTTTTACCAGATGTTTCCAGCTCTTTGGCttttttttattttttttGACCAAAAACTTTCCATGTTTTCCTGTGCCTCTGTAATCATCGGTGGNNCAATGCATTACGGATTTATTTCCCTGCTCCCTTCTATACACACTTTTGCTGTCAGACTACAAGACTTTTTTGCTACAGTACATTGGAAANNTG
  5   1   2       bld Ga15      in                       XL448o06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGTTGCAGAGGACTCCATACACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGACNAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAAAAACGTGGCCAATTTCaaaaaagtaaaacgggttaaaactgaagaggaaaaggaaggagaggacaagaaagatgttaaagaagaggagaaagctaaagatgagaagaCGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCTCATGGTTTTATATTTTGTATATGCCCTGTACAGAGCCCTACTATGAAATATAAGTCCACACATTCTAAATTATTTCTGTCCCACTGGTTGAGGGGGGGTGAAGTTGTCGCTGTAGTGGATTAAGCTTCACATCTGTTACCTTTTTTTAAGATTCACATCTGTTACCTTTTTACCAGATGTTTCCAGCTCTTTGGCtttttttttttttttNNCCAAAANTT
  5   1   2       bld Gas9                                 BG409875.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCACGCGTCCGCACGATGACAGTGGTGAAGAAGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAAAAACGTGGCCAATTTCAAAAAAGTAAAACGGGTTAAAACTGAAGAGGAAAAGgaaggagaggacaagaaagatgttaaagaagaggagaaagctaaagatgagaagaCGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCTCATGGTTTTATATTTTGTATATGCCCTGTACAGAGCCCTACTATGAAATATAAGTCCACACATTCTAAATTATTTCTGTCCCACTGGTTGAGGGGGGGTGAAGTTGTCGCTGTAGTGGATTAAGCTTCACATCTGTTACCTTTTTTTAAGATTCACATCTGTTACCTTTTTACCAGATGTTTCCAGCTCTTTGGCtttttttttttttttGCCAAAAACTTTCCATGTTTTCCTGTGCCTCTGTAATCTTCGGNGGNGCAATGCATTACNGATTTTATTTCCCTGCTCCTTCTATACACACTTTTGCTGNCAGACTACAAAGACTTTTTTGCTCCAGTACATTGGNAATATGTNCACCTTATGCTCAGGATCAGGCANTGAAAANGANGNGGGTTCCANCCGTCTT
  5   1   2       bld Ga15      in                       XL514p09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGATGAAGATGATCCCGACAAGCGTATTTCAATTCGGTCATCAGATAAAAGGATTGCCTGTGATGAGGAGTTCTCAGATTCTGAGGATGAAGGGGAGGGAGGTCGCAAAAACGTGGCCAATTTCAAAAAAGTAAAACGGGTTAAAACTGAAGAGGAAAAGgaaggagaggacaagaaagatgttaaagaagaggagaaagctaaagatgagaagaCGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCTCATGGTTTTATATTTTGTATATGCCCTGTACAGAGCCCTACTATGAAATATAAGTCCACACATTCTAAATTATTTCTGTCCCACTGGTTGAGGGGGGGTGAAGTTGTCGCTGTAGTGGATTAAGCTTCACATCTGTTACCttttttttAAGATTCACATCTGTTACCTTTTTACCAGATGTTTCCAGCTCTTTGGCtttttttttttttttNCCCAAAANNTT
  5   1   2       bld Gas5      out                   IMAGE:3747455.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAATTTCaaaaaagtaaaacgggttaaaactgaagaggaaaaggaaggagaggacaagaaagatgttaaagaagaggagaaagctaaagatgagaAGACGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCTCATGGTTTTATATTTTGTATATGCCCTGTACAGAGCCCTACTATGAAATATAAGTCCACACATTCTAAATTATTTCTGTCCCACTGGTTGAGGGGGGGT
  5   1   2       bld Ga15      in                       XL479l02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TtaaaactgaagaggaaaaggaaggagaggacaagaaagatgttaaagaagaggagaaagCTAAAGATGAGAAGACGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCTCATGGTTTTATATTTTGTATATGCCCTGTACAGAGCCCTACTATGAAATATAAGTCCACACATTCTAAATTATTTCTGTCCCACTGGTTGAGGGGGGGTGAAGTTGTCGCTGTAGTGGATTAAGCTTCACATCTGTTACCTTTTTTTAAGATTCACATCTGTTACCTTTTTACCAGATGTTTCCAGCTCTTTGGCttttttttttttttNGNCCAAAANNT
  5   1   2       bld Ga15                               XL428h18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGAGGACAAGAAAGATGTTAAAGAAGAGGAGAAAGCTAAAGATGAGAAGACGGATAGCAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCTCATGGTTTTATATTTTGTATATGCCCTGTACAGAGCCCTACTATGAAATATAAGTCCACACATTCTAAATTATTTCTGTCCCACTGGTTGAGGGGGGGTGAAGNTGTCGCTGTAGTGGATTAAGCTTCACATCTGTTACCTTTTTTTAAGATTCACATCTGTTACCTTTTTACCAGATGTTTCCAGCTCTTTGGCttttttttttttttGGNC
  5   1   2       bld Egg2                            IMAGE:5162524.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGAAGAGGAGATTGCTAAAGATGAGAAGACGGATTTTAAACGGGTAAAAGAAGAGACCAAATCAGTCTGATCCTTCAACTATGGGGAGAAAATCCGAAGACCAAACTAATTCTCATGGTTTTATATTTTGTATATGCCCTGTACAGAGCCCTACTATGAAATATAAGTCCACACATTCTAAATTATTTCTGTCCCACTGGTTGAGGGGGGGTGAAGTGGTCGCTGTAGTGGATTAAGCTTCACATCTGTTACCTTTTTTTAAGATTCACATCTGTTACCTTTTTACCAGATGTTTCCAGCTCTTTGGCtttttttttttttttttGACCAAAAACTTTCCATGGTTTCCTGTGTCTCTGTAATCATCGGTGGTGCTATGCATTACGGATTTATTTCCCTGCTCCCT
  3  -1   2       bld Emb1                            IMAGE:3401282.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTTTTTTTTTTTTTTTTTTTTTAAGGGATAAGTACCAGATTTTATTACAAAGCTTTTCTACAACTCAACCATAAAAAAAAAAAAAAAGAAATTTCCCATCACAAAAATTGGACATAAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTGCAACCCACTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGGAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCT
  3   1   2       bld Ga18      in                      xlk129j02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTTTTTTTTTTTTTTTTTTTATAANTNCCAGATTTTATTNCAAAGCTTTTCTNCANCTCACCCATAAAAAAAAAAAAAAAAAAAGAAATTNCNNNTCACAAAAATTGGACATAAAAATTNTCCATTTTCTTCNCTCCATGAATCCAGACACTCTCCAACCCACTAAGATTAAAGGCAGAANCCCAAATTGCAAATCCCCACAATNCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGAACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAANTCCGTANNCNNNNNNCNNCGATGA
  5   1   2       bld Ooc2      out                   IMAGE:3745229.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTCGGGtttttttttttttttttATAAGTACCAGATTTTATTACAAAGCTTTTCTACAACTCAACCATaaaaaaaaaaaaaGAAATTTCCCATCACAAAAATTAGACATAAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCAACCCACTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGAACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACAGCTGGAACCCACCTCCTTCTCA
  3   1   2       bld Ga18 5g   in                      xlk166n17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTTTTTTTTTTTTTTTNAGGTATAAGTACCAGATTTTATTACAAAGCTTTTCTACAACTCAACCATAAAAAAAAAAAAAAGAAATTTCCCATCACAAAAATTGGACATAAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCAACCCACTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAANTCCGTANNCNNNNNNCNCCGAAGATTACAG
  3  -1   2       bld Oo1       in                    IMAGE:5078572.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTTTTTTTTTTAAGGGATAAGTACCAGATTTTATTACAAAGCTTTTCTACAACTCAACCATAAAAAAAAAAAAAAGAAATTTCCCATCACAAAAATTGGACATAAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCAACCCACTAAGATTAAAGGGAGAAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGGAACTGGGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAG
  3   1   2       bld Ga18 5g   in                      xlk155i16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTTTTTTTTnTTTTTTNNNGNNTAAAANACAANNNTTTTNTACAANTNNNNCATAAAAAAAAAAAAAAGAAATTTCNCATCACAANANTTGGACATAAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCAACCCACTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATCCGTANNCNNNNNNCACCGAAGATNACANNNGCAC
  5   1   2       bld Egg1                               PBX0032C07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTTTATAAGTACCAGATTTTATTACAAAGCTTTTCTACAACTCAACCATaaaaaaaaaaaaaaaaaagaaatttcccatcacaaaaattggacataaaaatTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCAACCCACTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGAACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATCCGTAATGCATTGCACCACCGATGATTACAGAGGCACAGGAAAACATGGAAAGTTTTTGGTCaaaaaaaaaaaaaaaaaaGATTC
  5  -1   2       bld Ga18                              xlk133d16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ttttttttttATAAGTNCCAGATTTTATTACAAAGCTTTTCTACAACTCANCCATaaaaaaaaaaaaaaaGAAATTTCCCATCACAAAAATTGGACATAAAANTTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCAACCCACTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATCCGTANNCNNTGCACCACCGAAGATTACAGAGGCA
  5   1   2       bld Egg1                               PBX0166E11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATAAGTACCAGATTTTATTACAAAGCTTTTCTACAACTCAACCATaaaaaaaaaaaaaaaaaaGAAATTTCCCATCACAAAAATTGGACATAAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCAACCCACTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGAACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATCCGTAATGCATTGCACCACCGATGATTACAGAGGCACAGGAAAACATGGAAAGTTTTTGGTCaaaaaaaaaaaaaaaaa
  5   1   2       bld Egg1                               PBX0029C08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATTTTATTACAAAGCTTTTCTACAACTCAACCATaaaaaaaaaaaaaaaaaaGAAATTTCCCATCACAAAAATTGGACATAAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCAACCCACTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGAACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATCCGTAATGCATTGCACCACCGATGATTACAGAGGCACAGGAAAACATGGAAAGTTTTTGGTCaaaaaaaaaaaaaTAAAAGATTC
  5  -1   2       bld Ga15                               XL435d19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATTTTNTTNCAAAGNTTTTTTTCAACTCNNCCNTaaaaaaaaaaaaaaGAAATTTCCCATCACAAAAATTGGACATAAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCAACCCACTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGG
  5   1   2      seed Emb4                            IMAGE:4970582.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTTCTGTTTTCGCGTGCCTCCGGTGTCTTCGGGTGgtgaaaaaaagaaatttcccatcacaaaaattgtgacataaaaatTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCAACCCACTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATCCGTAATGCATTGCACCACCGAAGATTACAGAGGCACAGGAAAACATGGAAAGTTTTTGGTCaaaaaaaaaaaaaaaGCCAAAGAGCTGGAAACATCTGGTAAAAAGGTAACAGATGTGAATCTTAAAAAAAGGTAACAGATGTGAAGCTTAATCCACTACAGCGACAACTTCACCCCCCCTCAACCAGTGGGACAGAAATAATTTAGAATGTGTGGACTTATATTTCATAGTAAGGCTCTGTACAGGGCATATACCAAATATAAAACCTTGAGAAATTATTTGGGTCTTCGGATTTTCTCCCCCTAGTTGAAGGATCAGACTGATTTGGTCTCTTCCTTTACCCGTTTGCTATCCGTCN
  3  -1   2       bld Thy       in                    IMAGE:8546618.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTTCTGTTTTCGGTGCCTCGTATCTTCGGTGGTGAAAAGAAAGAAATTTCCCATCACAAAGATTAGACATAAAAATTCTCCATTTGCTTCACTCCATGAATCCAGACACTCTCCAACCCACTAAGATTAAAGGCAGAAACCCAGATTGCGAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGAACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACAGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAAGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATCCGTAATGCATTGCACCACCGAAGATTACAGAGGCACAGGAAAACATGGAAAGTTTTTGGTCAAAAAAAAAAAAAAGCCAAAGAGCTGGAAACATCTGGTAAAAAGGTAACAGATGTGAATCTTAAAAAAAGGTAACAGATGTGAAGCTTAATCCACTACAGCGACCACTTCACCCCCCCTCAACCAGTGGGACAGAAATAATTTAGAATGTGTGGACTTATATTTCATAGTAGGGCTCTGTACAGGGCATATACAAATATAAAACCATGAAATTAGTTGGNNTCTCNGATTTTCTCCCATAGTTGAAGATCAACTGATTTGTCTCTTCTTTACCCGTTGC
  5  -1   2       bld Ga15                               XL450m01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGNTTTTTTTCAACTCANCCNTaaaaaaaaaaaaaaGAAATTTCCCATCACAAAAATTGGACATAAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCAACCCACTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTG
  5  -1   2       bld Ga15                               XL440h23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TaaaaaaaaaaaaaaaaaaaGAAATTTCCCATCACAAAAATTGGACATAAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCAACCCACTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGAACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATCCGTAATGCATTGCACCA
  3   1   2       bld Ga15      in                       XL514p09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GNAAAAAAAAAAAAGAAATTTCCCATCACAAACNNTTGGACATAAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCANCCCANTAAGANNNAAGGCAGAAACCCAAATNGCAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCNCACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATNTGGAAGACCGGCTGGAACCCACCTCNTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATCCGTAATGCAT
  3   1   2       bld Ga15 5g   in                       XL416m01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAAAAAAAAAAAGAAATTTCCCATCACAAAAATTGGACATAAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCAACCCACTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATCCGTAATGCATGCACCACCGAAGATTACAGAG
  3   1   2       bld Ga15      in                       XL462l22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAAAAAAAAAAAGAAATTTCCCNTCACAANAATTGGACATAAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTNTCCAACCCANTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATCCGTAATGCATTGCACCAC
  3   1   2       bld Ga15      in                       XL479l02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAAAAAAAAGAAATTTCCCATCACAAAAATTGGACATAAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCANCCCACTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCANTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATCCGTAATGCAT
  3   1   2       add DMZ                                 rxl229l16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ANNAAAANAGAAATNTCCCATCNCNAAAATTGGACATAAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCACCCCGNTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACANTCNCCNNTNTNAGGTANCTGTGGACCAGGTTTCCACNNNTNTNNAAATNNGCTTCATGNNGTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACNGGGANTCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTNAAATTCATTTGGANGACGGCTGGAACCCACC
  3   1   2       add DMZ                                 rxl289e17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAANAGAAATNTCCCATCNCNNAAATTNGACATAAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCANCCCGNTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACANTCCCCNNTNTAAGGTANCTGTGGACCAGGTTTCCNCACNTNTANAAATNNGCTTCATGNNGTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACNGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCAGCTGCCTGATCCTGAGCNTAAGGTGTACATATTTCCAATGTNCGGTAGCAAAAAAGTCTTGTAGTCTGACANCAAAAG
  3   1   2       add DMZ  5g   in                         xl253h16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CNAAAATTGGACATAAAAATTCTCCATTTTCTTCACTCCANGAATCCNGACACTCTCCANCCCGNTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACANTNNCCGNTNTAAGGTATCTGTGGACCAGGTTTCCACACNTNTANAAATNNGCTTCANGNGGTAATCTGGAGGAGGGTTAGCAGCATTAAGNGTACGGGGAATCCCTGAATAGNTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTNAAANTCATTTGGANGACGGCTGGAACCC
  3   1   2       add Ga15 5g   in                       XL423l05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATAAAAATTCTCCATTTTCTTCACTCCATGAATCCAGACACTCTCCAACCCAGTAAGATTAAAGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCANTATANGGTNACTGTGGACCAGGTTTCCACACATCTAANAATCTGNTTCATGANGTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATNTGGAAGACGGCTGGAACCCACCTCCTTCTCGNTGCNTGATCCTGAGCATAAGGTGTACATATTTCCAANGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATCCGTAATGCATTGC
  3   1   2       bld Ga18 5g   in                      xlk156h01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CANAAAANTNNNNCATNTNCTTCNCNCCATGAATCCAGACACTCTCCNNCCCNCTAAGATNANAGGCAGAANNCCAAATNGNAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAANTCCGTA
  3   1   2       bld Ga15      in                       XL448o06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACTCCATGAATCCAGACACTCTCCAACCCANTAAGATTAANGGCAGAAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTNGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATCCGTAATGCATTGCACCA
  3   1   2       bld Ga18      in                       xlk57h14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCTCTAAGATTNNAGGCAGAANCCCNANTTGCAAATCCCCACNATCCCCNTTATAAGGTNACTGTGGACCAGGNTNCCACACATCTAAAAATCTGCTTCATGANCTAATCTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAANAANTCCNT
  3   1   2       add Ga15      in                       XL506p18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCNNTAAGATTAAANNCAGAAACCCAAATTGCAAATCCCCACAATCCNCATNATANGGNNACTGTGGACCAGGTTTCCACACATNTANNAATCTGNTTCATGNGGTAATCTGGAGGAGGNTTAGCAGCATTAAGAGTACNGGGAATCCCTGAATAGTNTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCNAATTCATNTGGAAGACGGCNGGAACCCACCTCCTTCTCGGTGCCTGATCCTGAGCATAAGGNGTACATATTTCCNANGTNNTGTAGCAAAAAAGTCTTGTAGTNTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATCNGTAATGCATTG
  3   1   2       bld Ga18                             rxlk160l19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CNNNGNTTAAAGGCAGANNNNCAANTTGCAAATCCCCACAATCCCCNTTATAAGGTANCTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTANTCTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTNCTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAANNGAGCAGGGAAATA
  5  -1   2       bld Egg5                            IMAGE:3431293.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAACCCAAATTGCAAATCCCCACAATCCCCATTATAAGGTAACTGTGGACCAGGTTTCCACACATCTAAAAATCTGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCATTAAGAGAACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGG
  3   1   2       bld Ga18      in                      xlk160k09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TNAAAATCNNCNNNATGNNCTAATCNGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATCCGTAANC
  3   1   2       bld Ga15      in                       XL445k18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTTCATGNNCTAATNTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATANTNTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTATCTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGGTGTGTATAGAAGGGAGCAGGGAAATAAATCCGTAATGC
  3   1   2       bld Gas6      out                   IMAGE:3474399.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCTTCATGAACTAATCTGGAGGAGGGTTAGCAGCAGACAGAACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCACATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATCCGTAATGCATTGCACCACCGAAGATTACAGAGGCACAGGAAAACATGGAAAGTTTTTGGTCAAA
  3   1   2       add Ga15      in                       XL444f21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAACTAATNTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTNNNAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCNTTCTCACTGCNTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGGCAGGGAAATAAATCCGTAATGCAT
  3   1   2       bld Ga15 5g   in                       XL443c20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTNNAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATNTGGAAGNCGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTTGTAGTCNGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAAATCCGTAATGCAT
  3   1   2       bld Ga18 5g   in                        xlk8o04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAGGAGGGTTAGCAGCATTAAGAGTACAGGGAATCCCTGAATAGTTTAGTTTAAGAGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTCTCAAATTCATTTGGAAGACGGCTGGAACCCACCTCCTTCTCACTGCCTGATCCTGAGCATAAGGTGTACATATTTCCAATGTACTGTAGCAAAAAAGTCTNGTAGTCTGACAGCAAAAGTGTGTATAGAAGGGAGCAGGGAAATAA
  3   1   2       add DMZ                                 rxl290e17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGGAGGGTTAGCAGCATTNAGAGTACNGGGAATCCGTGAATAGTTTAGTTTAAGNGGAGCTTCAGCTTCCCCCTCCATCCCTCAAGGTAACCCTGTCAAAATCATTTGGAAGAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)